Team:UPMC PARIS/Experiments

Impact UPMC

Part I - Characterization of the relative strength of some promoters with polycistronism effect

Introduction :

The insertion of chaperone genes in bacterial chromosome is an efficient system to ensure the stability of our optimized E. coli strain for the expression of eukaryotes recombinant proteins. However, the transposition one hampers system that we used to target a unique insertion site. To ensure an adequate production of chaperone for the proper folding of all recombinant proteins, we decided to insert two copies of our chaperone gene through a polycistronic construct under the control of a strong promoter.

The Anderson Promoters include a large panel of constitutive promoters family with different levels of strengths. They are mainly including into the J61002 backbone expressing RFP for color screening. Lot of team projects are based on these types of promoters and they were previously well characterized. However, their ability to control multiple gene expression was never determined.

We characterized strength of several promoters from the iGEM community, which are BBa_J23101, BBa_J23102, BBa_J23104, BBa_J23107 and BBa_J23110. In other hand, we wanted to evaluate their level of strength in the context of polycistronism, with GFP (BBa_I13500) and RFP (BBa_I13507) reporters downstream. We think that it could be very interesting to assess the ability of these promoters to control several gene expression, in order to choose which one of them is more appropriate for us to induce an high chaperone expression.

Achievements :

- We documented at least one new substantial contribution to the iGEM community that showcases a project made with BioBrick.
- We measured the strength variation of 5 differents promoters in the context of a simple or multiple gene expression, allowing us to selected for our project the promoter BBa_J23107, showing high level of activity.

In order to assess the strength of various promoters from the Anderson family we built a polycistronic reporter including GFP (BBa_I13500) and RFP (BBa_I13507) which we places under the control of characterized promoters.

Figure 1 Global strategy about our study of Anderson’s Promoter characterization

Amplification of iGEM parts

We transformed E. coli DH5α competent bacteria with DNA from the iGEM distribution kit 2017. The Anderson’s promoters BBa_J23101, BBa_J23102, BBa_J23104, BBa_J23107, BBa_J23110, GFP coding sequence BBa_I13500 and RFP coding sequence BBa_I13507.

DNA amplification of parts and cloning of devices

After transformation of bacterial cells we proceed to a plasmid DNA extraction with the the Monarch Plasmid Miniprep kit from NEB. Then we amplified each part by PCR using the Q5® High-Fidelity 2X Master Mix (NEB #M0492S) with following primers.
Primer Foward: VF 5’tgccacctgacgtctaagaa 3’
Primer Revers : VF2 5’attaccgcctttgagtgagc 3’ primers
(Tm: 60°C)
We used the Monarch DNA Cleanup extraction Kit from NEB to purify the PCR products.
We used the Biobrick assembly kit from NEB to digest GFP BBa_I13500 upstream part and RFP reporter downstream part and cloning the new device GFP-RFP in the pSB1C3 plasmid.
The next day we follow the same scheme in order to assemble our final polycistronic device Characterized promoter - GFP - RFP.
After transformation, we selected recombinant clones directly by visualization of GFP and RFP fluorescence through epifluorescent microscope Zeiss Axiovision.
We quantify GFP and RFP production in bacteria in 96-well microwell plate during their exponential phase (OD600 of 0.5) using the spectrophotometer Molecular Device SpectraMax M4. Finally, we made ratio between protein synthesis (fluorescence) and growth rate (optical density) of our different transformed strains and measured each sample in triplicates.

Figure 2 Quantification of GFP fluorescence and RFP in the context of polycistronic reporter under the control of Anderson’s promoters

Promoter strength was assessed through the quantification of specific fluorescence from GFP (A) and RFP (B) normalized with OD600 to obtain relative fluorescent units (RFU).

The specific relative fluorescence of the original Anderson Promoters in backbone pSB1C3 shows strength variations with GFP reporter BBa_I13500. The strongest promoter of the 5 measured ones is BBa_J23107 (15796,8U) followed by BBa_J23104 promoter (9443,2 U). BBa_J23102 and BBa_J23110 exhibit a comparable activity than BBa_J23101 promoter (approximately 2500 U). Our system of polycistronic reporter show that all of the five promoters tested allow the a polycistronic production of proteins. Surprisingly, the level of RFP fluorescence is not affected by the strength of these different promoters. These results suggest in our study that the level of activity in the context of polycistron is not directly affected by the strength of the promoter. One hypothesis of these observation is that the distance between the sequence GFP and RFP was not enough important to look for the effect on the second reporter expression, and it could be more reliable to use Lux genes in order to avoid the overlap between fluorescences. To conclude, our work convince us to use BBa_J23107 promoter in the second part of our work.

Part II- SKP integration into bacterial chromosome

Introduction :

Our purpose was to produce antibodies through our transportable factory "The BioMaker Factory". As many eukaryotic proteins it depends a lot of various post-traductional modification and a precise tridimensional architecture. In this way, it’s appears important for us to coexpress our recombinant protein with chaperones. However, WHO legislations demand a total safety of sanitary product exempt from any dangerous substance. So il was a necessity for us to avoid usage of antibiotics during cell growth. The direct insertion of chaperone gene within the bacterial genome appeared to be the best way to ensure a stable expression of additional chaperone proteins into the genome of our designed bacteria allowing a proper folding of eukaryotic therapeutical proteins.

To do so, we used pGRG25 integration vector obtained from Addgene in transformed DH5α E. coli. This vector was designed by McKenzie et al to insert DNA sequence in bacterial chromosome without inducing drug resistance of the host. This system uses Tn7 to insert transgenes at a defined neutral site in the chromosome (attTn7). The site is highly conserved and is known to work as a Tn7 attachment site in E. coli and its relatives. The attTn7 sequence is conserved in most (all) bacteria.

Construction of cytosolic Skp gene :

We had synthesized a cytosolic form of Skp under the control of T7 promoter and ended by a T7 terminator by IDT.

We amplified by Polymerisation Chain Reaction the Skp CDS preceded by its RBS and ended by the T7 promoter with the following primers, introducing XbaI restriction site and SpeI NotI restrictions sites.
TM :67,3°C
We used the Biobrick Assembly kit to place Skp under the control of the promoter from the iGEM distribution kit 2017 BBa_J2310 we used this new construct to transformed E. coli competent DH5α.

Cloning of Skp in pGRG25 :

Culture of these strain was made at 30°C. Indeed, the plasmid backbone is the easily curable temperature sensitive mutant of pSC101, carrying the pSC101 temperature sensitive origin, which must be grown at 30-32°C to allow replication. So in order to extract plasmids, we inoculate these bacterial cells overnight in culture with ampicillin. We inserted the Skp sequence into the NotI restriction site located on the MCS of pGRG25 and then we transformed E. coli competent DH5α with the cloned vector.

Integration of the cytoplasmic form of Skp in E. coli DH5α genome

Cultures of the transformed cloned cells was made overnight without antibiotics at 32°C (this step allows for some loss of plasmid) and then at 42°C to block replication of the plasmid. Colonies were streaked once on LB at 42°C to ensure the complete loss of the plasmid and DNA integration into the genome.
After this step of integration and before characterization of the effect of SKP in protein synthesis we made verifications:
A simple checking was to pick the next day 3 colonies to put them in culture in LB+/- ampicillin.

Verification of the genomic insertion of cytosolic Skp

We check out the proper insertion of our Skp by performing a PCR on colonies allowing the specific amplification of cytosolic Skp with the following primers:
TM :67,3°C

Transposition was verified by the absence by PCR amplifying sequences which flank the attTn7 site with the following primers.

Then, we purified DNA from PCR and we visualized PCR product on an agarose gel electrophoresis (1.5%).

Characterization of Skp insertion

In order to assess the effect related to the SKP chromosomique intégration, we transformed our engineered E. coli with our composite part BBa_I13500-BBa_I13507 created for the promoter caracterisation under the BBa_J231107 promoter and then we quantified the production of GFP and RFP.

Results Verification of the genomic insertion of cytosolic Skp

After amplification by polymerisation chain reaction of RBS-SKP-Terminateur sequence, which represent a fragment of 622pB we realized a comparison between non integrated DH5α cells and bacterial cells with DNA insertion (at 42°C). Here on these electrophoresis gel we can see that there is a band with a very high level of intensity and some SMIRS. We made a mistake between preparation of PCR and used primers 10 times more concentrated but this observation confirm the fact that we can improve the level of SKP production directly into the genome.

Characterization of the SKP insertion:

Promoter strength was assessed through the quantification of specific fluorescence from GFP (A) and RFP (B) normalized with OD600 to obtain relative fluorescent units (RFU). After transformation we compared the level of GFP and RFP expression between DH5α with and without SKP integration. Firstly, we can find with the same condition of transformation a same range of fluorescence for both reporters compared to the characterisation of Anderson’s promoters. Here we can see that the level of GFP expression (around 20000U) is not significantly change when we introduce SKP into the genome, even if there is a very weak increase in the emission level of GFP and RFP. Our supposition is that GFP is a protein which is relatively simple, which don’t need chaperon proteins or an high level of post traductional modifications, and we didn’t had the time to realize other tests with more complex proteins

Part III - Determination of the best purification system

The goal is to test and compare the Gluthation purification system and the hisTrap one to systems to see which one would be the most effective for our box. To do so, we have purified GST-10XHIS proteins with both of the purification system. We have determined the GST enzymatic activity before and after the purifications to obtain the purification yields. Finally, we have done SDS-PAGE chromatographies to semi-quantify the proteins and compare the results with those obtained with the enzymatic activity.

Figure.11: Growth curve of the DH5α containing the PET 21 GST-10HIS
All the points data come from a mean done by data collected from 5 cultures. Cultures were incubated in LB at37°C. The DO(600nm) was calculated every hour.

We cultured DH5α containing plasmid pet21 GST-10XHIS. We measured the OD every hour in order to follow the turbidity and thus determine the time corresponding to the exponential phase of growth(fig.11).

Analysis of GST enzymatic activity:

We calculated the GST activity of the sample taken before and after the purification. We took 5µL of the aliquotes to do the reaction. We then calculated the total reaction for the all volume before and after lysis that can be found in table.1. The table.2 presents the the activities and purification yields obtained for both of the purification.
For the HisTrap column, we observe a purification yield equal to 72.1 %.
For the Gluthation Agarose Resin we observe a purification yield equal to 32%.

Fraction Enzymatic activity From 5 µL (Δabs/min) Total enzymatic activity (Δabs/min) Purification Yield
F1 HisTrap column 0.13 208 72.1%
F2 HisTrap column 0.15 150
F1 Gluthation Agarose Resin 0.75 120 32%
F2 Gluthation Agarose Resin 0.77 38.5

Table.2 GST Enzymatic activity obtained and purification yield

Analysis of SDS-PAGE gel:

After bacterial lysis, we prepared aliquots from the solutions before and after purification and we performed SDS-PAGE for both types of purification. This is done in order to check the presence of GST-10XHIS and to compare these results with those obtained with the enzymatic analysis.

12% polyacrylamide gel. 10 µL deposited with Laemli 1X for each well. M: Kb Ladder. 1: eluted and purified proteins using a Gluthation-Agarose column. 2: expressed proteins before purification.

Figure.13: SDS-PAGE analyse of purification of GST-10his proteins using a HisTrap column

Before purification, mutliple bands can be seen corresponding to bacterial proteins. However, an intense band at about 27 kDa, which correspond to the GST-10His is observed and suggest a good expression of the protein(fig.12.2). After purification with Gluthation Agarose Resin, we can only see one band corresponding to the GST-10His but smaller than the one seen before purification(fig12.1).

SDS-PAGE of HisTrap column purification : Similarly to what was observed in the previous SDSPAGE, multiple bands and one more intense can be seen at about 27kDa corresponding to the GST-10His, before purification(fig13.2). After purification, only one the GST-10His band is observed at 27kDa. The band looks as intense as the one before purification(fig13.1).

Comparing the results with the SDS-PAGE and the GST enzymatic activity, we can say that the purification yields are consistent with the intensity of the bands observed with the SDS-PAGE. Indeed, with the Gluthation-Agarose column, we calculated a purification yield of 32% which is consistent with the diminution of the band size after purification. Likewise, the purification yield of 73% observed with the HisTrap column is consistent with the size of the band. However, the size of the band after HisTrap purification seems to be the as the one before purifcation so the purification yield should be closer to 100%. We have probably lost GST enzymatic activity during the experiments.

To conclude, the HisTrap column seems to be more efficient at purifing the GST-10His protein than the GST-Trap one. Yet, we should not forget that the HisTrap purification System require buffer containing imidazole. Imidazole is irritating and can cause allergies, so we will have to be even more careful when choosing our following Sephadex exclusion chromaztography to exclude small undesired composants. We should maybe try other types of column like the one capable of binding the SUMO protein for example. For the box modelisation, we still decided to use the data obtained with the HisTrap column.

Loading ...