Difference between revisions of "Team:Oxford/Software"
| (16 intermediate revisions by 3 users not shown) | |||
| Line 19: | Line 19: | ||
<script> | <script> | ||
$( function() { | $( function() { | ||
| − | var suggestions = [ | + | var suggestions = [ |
| − | + | { | |
| + | label:"African Sleeping sickness", | ||
| + | value:"item3", | ||
| + | }, | ||
| + | { | ||
| + | label:"Brucepain", | ||
| + | value:"item3", | ||
| + | }, | ||
| + | { | ||
| + | label:"Cathepsin L", | ||
| + | value:"item5", | ||
| + | }, | ||
| + | { | ||
| + | label:"Cercarial elastase", | ||
| + | value:"item4", | ||
| + | }, | ||
{ | { | ||
label:"Congenital Chagas disease", | label:"Congenital Chagas disease", | ||
value:"item1", | value:"item1", | ||
}, | }, | ||
| + | { | ||
| + | label:"Congenital toxoplasmosis", | ||
| + | value:"item5", | ||
| + | }, | ||
| + | { | ||
| + | label:"Cruzipain", | ||
| + | value:"item1", | ||
| + | }, | ||
| + | { | ||
| + | label:"LasA", | ||
| + | value:"item2", | ||
| + | }, | ||
| + | { | ||
| + | label:"Pseudomonas aeruginosa", | ||
| + | value:"item2", | ||
| + | }, | ||
| + | { | ||
| + | label:"Rhodesain", | ||
| + | value:"item3", | ||
| + | }, | ||
| + | { | ||
| + | label:"Schistosoma mansoni", | ||
| + | value:"item4", | ||
| + | }, | ||
| + | { | ||
| + | label:"Schistosomiasis", | ||
| + | value:"item4", | ||
| + | }, | ||
| + | { | ||
| + | label:"Sepsis", | ||
| + | value:"item2", | ||
| + | }, | ||
| + | { | ||
| + | label:"Toxoplasma gondii", | ||
| + | value:"item5", | ||
| + | }, | ||
| + | { | ||
| + | label:"Trypanosoma brucei", | ||
| + | value:"item3", | ||
| + | }, | ||
{ | { | ||
label:"Trypanosoma Cruzi", | label:"Trypanosoma Cruzi", | ||
value:"item1", | value:"item1", | ||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
} | } | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
]; | ]; | ||
$("#myInput" ).autocomplete({ | $("#myInput" ).autocomplete({ | ||
| − | source: function( request, response ) { | + | source: function(request, response) { |
| − | + | var results = $.ui.autocomplete.filter(suggestions, request.term); | |
| − | + | response(results); | |
| − | + | }, | |
| − | + | minLength: 0, | |
| − | + | ||
| − | + | ||
select: function( event, ui ) { // Once the term is selected from the list | select: function( event, ui ) { // Once the term is selected from the list | ||
$("tr[class^='item']").hide(); // hide all rows with class name starts with "item" | $("tr[class^='item']").hide(); // hide all rows with class name starts with "item" | ||
| Line 102: | Line 110: | ||
return false; | return false; | ||
} | } | ||
| − | }); | + | }).focus(function () { |
| − | } ); | + | $(this).autocomplete("search", ""); |
| + | }); | ||
| + | } ); | ||
</script> | </script> | ||
</head> | </head> | ||
| Line 110: | Line 120: | ||
<div style="margin-top: 100px"></div> | <div style="margin-top: 100px"></div> | ||
<h1 class="text-center">Software Tool</h1> | <h1 class="text-center">Software Tool</h1> | ||
| − | <p>Enter the disease name, parasite or specific protease to find the cleavage sequence of protease specific to the disease of interest and how our system may be applicable.</p> | + | <center><img class="img-responsive" width="200px;" src="https://static.igem.org/mediawiki/2017/a/ae/T--oxford--softwarelogo.png |
| − | <input type="text" id="myInput" placeholder="Search"> | + | "></center><br> |
| − | <table id="id_tbl" class="table table-hover"> | + | <p>The design of our rapid diagnostic kit enables it to act as a platform technology, wherein the input and output can be altered to detect a wide range of parasitic infections. We envisage our project being able to pave the way for quick, cheap, and unambiguous serological testing that does not dependent on antibody detection, making it ideal for immunocompromised patients as well as any diseases that lack antigenically detectable biomarkers. We have created a simple software tool to aid the expansion of our platform technology, we aim to make the software open source to allow continual addition of the diseases and their protease-based biomarkers and consequently ensure the tool remains date with the the most recent research.</p> |
| − | + | <p> Enter the disease name, parasite or specific protease to find the cleavage sequence of protease specific to the disease of interest and how our system may be applicable.</p> | |
| − | + | <br/> | |
| − | + | <input type="text" style="width:100%; border:2px solid black;" id="myInput" placeholder="Search"> | |
| − | + | <table id="id_tbl" class="table table-hover"> | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
<tbody> | <tbody> | ||
| − | + | <tr class="item1" style="display:none"> | |
| − | + | <td> | |
| − | + | <table width="100%"> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Disease</td><td><span>Congenital Chagas Disease</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Parasite</td><td><span><i>Trypanosoma Cruzi</i></span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Specific Protease</td><td><span>Cruzipain</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">DNA Sequence of Cleavage Site</td><td><span>AAAAAAGTTAAAGCTAAAAAA</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Protease Cleavage Sequence</td><td><span>K/K/L/KR-A/KS/K/RQ</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Medium of Test</td><td><span>Blood</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Final Output</td><td><span>Hirudin</span></td></tr> | |
| + | <tr><td style="font-weight:bold" width="25%">Positive Result</td><td><span>No blood clotting</span></td></tr> | ||
| + | </table> | ||
| + | </td> | ||
| + | </tr> | ||
<tr class="item2" style="display:none"> | <tr class="item2" style="display:none"> | ||
| − | + | <td> | |
| − | + | <table width="100%"> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Disease</td><td><span>Sepsis</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Parasite</td><td><span><i>Pseudomonas aeruginosa</i></span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Specific Protease</td><td><span>LasA</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">DNA Sequence of Cleavage Site</td><td><span></span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Protease Cleavage Sequence</td><td><span>After Gly-Gly (e.g. PGVGG - elastin) or between Lys-Ile (e.g. NKKIEKFQ(S-P) - beta=casein)</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Medium of Test</td><td><span>Blood</span></td></tr> | |
| + | <tr><td style="font-weight:bold" width="25%">Final Output</td><td><span>Hirudin</span></td></tr> | ||
| + | <tr><td style="font-weight:bold" width="25%">Positive Result</td><td><span>No blood clotting</span></td></tr> | ||
| + | </table> | ||
| + | </td> | ||
</tr> | </tr> | ||
<tr class="item3" style="display:none"> | <tr class="item3" style="display:none"> | ||
| − | + | <td> | |
| − | + | <table width="100%"> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Disease</td><td><span>African Sleeping sickness</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Parasite</td><td><span><i>Trypanosoma brucei</i></span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Specific Protease</td><td><span>Rhodesain/Brucepain</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">DNA Sequence of Cleavage Site</td><td><span>TCCGCGCCGAAATCCCTGATTGGC/ TCCGCGCCGCGTTCCCTGATTGGC</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Protease Cleavage Sequence</td><td><span>S/A/P/R-K/S/L/I/G</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Medium of Test</td><td><span>Blood</span></td></tr> | |
| + | <tr><td style="font-weight:bold" width="25%">Final Output</td><td><span>Hirudin</span></td></tr> | ||
| + | <tr><td style="font-weight:bold" width="25%">Positive Result</td><td><span>No blood clotting</span></td></tr> | ||
| + | </table> | ||
| + | </td> | ||
</tr> | </tr> | ||
<tr class="item4" style="display:none"> | <tr class="item4" style="display:none"> | ||
| − | + | <td> | |
| − | + | <table width="100%"> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Disease</td><td><span>Schistosomiasis</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Parasite</td><td><span><i>Schistosoma mansoni</i></span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Specific Protease</td><td><span>Cercarial elastase</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">DNA Sequence of Cleavage Site</td><td><span>Cercarial elastase</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Protease Cleavage Sequence</td><td><span>AGCTGGCCGCTG</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Medium of Test</td><td><span>SWPL</span></td></tr> | |
| + | <tr><td style="font-weight:bold" width="25%">Final Output</td><td><span>Hirudin</span></td></tr> | ||
| + | <tr><td style="font-weight:bold" width="25%">Positive Result</td><td><span>No blood clotting</span></td></tr> | ||
| + | </table> | ||
| + | </td> | ||
</tr> | </tr> | ||
<tr class="item5" style="display:none"> | <tr class="item5" style="display:none"> | ||
| − | + | <td> | |
| − | + | <table width="100%"> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Disease</td><td><span>Congenital toxoplasmosis</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Parasite</td><td><span><i>Toxoplasma gondii</i></span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Specific Protease</td><td><span>Cathepsin L</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">DNA Sequence of Cleavage Site</td><td><span>AAACAGAAACTGCGC</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Protease Cleavage Sequence</td><td><span>KQKLR</span></td></tr> | |
| − | + | <tr><td style="font-weight:bold" width="25%">Medium of Test</td><td><span>Amniotic fluid</span></td></tr> | |
| + | <tr><td style="font-weight:bold" width="25%">Final Output</td><td><span>Luciferase</span></td></tr> | ||
| + | <tr><td style="font-weight:bold" width="25%">Positive Result</td><td><span>Light</span></td></tr> | ||
| + | </table> | ||
| + | </td> | ||
</tr> | </tr> | ||
</tbody> | </tbody> | ||
| Line 182: | Line 204: | ||
</body> | </body> | ||
</html> | </html> | ||
| + | {{Oxford/footer}} | ||
Latest revision as of 01:04, 2 November 2017
Software Tool
The design of our rapid diagnostic kit enables it to act as a platform technology, wherein the input and output can be altered to detect a wide range of parasitic infections. We envisage our project being able to pave the way for quick, cheap, and unambiguous serological testing that does not dependent on antibody detection, making it ideal for immunocompromised patients as well as any diseases that lack antigenically detectable biomarkers. We have created a simple software tool to aid the expansion of our platform technology, we aim to make the software open source to allow continual addition of the diseases and their protease-based biomarkers and consequently ensure the tool remains date with the the most recent research.
Enter the disease name, parasite or specific protease to find the cleavage sequence of protease specific to the disease of interest and how our system may be applicable.
Sponsors
