Team:NEU-China/Safety

Q1. List and describe all new or modified coding regions you will be using in your project.

Species	Risk Group	Risk Group Source	Disease risk to humans?	Part number/name	Natural function of part	How did you acquire it?	How will you use it?	Notes
homo sapiens	2	Safety/Risk_Groups	No	BBa_K2288000	Olfactory receptor OR1A1 can bind to β-citronellol and transduce downstream signal into the cytosol.	OR1A1 instert was PCR-amplified from HEK293FT genonmic DNA.	OR1A1 expression vector is transfected into HEK293FT cells to construct the signaling circuit in response to odor molecule β-citronellol.	A Rho tag (accgagacatctcaggtggcccctgcc) was added to the N-terminal of OR1A1 CDS region as the whole instert
homo sapiens	2	Safety/Risk_Groups	No	BBa_K2288001	Olfactory receptor OR1D2 can bind to bourgeonal and transduce downstream signal into the cytosol.	OR1D2 instert was PCR-amplified from HEK293FT genonmic DNA.	OR1D2 expression vector is transfected into HEK293FT cells to construct the signaling circuit in response to odor molecule bourgeonal.	A Rho tag (accgagacatctcaggtggcccctgcc) was added to the N-terminal of OR1D2 CDS region as the whole instert

Q2. What is the Safety Level of your lab?

Level 1 (low risk)

Q3. Which work areas do you use to handle biological materials?

Open bench.

Q4. a) Have your team members received any safety training yet?

Yes, we have already received safety training.

Q4. b) Please briefly describe the topics that you learned about (or will learn about) in your safety training.

Lab access and rules (including appropriate clothing, eating and drinking, etc.)
Responsible individuals (such as lab or departmental specialist or institutional biosafety officer)
Differences between biosafety levels
Good microbial technique (such as lab practices)
Disinfection and sterilization
Emergency procedures
Transport rules
Chemicals, fire and electrical safety

Q4. c) Who provided your safety training? Did you get training from multiple people?

University biosafety office
Departmental specialist

Q5. Who is responsible for the safety of biology labs at your institution? What are the guidelines for laboratory biosafety?

Teng Fei who is is a professor at our college (College of Life Science and Health, Northeastern Universtiy). Here are some guidelines of laboratory safety regulations:
1. Every students should consciously abide by the laboratory disciplines and safeguard the order of the laboratory.
2. Must carefully prepare before experiments, familiar with the purpose of this experiment, principle, operation steps, Understand the significance of each operation steps and understand the use of instruments, otherwise you can't start the experiment.
3. Experim ental mesa should be clean and tidy, and instruments, medicines should be placed neatly. Common reagents should be covered tightly in place immediately after used up. Don't make the reagents, and drug sprinkled on experimental mesa. You are not be allowed to leave the laboratory untill you clean the mesa and ensure all the instruments are turned off.
4. Waste liquid will be poured into the water tank with water at the same time. Must use strong acid, strong alkali solution diluted by water. Waste paper and other solid waste can be throwed into a cylinder which can be dealt after experiment. Don't throw Into the sink or throw everywhere.
5. To achieve sterilization, open uv lamp for 30 to 60 minutes in sterile room space for 30 to 60 minutes.
6. Check the equipment, must be separately sterilized before moving in sterile room.
7. Dress white coats, sterile working clothes, gloves.
8. You have to sterilize your hands before the operation in aseptic environment .
9. Movements should be light and not too fast to avoid pollution. Move glasses softly in order to avoid damage.
10. Must operate in accordance with the relevant provisions of sterile operation.
11. All discharges of discarded reagents and microbial must be treated as harmless.
12. If you are uncomfortable in the process of experiment, immediately stop experiment.
13. Pay attention during animal feeding, wear work clothes and gloves, if you are bitten, go to hospital immediately.
14. Laboratory medicine can not be medical use and shall not be eaten.

Q6. In your country / region, what are the laws and regulations that govern biosafety in research laboratories?

Here are some links to regulations concerning biosafety in research laboratories in China:
1. http://www.moa.gov.cn/fwllm/zxbs/xzxk/bszl/201405/t20140527_3918356.htm
This is our national laws about biosafety.
2. http://www.zzwxp.com/news/show-872.html
This is a book about the standard requirments of laboratory safety and it refers to lots of international biosafety regulations such as :
1. The Minister ofHealth, Canada. The Laboratory Biosafety Guidelines [M]. 3rd ed. Ottawa: HealthCanada, 2004.U.S. Department of Health and Human Services, Centers for Disease Control and Prevention, National Institutes of Health.
2. Biosafety in Microbiological and Biomedical Laboratories[M].5th ed. Washington: U. S.Government Printing Office, 2007
3. Microbiological aspects and containment facilities[S]. New Zealand: StandardsAustralia, 2002 European Committee for Standardization.
4. Determining leakage of filter element (Scan method) [S].Brussels: European Committee for Standardization, 2000.
5. Laboratory biorisk management standard[S]. Brussels: European Committee for Standardization, 2008.
6. Medical laboratories-Ã‚ÂParticular requirements for quality and competence [S]. Geneva: International Organization for Standards, 2007.
7. Containment enclosures: Part 2: Classification according to leak tightness and associated checking methods [S].Geneva:International Organization for Standards, 1994.
8. Laboratory biosafety manual [M]. 3rd ed.Geneva:World Health Organization, 2004.
3. http://www.chinabaike.com/z/keji/shiyanjishu/2011/0116/166965.html
This is a book about General biosafety standard for microbiological and biomedical laboratories