Difference between revisions of "Team:Tianjin/Safty"

Line 3: Line 3:
 
<html>
 
<html>
 
<head>
 
<head>
−
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:maincss?action=raw&ctype=text/css
 
−
" rel="stylesheet">
 
−
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:fonts?action=raw&ctype=text/css">
 
  
−
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:downstyle?action=raw&ctype=text/css">
+
<link rel="stylesheet" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:videostyle?action=raw&ctype=text/css">
−
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:downanimation?action=raw&ctype=text/css">
+
<link rel="stylesheet" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:video?action=raw&ctype=text/css">
  
−
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:titledemo?action=raw&ctype=text/css
+
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:stylesub?action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:demo?action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:photo2?action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:fonts?action=raw&ctype=text/css">
 +
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:maincssmap?action=raw&ctype=text/css" rel="stylesheet">
 +
 
 +
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:button?action=raw&ctype=text/css
 
" rel="stylesheet">
 
" rel="stylesheet">
−
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:titlelinkstyle?action=raw&ctype=text/css
+
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:zoom?action=raw&ctype=text/javascript"></script> 
 +
<script type="text/javascript">
 +
$(document).ready(function() {
 +
$('div.small_pic a').fancyZoom({scaleImg: true, closeOnClick: true});
 +
        $('div.small_pic_one a').fancyZoom({scaleImg: true, closeOnClick: true});
 +
        $('div.small_pic_mid a').fancyZoom({scaleImg: true, closeOnClick: true});
 +
$('#zoom_word_1').fancyZoom({width:400, height:200});
 +
$('#zoom_word_2').fancyZoom();
 +
$('#zoom_flash').fancyZoom();
 +
});
 +
</script>
 +
 
 +
 
 +
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:maincss?action=raw&ctype=text/css
 
" rel="stylesheet">
 
" rel="stylesheet">
  
−
<script type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:modernizr?action=raw&ctype=text/javascript"></script>
 
  
−
<script type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:motor?action=raw&ctype=text/javascript"></script>
 
  
 
/* OVERRIDE IGEM SETTINGS */
 
/* OVERRIDE IGEM SETTINGS */
Line 76: Line 90:
 
</style>
 
</style>
  
 +
 +
<style type="text/css">
 +
*{padding:0;margin:0;list-style-type:none;}
 +
/* go */
 +
.go{width:95px;height:390px;background-color:#FFF;position:fixed;_position:absolute;_top:expression(eval(document.documentElement.scrollTop+document.documentElement.clientHeight-this.offsetHeight-(parseInt(this.currentStyle.marginTop,10)||200)-(parseInt(this.currentStyle.marginBottom,10)||0)));right:12px;bottom:25%;border-radius:5px;box-shadow:0 0 2px #6E6E6E;*border:solid 1px #ddd; z-index:999;}
 +
.go a{background: url(https://static.igem.org/mediawiki/2017/7/70/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171004122500.png) no-repeat;display:block;text-indent:999em;width:95px;margin:5px;border:0;overflow:hidden;float:left}
 +
.go .top{background-position:-8px 7px;height:60px}
 +
.go .top:hover{background-position:-95px 7px;}
 +
 +
.go .feedback{background-position:-8px -60px;height:49px}
 +
.go .feedback:hover{background-position:-95px -60px}
 +
 +
.go .two{background-position:-8px -105px;height:49px}
 +
.go .two:hover{background-position:-95px -105px}
 +
 +
.go .three{background-position:-8px -150px;height:49px}
 +
.go .three:hover{background-position:-95px -150px}
 +
 +
.go .four{background-position:-8px -190px;height:49px}
 +
.go .four:hover{background-position:-95px -190px}
 +
 +
.go .bottom{background-position:-8px -240px;height:60px}
 +
.go .bottom:hover{background-position:-95px -240px}
 +
</style>
 
<style>
 
<style>
  
Line 83: Line 121:
 
     z-index:9999;
 
     z-index:9999;
 
}
 
}
−
#design img{
+
 
−
text-align:center;
+
#description h1{
−
margin:3rem auto 3rem auto;
+
−
padding-top:1.2rem;
+
−
padding-bottom:1.2rem;
+
−
max-width:90%;
+
−
}
+
−
#design h1{
+
 
clear: both;
 
clear: both;
 
         margin-top: 1.325em;
 
         margin-top: 1.325em;
Line 97: Line 129:
 
text-align:center;
 
text-align:center;
 
font-size: 3.5 em;
 
font-size: 3.5 em;
−
         font-weight: 800;
+
         font-weight: 400;
−
font-family: 'Vibrocentric_rg',Verdana, Geneva, sans-serif;
+
font-family: 'righteous',Verdana,sans-serif;
 
text-align:center;
 
text-align:center;
 
}
 
}
−
#design h3{
+
 
−
text-align:center;
+
 
 +
#description h3{
 
font-size:1.2 em;
 
font-size:1.2 em;
 
font-weight:bold;
 
font-weight:bold;
 
color:#0D0F3D;
 
color:#0D0F3D;
−
         margin-bottom:2em
+
         margin-bottom:2em;
 +
        text-align: justify;
 
}
 
}
−
#design a{
+
#description a{
 
font-family:oblique;
 
font-family:oblique;
 
}
 
}
−
#design .zoom {
+
#description .zoom {
 
display:inline-block;
 
display:inline-block;
 
}
 
}
−
#design .zoom:after {
+
#description .zoom:after {
−
content:'';
+
content:'';display:block;position:absolute;top:0;right:0;
−
        display:block;
+
−
        position:absolute;
+
−
        top:0;right:0;
+
 
}
 
}
−
#design .zoom img{
+
#description .zoom img{
 
display:block;
 
display:block;
 
}
 
}
−
#design .zoom img::selection{
+
#description .zoom img::selection{
 
background-color:transparent;
 
background-color:transparent;
 
}
 
}
Line 133: Line 164:
 
.nav p {
 
.nav p {
 
font-size: 1.325em;
 
font-size: 1.325em;
−
         font-family: 'LiberationSerif-Regular', sans-serif;
+
         font-family: 'Montserrat', sans-serif;
 
margin-bottom: 1.5em;
 
margin-bottom: 1.5em;
−
line-height: 1.8em;
+
line-height: 1.5em;
 
font-weight: 400;
 
font-weight: 400;
 
text-align: justify
 
text-align: justify
 
}
 
}
  
−
#design p {
+
#newstyle p {
−
     font-size: 1.325em;
+
     font-size: 1.225em;
 
     margin-bottom: 1.500em;
 
     margin-bottom: 1.500em;
−
     line-height: 1.8em;
+
     line-height: 1.6em;
 
     font-weight: 400;
 
     font-weight: 400;
 
     text-align:justify;
 
     text-align:justify;
−
     font-family: 'LiberationSerif-Regular', sans-serif;
+
     font-family: 'Montserrat', sans-serif;
 
 
 
}
 
}
Line 157: Line 188:
 
     margin-bottom:1.1em
 
     margin-bottom:1.1em
 
}
 
}
 +
#cd-timeline p{
 +
    font-size: 1.2em;
 +
    margin-bottom: 1.500em;
 +
    line-height: 1.6em;
 +
    font-weight: 400;
 +
    text-align:justify;
 +
    font-family: 'Montserrat', sans-serif;
 +
 +
}
 +
 +
#cd-timeline h2{
 +
    font-size: 1.225em;
 +
    margin-bottom: 1.500em;
 +
    line-height: 1.6em;
 +
    font-weight: 600i;
 +
    text-align:justify;
 +
    font-family: 'Montserrat', sans-serif;
 +
   
 +
}
 +
 +
.span{
 +
    font-size: 1.2em;
 +
    font-weight: 400;
 +
    text-align:justify;
 +
    font-family: 'Montserrat', sans-serif;
 +
}
 +
#map p {
 +
font-size: 1.2em;
 +
font-weight: 400;
 +
line-height: 1em;
 +
text-align: justify;
 +
font-family: 'LiberationSerif-Regular', sans-serif;
 +
margin: 0;
 +
padding: 0 1em 1em 1em;
 +
color: #f8f8f8;
 +
border: none;
 +
}
 +
#map h2 {
 +
font-size: 1.2em;
 +
font-weight: 700;
 +
text-align: center;
 +
font-family: 'raleway', sans-serif;
 +
text-shadow: none;
 +
background: none;
 +
border: none;
 +
color: #f8f8f8;
 +
box-shadow: none;
 +
padding: 0 2em 0 2em;
 +
}
 +
 +
#mappppp
 +
{
 +
    position: relative;
 +
    -moz-box-sizing: border-box;
 +
    box-sizing: border-box;
 +
}
 +
 
</style>
 
</style>
 +
 
</head>
 
</head>
  
Line 164: Line 253:
  
  
 +
 +
<div  class="page">
 +
    <div id="gotop" name="gotop">
 +
 +
</div>
 +
     
 +
 +
<div id="page" class="hfeed site">
 +
 +
 
 +
  <div id="primary" class="content-area">
 +
<main id="main" class="about-main" role="main">
 +
            <article id="description">     
 +
                <h1>Collaborations</h1>
 +
                    <hr />
 +
 +
</article>
 +
 +
</main>
 +
 +
</div><!-- #primary -->
 +
 +
 +
<div id="newstyle" class="demo-2">
 
<div class="container">
 
<div class="container">
−
 
  
−
</div>
+
 +
<section class="main">
  
  
  
−
<section class="nav" id="design">
 
  
  
−
<h1>Design</h1>
+
−
<hr>
+
<h2>Sent a Collaboration Request and constructed an alliance to build a worldwide database.</h2>
−
  <div>
+
<p>We came up with the idea that we could gather all the iGEM teams whose projects were about water pollution treatment and build an alliance to unite all information and data concerning the social impact, knowledge and geographical advantages they collected during the conduction of their project.</p>
−
    <input id="label-1" name="lida" type="radio" checked/>
+
−
    <label for="label-1" id="item1">
+
−
    <i class="fa fa-globe" id="i1">
+
−
    </i>  Background</label>
+
−
    <div class="content" id="a1">
+
  
−
<p>Human existence on earth is almost impossible without the heavy metals. Even though important to mankind, exposure to them during production, usage and their uncontrolled discharge in to the environment has caused lots of hazards to man, other organisms and the environment itself. Heavy metals can enter human tissues and organs via inhalation, diet, and manual handling. As the process of urbanization and industrialization goes deeper and deeper, heavy metal pollution, a noticeable threaten to almost all the creatures, has become an essential problem to solve.</p>
+
<h3>2017.08.12</h3>
−
<p>According to our human practice, the situation of heavy metal pollution (copper and cadmium ions) is marked on a world map, and the severity of heavy metal pollution has been increasing all over this map. Places with serious pollution includes middle Asia, eastern Asia, southern Europe, and Latin America. In addition, not only fresh water sources, but also soil and crops are seriously contaminated by heavy metals. On average, during three out of ten suppers we have, we absorb excess heavy metals over the standard concentration.</p>
+
<p>2. On 12th of August, we had a voice conferencing with SJTU/SCUT/XMU/UCAS/JLU/FAFU. During which we discussed about how we want to use this alliance, and the discussion led to 2 conclusions:
−
<p>Considering the rigorous situation we face, our team decided to design an advanced system for typical toxic heavy metal disposal based on Saccharomyces cerevisiae.</p>
+
1. Build a worldwide database for the contents of heavy metals in local soil.
 +
2. Mutually promote the social impact of each parties in this alliance.
 +
</p>
 +
 
 +
 +
<h3>2017.08.23</h3>
 +
<p>On 23th of August, we sent a Collaboration Request to iGEM official website. And the next day, Ana Sifuentes replied our message and posted our request in the iGEM official website.</p>
 +
 
 +
 
 +
<div class="zxx_zoom_one" style="left:0%;">
 +
                    <div class="small_pic_one" style="float:left;">
 +
                        <a href="#pic_nine">
 +
                            <img src="https://static.igem.org/mediawiki/2017/8/8f/Tianjin-HP823.jpg"></a>
 +
<div style="padding-left:20%;"><p></p>
 
</div>
 
</div>
−
  </div>
+
                    </div>
−
  <div>
+
                   
−
    <input id="label-2" name="lida" type="radio"/>
+
                    </div>
−
    <label for="label-2" id="item2"><i class="fa fa-random" id="i2"></i> Mating-type switch and Mating Switcher</label>
+
                 
−
    <div class="content" id="a2">
+
                  <div id="pic_nine" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/8/8f/Tianjin-HP823.jpg"/></div>  
  
−
<p>Saccharomyces cerevisiae is a single-celled organism with three types, called a, α, and a/α. In Saccharomyces cerevisiae, three cell types differ from each other in their DNA content at the MAT locus which specifies the cell types. In nature, the two haploid cell types (a and α) of budding yeast are able to interconvert in a reversible manner by DNA-rearrangement with a DSB at the MAT locus, and this process is called mating-type switch. </p>
 
  
−
<p>The DSB at MAT locus is caused by HO endonuclease(a kind of site-specific endonuclease expressed by HO gene). DSBs in chromosomes can be repaired either by homologous recombination (HR) or by nonhomologous end-joining (NHEJ). In S.C haploids, the DSB caused by HO endonuclease mostly repaired by HR with HML(α) and HMR(a) as donors. If the donor is HML(α), the mating-type will become α, and vice versa. In this way, a haploid budding yeast is able to achieve mating-type switch.</p>
+
                <p> we received the response of many teams like heretofore team EXETER and team CSMU NCHU TAIWAN. With their information, we constructed a database which contained the global data of contents of Cu2+/Cd2+ in soil or water. And we built it based on the world map. We received team CSMU NCHU TAIWAN's kindly help——they offered us information about major metal pollution incidents in Taiwan as well as the real time monitoring data of places that have the potential risk of occurrence of serious pollution incidents.</p>
  
−
<p>In our design, we chose two a-type haploids as the starting strains. In one of them, we knocked out HMR(a) to ensure the mating type only switch from a to α. Since the change of mating type may appear successively,there is a great possibility that the same type haploid mate with each other.To avoid the existence of meaningless mating , we built an vector to express MATα genes to produce a1-α2 stable corepressor so that the haploid will regard itself as a diploid and prevent mating unless the MATa locus changes to the other one.</p>
+
<div class="set_5_button3"><a href="https://static.igem.org/mediawiki/2017/1/18/Tianjin-hp-taiwanmetal.xls">Read more about the information</a></div>
  
  
−
<span class="zoom" id="image1"><img src="https://static.igem.org/mediawiki/2017/6/68/HMR.png"></span>
 
  
 +
<div id="map">
 +
<div class="distribution-map">
  
−
<h3>Fig 1.</h3>
+
    <img src="https://static.igem.org/mediawiki/2017/1/15/Tianjin-copperworldwide.jpg" />
 +
 +
    <button class="map-point" style="top:32%;left:32%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>USA</h2>
 +
                <p>Seen form the data got from National Wetland Condition Assessment (NWCA), the copper concentration is general low when compared to the world. </p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
 +
    <button class="map-point" style="top:25%;left:55%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>Europe</h2>
 +
                <p>Seen form the data got from FOREGS-EuroGeoSurveys Geochemical Baseline Database, the copper concentration is general low when compared to the world. </p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
 +
    <button class="map-point" style="top:56%;left:43%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>Brazil</h2>
 +
                <p>We get data from web of science, so it cannot represent Brazilian soil copper concentration comprehensively. Seen form the data got from web of science, many regions in Brazil have a high and even very high concentration.</p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
 +
    <button class="map-point" style="top:70%;left:40%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>Africa</h2>
 +
                <p>We get data from web of science, so it cannot represent African soil copper concentration comprehensively. Seen form the data got from web of science, many regions in Africa have a high and even very high concentration.</p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
 +
    <button class="map-point" style="top:40%;left:68%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>India</h2>
 +
                <p>We get data from web of science, so it cannot represent Indian soil copper concentration comprehensively. Seen form the data got from web of science, many regions in India have a high and even very high concentration.</p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
    <button class="map-point" style="top:35%;left:74%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>China</h2>
 +
                <p>Seen form the data got from Team Jianchao Li, Shaanxi Normal University, when the copper concentration is general low or moderate, some regions have high and even very high concentration when compared to the world. </p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
 +
</div>
 +
</div>
  
−
<p>In laboratory, the species of budding yeast we usually used are BY4741 and BY4742, whose HO gene are knocked out. Therefore, we built another vector to make HO gene’s expression controllable. We used a modified GAL1 promoter with an artificial transcription factor (ATF) Z4EV (the Z4EV gene has been induced into the SynX chromosome of this group of haploids) to strictly control the expression of HO gene. Unlike common β-estradiol-induced or galactose-induced promoters, this modified promoter is designed to be activated only when it is specifically bound with activated Z4EV factor. </p>
+
<p>Data base</p>
  
−
<p>Z4EV is a kind of fusion protein with three domains – DNA binding domain (DBD), estrogen receptor (ER) and VP16 activation domain. In the absence of β-estradiol, the ER interacts with Hsp90 chaperone complex and keep the ATF out of the nucleus. This AFT will provide a strong transcriptional activator that is dependent on the presence of β-estradiol. By using a synthetic 4-time-repeated zinc-finger DBD array from the mouse TF Zif268, residual off-target effects have been completely eliminated.</p>
 
  
−
<span class="zoom" id="image2">
 
−
<img src="https://static.igem.org/mediawiki/2017/e/ea/Z4EVmechanism.png">
 
−
</span>
 
  
−
<h3>Fig 2.</h3>
+
<h2>Filmed a biosafety video together with other 12 teams</h2>
 +
<p>Biosafety is one of the most important knowledge everyone should master before starting their experiments. Unluckily, biosafety education in China is far too lagged behind compared with the exploding need; not only because of the out-dated education material but also due to the language problem accessing such resources overseas.</p>
 +
<p>We’ve took part in an intercollegiate cooperation project to produce series of Biosafety education materials in Chinese. With the tremendous amount of work of our collaborating partners and our team members, the video collection had finally online and freely available at our homepage on YouTube and Bilibili, a popular Chinese video-sharing website.</p>
 +
<p>12 teams gather together to film a biosafety video, every team took different topics, but all based on Yale biosafety manual.</p>
 +
<p>Our theme is about transportation of biological materials. </p>
  
 +
<div id="demovi" style="text-align:center;">
 +
             
 +
                <ul>
 +
                   
 +
                    <li><button type="button" class="btn demovi-media" data-src="https://static.igem.org/mediawiki/2017/4/48/Team_Tianjin_Safety.mp4"><img src="https://static.igem.org/mediawiki/2017/4/48/Tianjin_safety_title.png"></button></li>
 +
                    <script src="https://2017.igem.org/Team:Tianjin/Resources/JS:MODALitmin?action=raw&ctype=text/javascript"></script>
 +
    <script src="https://2017.igem.org/Team:Tianjin/Resources/JS:script?action=raw&ctype=text/javascript"></script>
  
−
<p>We use this synthetic single-gene expression system to control the expression of HO gene, so that the mating-type switch will happen only under the presence of β-estradiol. After the switch of mating type, this group of haploids’ MATa becomes MATα, and are ready to mate with the other group of haploids whose MAT locus are α.</p>
+
                </ul>
 +
            </div>
  
−
<span class="zoom" id="image3">
 
−
<img src="https://static.igem.org/mediawiki/2017/c/c0/VIKAANDZ4EV.PNG"></span>
 
  
−
<h3>Fig 3.</h3>
 
−
<p>Next, we introduce Vika/vox recombination system into our design. We introduce Vika recombinase and vox sites into these two haploids respectively. The first kind of haploids whose mating type is designed to switch will express Vika recombinase, and the other ones contain functional genes whose expressions are controlled by vox-Terminator-vox structure. When these two haploids mate with each other, cell fusion happens, the components of Vika/vox system are all gathered in one cell and cutting off the terminator flanked by vox locus. Henceforth, the functional genes begin to express, enabling the application of our system. To sum up, the mating type switch and mating behavior in our system serve as a novel gene switcher, namely, Mating Swicher.</p>
 
  
−
<p>Mating Switcher is a flexible system which can easily incorporate with other proven techniques in Saccharomyces cerevisiae, like CRISPR/cas9 and other sit-specific recombination system. We intend to use this system to link different functions in the procedure of heavy metals’ enrichment for further disposal, and make each transition clear and controllable.</p>
+
 
 +
<h2>Helping TUST prepare for their first year of competition.</h2>
 +
<p>To begin with, we offered them some constructive suggestions, and communicated with their team adviser. In 24/3/2017, we were invited to TUST to carried out a recruiting propaganda for them, and helped them form a team.</p>
 +
<div id="middle" name="middle">
 +
<h3>2017.08.01</h3>
 +
<p>In 2017.08.01, TUST and Tianjin held a meeting together, during which TUST gave an account of their recent progress, we suggested them to add some new synthetic routes and elements in their project, and probably a new strain instead of simply Xylinus for fibrin.</p>
 +
</div>
  
−
    </div>
+
<div class="zxx_zoom_left">
−
  </div>
+
                    <div class="small_pic" style="float:left;">
−
  <div>
+
                        <a href="#pic_one">
−
    <input id="label-3" name="lida" type="radio"/>
+
                            <img src="https://static.igem.org/mediawiki/2017/3/34/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171025161733.jpg"></a>
−
    <label for="label-3" id="item3"><i class="fa fa-bar-chart" id="i3"></i> Characterization of Mating Switcher (RFP to CRT)</label>
+
<div style="padding-left:20%;"><p></p></div>
−
    <div class="content" id="a3">
+
                    </div>
 +
                    <div class="small_pic" style="float:right;">
 +
                        <a href="#pic_two" >
 +
                            <img src="https://static.igem.org/mediawiki/2017/6/64/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003130215.jpg"/>
 +
                        </a>
 +
                    </div>
 +
                    </div>
 +
                  <div id="pic_one" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/3/34/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171025161733.jpg"/></div>
 +
                  <div id="pic_two" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/6/64/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003130215.jpg"/></div> 
  
−
<p>Mating Switcher is also a means of gene regulation. In our design, unlike the traditional ways, we regard the whole cell as a signal factor, which can carry components of different systems or transcription factors to influence the expression of downstream genes. The advantages of this switcher are its flexibility, feasibility and no leaky expression. </p>
 
  
−
<p>To characterize our Mating Switcher, we built a gene route to switch the expression from RFP to β-carotene. In this route, we combined RFP with TEF-1 promoter. To prevent leaky expression, we choose two kinds of terminators——ADH1 and Ura3‘s. So β-carotene’s expression is controlled by promoter-vox-RFP-Terminators-vox structure. Before the mating-type switch, our yeast presents reddish color due to RFP’s expression. After the Mating Switcher, with the deletion of RFP and terminators flanked by vox locus, β-carotene expresses and the strains take on an orange color. In Saccharomyces cerevisiae, these two colors are easy to distinguish. In this way, we can easily visualize the function of our switcher, as well as measure its efficiency and error rate.</p>
+
<div id="two" name="two">
 +
<h3>Later on</h3>
 +
<p>TUST came to us again with their modeling problem, we gladly suggested them to share the Fluorescence method and modeling method with us. Since it's their first year competition, we offered them to design Fluorescence experience and modeling together. </p>
 +
</div>
  
−
<span class="zoom" id="image4">
 
−
<img src="https://static.igem.org/mediawiki/2017/c/c6/UraandRFP.png"></span>
 
  
−
<h3>Fig 4.</h3>
+
<div class="zxx_zoom_left">
 +
                    <div class="small_pic" style="float:left;">
 +
                        <a href="#pic_three">
 +
                            <img src="https://static.igem.org/mediawiki/2017/c/ca/20171003132121.jpg"></a>
 +
<div style="padding-left:20%;"><p></p></div>
 +
                    </div>
 +
                    <div class="small_pic" style="float:right;">
 +
                        <a href="#pic_four" >
 +
                            <img src="https://static.igem.org/mediawiki/2017/5/53/20171003132127.jpg"/>
 +
                        </a>
 +
                    </div>
 +
                    </div>
 +
                  <div id="pic_three" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/c/ca/20171003132121.jpg"/></div>
 +
                  <div id="pic_four" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/5/53/20171003132127.jpg"/></div>
  
−
    </div>
 
−
  </div>
 
−
  <div>
 
−
    <input id="label-4" name="lida" type="radio"/>
 
−
    <label for="label-4" id="item4"><i class="fa fa-refresh" id="i4"></i>  Resistance to heavy metals (SCRaMbLE)</label>
 
−
    <div class="content" id="a4">
 
  
−
<p>We want to exploit the genetic and biomedical capacities of Saccharomyces cerevisiae to remediate contaminated water by heavy metals, which means that the yeast strain we use should have an inherent high resistance to heavy metal. Statistics reveal that in the natural environment, Saccharomyces cerevisiae can barely survive in the medium that contains copper or cadmium ions of which the concentrations is higher than 1.5×10-3 and 0.55×10-3 mole per litre, respectively. Since the concentration of heavy metals in industrial effluents is usually higher than these, we decide to increase the heavy metal resistance of the yeast strain, conferring a survival advantage on it in terms of coping with adverse environmental conditions. Because our laboratory spearheads efforts in the de novo synthesis of the yeast chromosomes and the cutting-edge technology— SCRaMbLE (Synthetic Chromosome Rearrangement and Modification by loxPsym-mediated Evolution) in China, we want to apply this novel technology to obtain a geneticallyengineered yeast strain with the highest heavy metal resistance.</p>
 
  
−
<p>Cre/Loxp system is a site-specific DNA recombination technology, used to conduct deletions, inversions, insertions, and translocations of DNA fragments in cells. This system consists of one enzyme, Cre recombinase, which recognizes and recombines a pair of short sequences called loxp sites. Results of the recombination events are dependent on the directionality of the loxp sites. Because of the asymmetry of the loxp sites, when a pair of loxp sites is present in the same DNA strand and they are in opposite orientations, the Cre recombinase will catalyze the inversion of the gene in between the loxp sites; when the loxp sites are in same orientation, this gene will be deleted.</p>
 
  
−
<p>In order to bestow more genetic capacities on yeast strain containing synthetic chromosomes, our laboratory has done many genetic alterations to the original yeast chromosome V and chromosome X before embarking on their de novo synthesis, one of which being to introduce loxpsym (sym: symmetric) sites to synthetic chromosomes. To be more specific, virtually every genes present in the synthetic chromosome V and X are flanked by the loxpsym sites. Unlike the naturally-occurring loxp sites, the loxpsym sites are deprived of directionality, which means the results of recombination events are no longer contingent upon the relative orientation of loxp sites (which they do not have). Under the catalysis of Cre recombinases, these loxpsym-flanked genes in synthetic chromosomes are stochastically deleted, inverted, inserted, and translocated. To put it simply, these genes are “shuffled”. Considering the intricacies of interreactions between genes as well as metabolic pathways in cells, these recombination events of chromosome fragments will somehow exert influences on the complicated metabolic network in yeast cells, engendering a dramatic shift in their biochemical properties and thus a great diversity of phenotypes amid a viable increase in heavy-metal resistance. SCRaMbLE provides us with a new method of rapid evolution of species harboring synthetic chromosomes. With this powerful genetic tool, we are able to not only select strains with highest heavy metal resistance but also other desired traits, be they alcohol tolerance, heat tolerance et cetera.</p>
 
  
−
<span class="zoom" id="image5"><img src="https://static.igem.org/mediawiki/2017/d/d7/Scramblecopy.png"></span>
 
−
<h3>Fig 5.</h3>
 
  
−
    </div>
+
<h2>Test the mini system for OUC</h2>
−
  </div>
+
<h3>What we did：</h3>
−
  <div>
+
<p>To verify whether the system built by China Ocean University was still available in other species of <i>Saccharomyces cerevisiae</i>. In that case, we used our laboratory-specific <i>Saccharomyces cerevisiae</i> with synthetic chromosome 10 to test its value of fluorescence intensity.</p>
−
    <input id="label-5" name="lida" type="radio"/>
+
−
    <label for="label-5" id="item5"><i class="fa fa-magnet" id="i5"></i> Detection and enrichment of copper ions (parts’ improvement)</label>
+
−
    <div class="content" id="a5">
+
  
−
<p>In Saccharomyces cerevisiae S288C, there is a natural copper-induced promoter – CUP1p. The CUP1 promoter enables binding of RNA Polymerase II and the subsequent transcription of downstream DNA to mRNA. It is activated by ACE1, a transcription factor which binds to copper ions. It is previously available as a standalone part as BBa_K945002, produced by Tec-Monterrery’s 2012 iGEM team, and team iGEM16_Washington modified this part with illegal restriction sites removed to make this part (BBa_K2165004) easier to control and operate.</p>
+
<p><i>Protocol for fluorescence detection</i>：</p>
  
−
<p>Based on the part provided by iGEM16_Washington, we built a vector for detection of copper ions which combines CUP1 promoter with RFP. In fact, this promoter is leaky in the absence of inducer. To make it more sensitive and lower the threshold of expression, we decide to transform the promoter with error-prone PCR. After finishing the library, the sensitivity of engineered promoter will be characterized by the fluorescence intensity.</p>
+
<p><i>Yeast with plasmid was incubated overnight in YPD + G418 medium<br>
 +
Transfer the yeast suspension to the new YPD + G418 and adjusted the OD to 0.1<br>
 +
After incubation for 20 hours, the fluorescence was measured<br>
 +
Excitation light 502nm<br>
 +
Emitting light 532nm<br>
 +
The OD600 values were measured after fluorescence measurements</i></p>
 +
<P>Results</p>
 +
<p>Having compared our results with that provided by Ocean University, except for some slight deviation of measurements, we found that the experimental results in both labs were consistent, which indicated that the mini system had similar expression in different laboratories and yeast strains.</p>
  
−
<p>After the detection, we will use Mating Switcher to open following gene’s expression rapidly. We can either overexpress CUP1 to concentrate copper in the yeast cell or display the Metallothionein on the surface of budding yeast.</p>
 
−
<span class="zoom" id="image6"><img src="https://static.igem.org/mediawiki/2017/1/1d/Cucopy.png"></span>
 
−
<h3>Fig 6.</h3>
 
  
−
</div>
 
−
  </div>
 
−
  <div>
 
−
    <input id="label-6" name="lida" type="radio"/>
 
−
    <label for="label-6" id="item6"><i class="fa fa-cogs" id="i6"></i>  Separation of different irons (copper and cadmium ions) </label>
 
−
    <div class="content" id="a6">
 
  
−
<p>Our HP shows that the most challenging point in dealing with heavy metals is the separation of different metal ions. To tackle this problem, we designed a gene route based on Mating Switcher to enrich two different heavy metal respectively.</p>
+
<div class="zxx_zoom_left">
−
<span class="zoom" id="image7"><img src="https://static.igem.org/mediawiki/2017/4/43/Cdcopy.png"></span>
+
                    <div class="small_pic" style="float:left;">
−
<h3>Fig 7.</h3>
+
                        <a href="#pic_seventeen">
−
<p>Aiming to separate two different ions effectively, we redesign two kinds of metallothionein. In addition to CUP1, another metallothionein was found that can specifically combine with cadmium ions. Semi-rational design and error PCR help us improve the specificity of each proteins, which make sure the separation of two kinds of metal ions can be accomplished accurately. </p>
+
                            <img src="https://static.igem.org/mediawiki/2017/0/0b/Qwerrt.jpg"></a>
 +
<div align="center"><p style="font-size:1.7rem;text-align:center"><br/>Testing results for OUC</p></div>
 +
                    </div>
 +
                    <div class="small_pic" style="float:right;">
 +
                        <a href="#pic_eighteen" >
 +
                            <img src="https://static.igem.org/mediawiki/2017/6/69/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171025093814.jpg"/>
 +
                        </a>
 +
                    </div>
 +
                    </div>
 +
                  <div id="pic_seventeen" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/0/0b/Qwerrt.jpg"/><br/>Testing results for OUC</div>
 +
                  <div id="pic_eighteen" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/6/69/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171025093814.jpg"/></div>
 +
<h3>What we asked OUC to do</h3>
 +
<p>Easy - to - error PCR library development. They were supposed to amplify our existing error-prone PCR library by conducting error-prone PCR  for the CUP1 promoter we used in our project.<br>
 +
Specific steps:<br>
 +
1.Error-prone PCR<br>
 +
2. digestion<br>
 +
3. Purification / Adsorption<br>
 +
4. Connect<br>
 +
5. <i>E.Coli</i> transformation</p>
 +
<p><i>Easy-to-error PCR protocol (100μl)：<br>
 +
5X buffer（140mM MgCl2, 250mM KCl, 50mM Tris, and 0.1%(wt/vol) gelatin）20μl<br>
 +
Template (iGEM-Tianjin provided) 4μl<br>
 +
Primers (iGEM-Tianjin provided) 4μl*2<br>
 +
10X dNTP (2mM dGTP, 2mM dATP, 10mM dCTP, and 10 mM TTP) 10μl<br>
 +
Taq polymerase 2μl<br>
 +
5mM MnCl2 10μl<br>
 +
ddH2O 46μl<br></i>
 +
</p>
 +
<p>94℃ 3min<br>
 +
94℃ 30s<br>
 +
53℃ 30s<br>     
 +
72℃ 30s<br>
 +
72℃ 1min<br>
 +
recycle for 35 times<br>
 +
</p>
 +
<p>The PCR products were obtained and digested with BamHI and XbaI, and ligated with vector pRS416.<br>
 +
After <i>E.Coli</i> transformation, we collected the target bacteria and plasmids</p>
  
  
 +
<div class="zxx_zoom_left">
 +
                    <div class="small_pic" style="float:left;">
 +
                        <a href="#pic_nineteen">
 +
                            <img src="https://static.igem.org/mediawiki/2017/8/82/2017100221162222thumb.jpg"></a>
 +
<div align="center"><p style="font-size:1.7rem;text-align:center"></p></div>
 +
                    </div>
 +
                    <div class="small_pic" style="float:right;">
 +
                        <a href="#pic_twenty" >
 +
                            <img src="https://static.igem.org/mediawiki/2017/c/c4/Wwwwwwwwwww%E5%89%AF%E6%9C%AC.png"/>
 +
                        </a>
 +
                    </div>
 +
                    </div>
 +
                  <div id="pic_nineteen" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/b/b7/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171002211622.jpg"/></div>
 +
                  <div id="pic_twenty" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/f/f3/Wwwwwwwwwww.jpg"/></div>
 +
  
  
 +
                 
 +
<h2>Helping NKU with their plasmid construction</h2>
 +
<h3>What we did：</h3>
 +
<p>Helping NKU-iGEM construct their plasmid<br>The cleavage sites XbaI and SacI were added by PCR before and after lysase (lys)<br>Forward Primer：GCTCTAGAATGAAATACCTGCTGCCGAC<br>Reverse Primer：CGAGCTCtCAATGCGTTTCCATAATAGCAGC</p>
 +
<p>After the PCR product was obtained, then came cleavage：</p>
 +
<p>After overnight digestion, it was linking with the linearized plasmid pEX18 for 1 hr.
 +
Then the linking product was transformed into <i>E.Coli.</i><br>PxylA-xylR was cleaved by SacI on plasmid pAX01<br>The pEX18-lys, which has been added with lys, was linearized by SacI single restrict digestion<br>The two were connected after 1hr<br> Then the linking product was transformed into E.coli.</p>
 +
<p>Helped us to test the fluorescence intensity of pRS416-CUP1p-RFP without copper induction in <i>Saccharomyces cerevisiae</i> BY4742 and BY4741.</p>
  
 +
<div id="three" name="three">
  
  
−
</div>
+
<div class="zxx_zoom_left">
−
  </div>
+
                    <div class="small_pic" style="float:left;">
 +
                        <a href="#pic_five">
 +
                            <img src="https://static.igem.org/mediawiki/2017/9/92/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171002211559.jpg"></a>
 +
<div style="padding-left:20%;"><p></p></div>
 +
                    </div>
 +
                    <div class="small_pic" style="float:right;">
 +
                        <a href="#pic_six" >
 +
                            <img src="https://static.igem.org/mediawiki/2017/8/82/2017100221162222thumb.jpg"/>
 +
                        </a>
 +
                    </div>
 +
                    </div>
 +
                  <div id="pic_five" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/9/92/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171002211559.jpg"/></div>
 +
                  <div id="pic_six" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/b/b7/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171002211622.jpg"/></div>
 +
 
  
−
<div style="padding-top:10em;padding-right:1em;">
 
−
 
  
−
</div>
 
−
</section>
 
  
−
 
−
 
−
 
 
 
−
</div><!-- #primary -->
+
 +
                <p><i>protocol<br>
 +
Cutsmart® buffer 5μl<br>XbaI 1μl<br>SacI 1μl<br>PCR product 43μl</i></p>
  
−
<script>
 
−
window.requestAnimFrame = (function(callback) {
 
−
return window.requestAnimationFrame || window.webkitRequestAnimationFrame || window.mozRequestAnimationFrame || window.oRequestAnimationFrame || window.msRequestAnimationFrame ||
 
−
function(callback) {
 
−
window.setTimeout(callback, 1000 / 60);
 
−
};
 
−
})();
 
  
−
var requestId, jolttime;
+
<div class="zxx_zoom_mid"  align="center">
 +
                    <div class="small_pic_mid">
 +
                        <a href="#pic_fif">
 +
                            <img src="https://static.igem.org/mediawiki/2017/5/57/1234qaz%E5%89%AF%E6%9C%AC.png"></a>
 +
<div align="center"><p style="font-size:1.7rem;text-align:center"><br/><i>E.coli </i>after transformation</p></div>
 +
                    </div>
 +
                   
 +
                    </div>
 +
                  <div id="pic_fif" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/e/ea/1234qaz.jpg"/><br><i>E.coli</i> after transformation</div>
  
−
var c = document.getElementById('canv');
+
<p>Protocol</p>
−
var $ = c.getContext('2d');
+
<p><i>Cultures were incubated overnight in SC-URA medium.<br>Take some yeast suspension to the new SC-URA medium, then adjusted the OD600 value to 0.1 for 24 hours.<br>Fluorescence was measured, and the results were presented below:<br>Excitation 472nm<br>Radiation 532nm.</i></p>
  
−
var s = 18; //grid square size
+
<div class="zxx_zoom_left"  align="center">
−
var mv = 10; //moving areas
+
                    <div class="small_pic">
−
var sp = 1; //move speed
+
                        <a href="#pic_sixteen">
−
var clm = 23; //columns
+
                            <img src="https://static.igem.org/mediawiki/2017/7/76/Qazwsx.png"></a>
−
var rw = 10; //rows
+
<div align="center"><p style="font-size:1.7rem;text-align:center"><br/>the data they obtained in their lab was provided for iGEM-Tianjin as reference</p></div>
−
var x = []; //x array
+
                    </div>
−
var y = []; //y array
+
                   
−
var X = []; //starting X array
+
                    </div>
−
var Y = []; //starting Y array
+
                  <div id="pic_sixteen" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/7/76/Qazwsx.png"/><br>the data they obtained in their lab was provided for iGEM-Tianjin as reference</div>
 +
</div>
  
−
c.width  = c.offsetWidth;
 
−
c.height = c.offsetHeight;
 
  
−
for (var i = 0; i < clm * rw; i++) {
 
−
x[i] = ((i % clm) - 0.5) * s;
 
−
y[i] = (Math.floor(i / clm) - 0.5) * s;
 
−
X[i] = x[i];
 
−
Y[i] = y[i];
 
−
}
 
−
var t = 0;
 
  
−
function jolt() {
 
−
$.fillRect(0, 0, c.width, c.height);
 
  
−
for (var i = 0; i < clm * rw; i++) {
 
−
if (i % clm != clm - 1 && i < clm * (rw - 1) - 1) {
 
−
$.fillStyle = "hsla(0,0,0,1)";
 
−
$.strokeStyle = "#95D384";
 
−
$.lineWidth = 1;
 
−
$.beginPath();
 
−
$.moveTo(x[i], y[i]);
 
−
$.lineTo(x[i + 1], y[i + 1]);
 
−
$.lineTo(x[i + clm + 1], y[i + clm + 1]);
 
−
$.lineTo(x[i + clm], y[i + clm]);
 
−
$.closePath();
 
−
$.stroke();
 
−
$.fill();
 
−
}
 
−
}
 
−
for (var i = 0; i < rw * clm; i++) {
 
−
if ((x[i] < X[i] + mv) && (x[i] > X[i] - mv) && (y[i] < Y[i] + mv) && (y[i] > Y[i] - mv)) {
 
−
x[i] = x[i] + Math.floor(Math.random() * (sp * 2 + 1)) - sp;
 
−
y[i] = y[i] + Math.floor(Math.random() * (sp * 2 + 1)) - sp;
 
−
} else if (x[i] >= X[i] + mv) {
 
−
x[i] = x[i] - sp;
 
−
} else if (x[i] <= X[i] - mv) {
 
−
x[i] = x[i] + sp;
 
−
} else if (y[i] >= Y[i] + mv) {
 
−
y[i] = y[i] - sp;
 
−
} else if (y[i] <= Y[i] + mv) {
 
−
y[i] = y[i] + sp;
 
−
}
 
−
}
 
−
//controls time of electric shake> when counter equals 0, it will reset for 5s then start again.
 
−
if (t % c.width == 0) {
 
−
jolttime = setTimeout('jolt()', 5);
 
−
t++;
 
−
} else {
 
−
jolttime = setTimeout('jolt()', 5);
 
−
t++;
 
−
}
 
−
}
 
  
−
function start() {
 
−
if (!requestId) {
 
−
requestId = window.requestAnimFrame(jolt);
 
−
}
 
−
}
 
  
−
function stop() {
 
−
if (requestId) {
 
−
clearTimeout(jolttime);
 
−
window.cancelAnimationFrame(requestId);
 
−
requestId = undefined;
 
−
}
 
−
}
 
  
−
document.querySelector('a.link--asiri').addEventListener('mouseenter', start);
 
−
document.querySelector('a.link--asiri').addEventListener('mouseleave', stop);
 
−
</script>
 
−
<script>
 
−
// For Demo purposes only (show hover effect on mobile devices)
 
−
[].slice.call( document.querySelectorAll('.grid a') ).forEach( function(el) {
 
−
el.onclick = function() { return false; }
 
−
} );
 
−
</script>
 
  
 +
 +
<p><a class="ref" href=""></a></p>
 +
     
 +
 +
 
 +
 +
 +
<div id="gobottom" name="gobottom">
 +
</section>
 +
</div>
 +
<div class="go">
 +
<a title="top" class="top" href="#gotop"></a>
 +
<a title="middle" class="feedback" href="#middle"></a>
 +
    <a title="22" class="two" href="#two"></a>
 +
    <a title="33" class="three" href="#three"></a>
 +
    <a title="44" class="four" href="#four"></a>
 +
<a title="bottom" class="bottom" href="#gobottom"></a>
 +
</div>
 +
</div>
  
  

Revision as of 13:58, 27 October 2017

/* OVERRIDE IGEM SETTINGS */

Collaborations

Sent a Collaboration Request and constructed an alliance to build a worldwide database.

We came up with the idea that we could gather all the iGEM teams whose projects were about water pollution treatment and build an alliance to unite all information and data concerning the social impact, knowledge and geographical advantages they collected during the conduction of their project.

2017.08.12

2. On 12th of August, we had a voice conferencing with SJTU/SCUT/XMU/UCAS/JLU/FAFU. During which we discussed about how we want to use this alliance, and the discussion led to 2 conclusions: 1. Build a worldwide database for the contents of heavy metals in local soil. 2. Mutually promote the social impact of each parties in this alliance.

2017.08.23

On 23th of August, we sent a Collaboration Request to iGEM official website. And the next day, Ana Sifuentes replied our message and posted our request in the iGEM official website.

we received the response of many teams like heretofore team EXETER and team CSMU NCHU TAIWAN. With their information, we constructed a database which contained the global data of contents of Cu2+/Cd2+ in soil or water. And we built it based on the world map. We received team CSMU NCHU TAIWAN's kindly help——they offered us information about major metal pollution incidents in Taiwan as well as the real time monitoring data of places that have the potential risk of occurrence of serious pollution incidents.

Read more about the information

Data base

Filmed a biosafety video together with other 12 teams

Biosafety is one of the most important knowledge everyone should master before starting their experiments. Unluckily, biosafety education in China is far too lagged behind compared with the exploding need; not only because of the out-dated education material but also due to the language problem accessing such resources overseas.

We’ve took part in an intercollegiate cooperation project to produce series of Biosafety education materials in Chinese. With the tremendous amount of work of our collaborating partners and our team members, the video collection had finally online and freely available at our homepage on YouTube and Bilibili, a popular Chinese video-sharing website.

12 teams gather together to film a biosafety video, every team took different topics, but all based on Yale biosafety manual.

Our theme is about transportation of biological materials.

Helping TUST prepare for their first year of competition.

To begin with, we offered them some constructive suggestions, and communicated with their team adviser. In 24/3/2017, we were invited to TUST to carried out a recruiting propaganda for them, and helped them form a team.

2017.08.01

In 2017.08.01, TUST and Tianjin held a meeting together, during which TUST gave an account of their recent progress, we suggested them to add some new synthetic routes and elements in their project, and probably a new strain instead of simply Xylinus for fibrin.

Later on

TUST came to us again with their modeling problem, we gladly suggested them to share the Fluorescence method and modeling method with us. Since it's their first year competition, we offered them to design Fluorescence experience and modeling together.

Test the mini system for OUC

What we did：

To verify whether the system built by China Ocean University was still available in other species of Saccharomyces cerevisiae. In that case, we used our laboratory-specific Saccharomyces cerevisiae with synthetic chromosome 10 to test its value of fluorescence intensity.

Protocol for fluorescence detection：

Yeast with plasmid was incubated overnight in YPD + G418 medium
Transfer the yeast suspension to the new YPD + G418 and adjusted the OD to 0.1
After incubation for 20 hours, the fluorescence was measured
Excitation light 502nm
Emitting light 532nm
The OD600 values were measured after fluorescence measurements

Results

Having compared our results with that provided by Ocean University, except for some slight deviation of measurements, we found that the experimental results in both labs were consistent, which indicated that the mini system had similar expression in different laboratories and yeast strains.


Testing results for OUC

What we asked OUC to do

Easy - to - error PCR library development. They were supposed to amplify our existing error-prone PCR library by conducting error-prone PCR for the CUP1 promoter we used in our project.
Specific steps:
1.Error-prone PCR
2. digestion
3. Purification / Adsorption
4. Connect
5. E.Coli transformation

Easy-to-error PCR protocol (100μl)：
5X buffer（140mM MgCl2, 250mM KCl, 50mM Tris, and 0.1%(wt/vol) gelatin）20μl
Template (iGEM-Tianjin provided) 4μl
Primers (iGEM-Tianjin provided) 4μl*2
10X dNTP (2mM dGTP, 2mM dATP, 10mM dCTP, and 10 mM TTP) 10μl
Taq polymerase 2μl
5mM MnCl2 10μl
ddH2O 46μl

94℃ 3min
94℃ 30s
53℃ 30s
72℃ 30s
72℃ 1min
recycle for 35 times

The PCR products were obtained and digested with BamHI and XbaI, and ligated with vector pRS416.
After E.Coli transformation, we collected the target bacteria and plasmids

Helping NKU with their plasmid construction

What we did：

Helping NKU-iGEM construct their plasmid
The cleavage sites XbaI and SacI were added by PCR before and after lysase (lys)
Forward Primer：GCTCTAGAATGAAATACCTGCTGCCGAC
Reverse Primer：CGAGCTCtCAATGCGTTTCCATAATAGCAGC

After the PCR product was obtained, then came cleavage：

After overnight digestion, it was linking with the linearized plasmid pEX18 for 1 hr. Then the linking product was transformed into E.Coli.
PxylA-xylR was cleaved by SacI on plasmid pAX01
The pEX18-lys, which has been added with lys, was linearized by SacI single restrict digestion
The two were connected after 1hr
Then the linking product was transformed into E.coli.

Helped us to test the fluorescence intensity of pRS416-CUP1p-RFP without copper induction in Saccharomyces cerevisiae BY4742 and BY4741.

protocol
Cutsmart® buffer 5μl
XbaI 1μl
SacI 1μl
PCR product 43μl


E.coli after transformation

Protocol

Cultures were incubated overnight in SC-URA medium.
Take some yeast suspension to the new SC-URA medium, then adjusted the OD600 value to 0.1 for 24 hours.
Fluorescence was measured, and the results were presented below:
Excitation 472nm
Radiation 532nm.


the data they obtained in their lab was provided for iGEM-Tianjin as reference