Team:Tongji China/InterLab
Tongji iGEM
Tongji iGEM
InterLab
We partecipated in the 4th iGEM Interlab study along with about 100 teams.
We have focused on quantifying the expression of GFP in common,
comparable or absolute units.
expand_more
We have focused on quantifying the expression of GFP in common,
comparable or absolute units.
expand_more
Background & Design
Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader.
It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells.
Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.
We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP.
However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.
It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells.
Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.
We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP.
However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.
Description
Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli.
3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.
3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.
Results
Sequencing
| Length | Sequence | |
|---|---|---|
| BBa_R0040 Part-only sequence | 54 bp | tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac |
| BBa_J23101 Part-only sequence | 35 bp | tttacagctagctcagtcctaggtattatgctagc |
| BBa_J23106 Part-only sequence | 35 bp | ttacggctagctcagtcctaggtatagtgctagc |
| BBa_J23117 Part-only sequence | 35 bp | ttgacagctagctcagtcctagggattgtgctagc |
| BBa_J364100 Part-only sequence | 84 bp | gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttct |
| BBa_B0010 Part-only sequence | 80 bp | ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc |
| BBa_B0012 Part-only sequence | 41 bp | tcacactggctcaccttcgggtgggcctttctgcgtttata |
| BBa_E0040 Part-only sequence | 720 bp | atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtg atgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaa acttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtc actactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatg actttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaaga tgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaataga atcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaat acaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagt taacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaa caaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacac aatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgt aacagctgctgggattacacatggcatggatgaactatacaaataataa |
Table 1 - OD600 Reference Point
| LUDOX-HS40 | H2O | |
|---|---|---|
| Replicate 1 | 0.00624 | -0.00726 |
| Replicate 2 | 0.00684 | -0.00526 |
| Replicate 3 | 0.00734 | -0.00366 |
| Replicate 4 | 0.01104 | -0.00476 |
| Arithmetic Mean | 0.007865 | -0.00524 |
| Corrected Abs600 | 0.0131 | |
| Reference OD600 | 0.0425 | |
| OD600/Abs600 | 3.244275 |
Table 2 - FITC Standard Curve
| uM Fluorescein | Replicate 1 | Replicate 2 | Replicate 3 | Replicate 4 | Arith. Mean | Arith. Std.Dev. |
|---|---|---|---|---|---|---|
| 50 | 61138.13773 | 65271.06373 | 64591.86073 | 65095.54373 | 64024.15148 | 1945.425461 |
| 25 | 46595.20773 | 47958.14973 | 47759.33273 | 46973.06773 | 47321.43948 | 644.4444304 |
| 12.5 | 28000.11673 | 29885.96173 | 29220.19473 | 29151.63573 | 29064.47723 | 783.0590871 |
| 6.25 | 15683.49573 | 16760.13373 | 16218.20373 | 16178.31273 | 16210.03648 | 440.0474392 |
| 3.125 | 8520.498733 | 8943.591733 | 8732.387733 | 8904.756733 | 8775.308733 | 193.0857332 |
| 1.5625 | 3763.249733 | 4130.652733 | 3895.511733 | 4038.104733 | 3956.879733 | 161.3000976 |
| 0.78125 | 1812.487733 | 2054.542733 | 1959.396733 | 2020.259733 | 1961.671733 | 106.9557819 |
| 0.390625 | 985.464733 | 1054.489733 | 1024.705733 | 1069.755733 | 1033.603983 | 37.14713908 |
| 0.1953125 | 497.078733 | 527.161733 | 514.866733 | 522.469733 | 515.394233 | 13.21958841 |
| 0.09765625 | 244.808733 | 261.900733 | 248.052733 | 257.166733 | 252.982233 | 7.919506613 |
| 0.048828125 | 119.568733 | 122.370733 | 123.219733 | 127.955733 | 123.278733 | 3.48646784 |
| 0 | 0.419733 | 0.411733 | 0.046733 | 0.241733 | 0.279983 | 0.175837757 |
Figure 1 - Fluorescein standard curve
Figure 2 - Fluorescein standard curve [log scale]
![Fluorescein standard curve [log scale]](https://static.igem.org/mediawiki/2017/8/8c/2017tongji_image_fluorescein_standard_curve_log_scale.png)
Table 3 - Raw data of Abs600 measurement
| 0 | 2 | 4 | 6 | ||
|---|---|---|---|---|---|
| Negative Control | CLONE 1 | 0.0295 | 0.130507 | 0.314472 | 0.42238 |
| CLONE 2 | 0.031975 | 0.135382 | 0.354122 | 0.43548 | |
| Positive Control | CLONE 1 | 0.0305 | 0.161232 | 0.351597 | 0.488955 |
| CLONE 2 | 0.02885 | 0.162257 | 0.417697 | 0.50018 | |
| Test Device 1 | CLONE 1 | 0.028375 | 0.057732 | 0.148547 | 0.269505 |
| CLONE 2 | 0.02985 | 0.048457 | 0.112622 | 0.20678 | |
| Test Device 2 | CLONE 1 | 0.0314 | 0.148682 | 0.394347 | 0.46823 |
| CLONE 2 | 0.029025 | 0.125007 | 0.375497 | 0.43273 | |
| Test Device 3 | CLONE 1 | 0.030775 | 0.167307 | 0.400422 | 0.456205 |
| CLONE 2 | 0.027175 | 0.156457 | 0.405647 | 0.483105 | |
| Test Device 4 | CLONE 1 | 0.0305 | 0.158857 | 0.398722 | 0.45088 |
| CLONE 2 | 0.03015 | 0.155507 | 0.401822 | 0.453755 | |
| Test Device 5 | CLONE 1 | 0.0362 | 0.163682 | 0.410647 | 0.472155 |
| CLONE 2 | 0.03205 | 0.142507 | 0.377622 | 0.436505 | |
| Test Device 6 | CLONE 1 | 0.03545 | 0.176682 | 0.385822 | 0.45088 |
| CLONE 2 | 0.02795 | 0.153382 | 0.402072 | 0.449205 |
This is the average of each clone, click here to see the original data. [Excel file]
Figure 3 - Correction of Abs600 measurement
Table 4 - Raw data of fluorescence measurement
| 0 | 2 | 4 | 6 | ||
|---|---|---|---|---|---|
| Negative Control | CLONE 1 | 1.08025 | 2.16875 | 16.13602 | 29.83945 |
| CLONE 2 | 1.96175 | 1.974 | 19.02202 | 32.08245 | |
| Positive Control | CLONE 1 | 13.218 | 157.839 | 413.9833 | 493.0602 |
| CLONE 2 | 19.26725 | 178.7663 | 485.3383 | 578.5027 | |
| Test Device 1 | CLONE 1 | 203.4893 | 515.1385 | 1366.608 | 2527.968 |
| CLONE 2 | 216.369 | 550.578 | 1161.084 | 2002.293 | |
| Test Device 2 | CLONE 1 | 52.94075 | 330.942 | 1212.613 | 1625.767 |
| CLONE 2 | 57.626 | 300.5665 | 1104.674 | 1431.868 | |
| Test Device 3 | CLONE 1 | 2.81475 | 4.924 | 32.52677 | 47.32195 |
| CLONE 2 | 3.3015 | 4.3785 | 31.76152 | 56.2147 | |
| Test Device 4 | CLONE 1 | 2.65525 | 6.173 | 34.00727 | 45.5552 |
| CLONE 2 | 2.00575 | 5.008 | 37.20552 | 51.47795 | |
| Test Device 5 | CLONE 1 | 19.70225 | 167.6278 | 435.9625 | 529.8542 |
| CLONE 2 | 17.1425 | 140.0155 | 430.8645 | 498.9205 | |
| Test Device 6 | CLONE 1 | 3.124 | 5.37275 | 19.22877 | 30.8587 |
| CLONE 2 | 1.186134 | 5.4735 | 27.23052 | 39.53995 |
This is the average of each clone, click here to see the original data. [Excel file]
Figure 4 - Correction of fluorescence measurement
Table 5 - Raw data of Fl/Abs600
| 0H | 2H | 4H | 6H | ||
|---|---|---|---|---|---|
| Negative Control | Colony 1 | 0.0049 | 0.0021 | 0.0066 | 0.0091 |
| Colony 2 | 0.0080 | 0.0019 | 0.0070 | 0.0095 | |
| Positive Control | Colony 1 | 0.0559 | 0.1265 | 0.1525 | 0.1303 |
| Colony 2 | 0.0866 | 0.1422 | 0.1501 | 0.1493 | |
| Test Device 1 | Colony 1 | 0.9270 | 1.1547 | 1.1894 | 1.2126 |
| Colony 2 | 0.9366 | 1.4767 | 1.3349 | 1.2506 | |
| Test Device 2 | Colony 1 | 0.2177 | 0.2875 | 0.3997 | 0.4487 |
| Colony 2 | 0.2583 | 0.3105 | 0.3807 | 0.4273 | |
| Test Device 3 | Colony 1 | 0.0118 | 0.0038 | 0.0104 | 0.0133 |
| Colony 2 | 0.0166 | 0.0036 | 0.0102 | 0.0150 | |
| Test Device 4 | Colony 1 | 0.0114 | 0.0050 | 0.0109 | 0.0130 |
| Colony 2 | 0.0089 | 0.0042 | 0.0120 | 0.0146 | |
| Test Device 5 | Colony 1 | 0.0710 | 0.1324 | 0.1375 | 0.1449 |
| Colony 2 | 0.0685 | 0.1269 | 0.1476 | 0.1476 | |
| Test Device 6 | Colony 1 | 0.0113 | 0.0039 | 0.0064 | 0.0088 |
| Colony 2 | 0.0055 | 0.0046 | 0.0087 | 0.0114 |
This is the average of each clone, click here to see the original data. [Excel file]
Figure 5 - Average level of devices
Conclusions
It is noticeable that the promoter of the Device 1 is the strongest followed by the promoters of the devices 2 and 5. But the device 3, 4 and 6 are not active.
Methods & Materials
Strain used: E. coli DH5-alpha
Plasmid DNA (100 pg/uL in 10uL of water)
Materials
Plasmid DNA (100 pg/uL in 10uL of water)
Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3
Negative Control (BBa_R0040): R0040 in pSB1C3
Test Device 1 (BBa_J364000): J23101.B0034.E0040.B0010.B0012 in pSB1C3
Test Device 2 (BBa_J364001): J23106.B0034.E0040.B0010.B0012 in pSB1C3
Test Device 3 (BBa_J364002): J23117.B0034.E0040.B0010.B0012 in pSB1C3
Test Device 4 (BBa_J364003): J23101.J364100.E0040.B0010.B0012 in pSB1C3
Test Device 5 (BBa_J364004): J23106.J364100.E0040.B0010.B0012 in pSB1C3
Test Device 6 (BBa_J364005): J23117.J364100.E0040.B0010.B0012 in pSB1C3
Materials
FITC Standard: one tube with dried down FITC for creating a FITC standard
LUDOX: one tube with 30% colloidal silica suspended in 1mL of water
1xPBS (phosphate buffered saline)
LB (Luria Bertani) media
Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH)
50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth
1.5 ml eppendorf tubes for sample storage
Ice bucket with ice
Pipettes
Black 96 well plate
Machines: SpectraMax M5, SPX-150B-Z biochemical incubator and THZ-312 Thermostatic oscillator
Software: Microsoft Excel and pro5
Calibration: OD600 Reference point and FITC fluorescence standard curve
Cell measurement: Transformation and Measurements
Protocol for calibration and measurement
Raw Data
Ignis Fly
Tongji_China iGEM 2017 Team
Processchevron_right
