Team:SECA NZ/Parts

SB Admin - Start Bootstrap Template

Our Part

The part we submitted to the BioBrick Registry

BBa_K2291001

The Ice Inhibitor

Sequence - 669bp

atggcgaactgctgtctcttattattgtttctggcccttttgctacctgcggcatctgctacgagttgccatccggatgatcttcacgcccttagagggttcgccggaaacctctctgggggaggagtgctgcttagaagtgtgtggagtggcgattcatgttgcggctgggaaggagtaggatgcgacgacgcttccggaagggtgaccacaatgtggctcccccgaagagggctcgtcaaacccgtaccaggcgcctccctcgctggcgtcacagaattggaggaactcataacgaggaacagacgagccttggaagaacagcctaacaccatacaaggtacgaataacaatgtcagggacgggtgttacaacgctttgtccggcaacgataatacggttataagcggcaataataacactgtatcaggatcttttaatacgatcgtgaccggatgtcataatactgtatcagggtctaatcaggttgtcagtggtctgaaccacattgtgaccgatgataataatgatgttagtggcaacgataataacgtatcaggttcattccacacggtctccggcagtcacaacaccgtcagcggatcaaataatacggttagcggcaggaatcacgtagtaaccggtagcaataaagtagttactggtgga

Origin and Purpose

This part comes from the DaIRIP4 protein from Antarctic Hairgrass, Deschampsia antarctica.

This protein is an ice recrystallisation inhibition protein designed to stop ice crystals from growing and breaking cell membranes.

Characterisation

Initial testing shows that the DaIRIP4 protein is effective in the model plant chassis, Arabidopsis thaliana. It is currently unclear how effective this part would be in other organisms. Further characterisation of the part using the BioBrick system would be valuable.

Further information on this part can be found in the BioBrick Registry

Loading.....