Sent a Collaboration Request and constructed an alliance to build a worldwide database.

We came up with the idea that we could gather all the iGEM teams whose projects were about water pollution treatment and built an alliance to unite all information and data concerning the social impacts, knowledge and geographical advantages they collected during the conduction of their project.

Built an alliance

On 12th of August, we had a voice conferencing with SJTU/SCUT/XMU/UCAS/JLU/FAFU, during which we discussed about how we wanted to use this alliance, and the discussion led to 2 conclusions:

1. Build a worldwide database for the contents of heavy metals in local soil.

2. Mutually promote the social impact of each parties in this alliance.

Constructed a world-wide database

On 23th of August, we sent a Collaboration Request to iGEM official website. And the next day, Ana Sifuentes replied our message and posted our request in the iGEM official website.

we received the response of many teams like heretofore team EXETER and team CSMU NCHU TAIWAN. With their information, we constructed a database which contained the global data of contents of Cu2+/Cd2+ in soil or water. And we built it based on the world map. We received team CSMU NCHU TAIWAN's kindly help——they offered us information about major metal pollution incidents in Taiwan as well as the real time monitoring data of places that had the potential risk of occurrence of serious pollution incidents.

E-mails sent by iGEM EXETER and Nazarbayev University

e-mail sent by CSMU X NCHU TAIWAN.

e-mail sent by CSMU X NCHU TAIWAN.

e-mail sent by CSMU X NCHU TAIWAN.

e-mail sent by CSMU X NCHU TAIWAN.

original information that CSMU NCHU TAIWAN offered

translation copy of the imformation

USA

Seen form the data we got from National Wetland Condition Assessment (NWCA), the copper concentration is general low when compared to the world.

Europe

Seen form the data from FOREGS-EuroGeoSurveys Geochemical Baseline Database, the copper concentration is general low when compared to the world.

Brazil

We get data from web of science, so it cannot represent Brazilian soil copper concentration comprehensively. Seen form the data got from web of science, many regions in Brazil have a high and even extremely high concentration.

Africa

We get data from web of science, so it cannot represent African soil copper concentration comprehensively. Seen form the data got from web of science, many regions in Africa have a high and even extremely high concentration.

India

We get data from web of science, so it cannot represent Indian soil copper concentration comprehensively. Seen form the data got from web of science, many regions in India have a high and even extremely high concentration.

China

Seen form the data got from Team Jianchao Li, Shaanxi Normal University, when the copper concentration is general low or moderate, some regions have high and even extremely high concentration when compared to the world.

The pollution of copper worldwide

The pollution of cadmium worldwide

The portal of every school: XMU JLU FAFU SJTU SCUT UCAS

Filmed a biosafety video together with other 12 teams

Biosafety is one of the most important knowledge everyone should master before starting their experiments. Unluckily, biosafety education in China is far too lagged behind compared with the exploding need; not only because of the out-dated education material but also due to the language problem accessing such resources overseas.

We’ve taken part in an intercollegiate cooperation project to produce series of Biosafety education materials in Chinese. With the tremendous amount of work of our collaborating partners and our team members, the video collection was finally published online and freely available at our homepage on YouTube and Bilibili, a popular Chinese video-sharing website.

12 teams gathered together to film a biosafety video, every team took different topics, but all based on Yale biosafety manual.

Our theme is about transportation of biological materials.

Helping TUST prepare for their first year of competition.

To begin with, we offered them some constructive suggestions, and communicated with their team adviser. In 24/3/2017, we were invited to TUST to carried out a recruiting propaganda for them, and helped them form a team.

Figure 1. communicating with TUST team leader.

Figure 2. Group photo of TUST and Tianjin.

Fugure 3. Group photo of the team leaders.

Figure 4. Group photo of team member.

TUST asked us to test GFP fluorescence intensity of the plasmid in their E.coli

Rrotocol

Testing results for TUST.

Testing results for TUST.

Test the mini system for OUC

What we did：

To verify whether the system built by China Ocean University was still available in other species of Saccharomyces cerevisiae. In that case, we used our laboratory-specific Saccharomyces cerevisiae with synthetic chromosome 10 to test its value of fluorescence intensity.

Protocol for fluorescence detection：

Yeast with plasmid was incubated overnight in YPD + G418 medium
Transfer the yeast suspension to the new YPD + G418 and adjusted the OD to 0.1
After incubation for 20 hours, the fluorescence was measured
Excitation light 502nm
Emitting light 532nm
The OD600 values were measured after fluorescence measurements

Results

Having compared our results with that provided by Ocean University, except for some slight deviation of measurements, we found that the experimental results in both labs were consistent, which indicated that the mini system had similar expression in different laboratories and yeast strains.

Figure 5. Testing results for OUC

Figure 6. Testing results for OUC

Figure 5. Testing results for OUC

Figure 6. Testing results for OUC

What we asked OUC to do

Easy - to - error PCR library development. They were supposed to amplify our existing error-prone PCR library by conducting error-prone PCR for the CUP1 promoter we used in our project.
Specific steps:
1.Error-prone PCR
2. digestion
3. Purification / Adsorption
4. Connect
5. E.Coli transformation
Easy-to-error PCR protocol (100μl)：
5X buffer（140mM MgCl2, 250mM KCl, 50mM Tris, and 0.1%(wt/vol) gelatin）20μl
Template (iGEM-Tianjin provided) 4μl
Primers (iGEM-Tianjin provided) 4μl*2
10X dNTP (2mM dGTP, 2mM dATP, 10mM dCTP, and 10 mM TTP) 10μl
Taq polymerase 2μl
5mM MnCl2 10μl
ddH2O 46μl

94℃ 3min
94℃ 30s
53℃ 30s
72℃ 30s
72℃ 1min
recycle for 35 times

The PCR products were obtained and digested with BamHI and XbaI, and ligated with vector pRS416.
After E.Coli transformation, we collected the target bacteria and plasmids

Helping NKU with their plasmid construction

What we did：

Helping NKU-iGEM construct their plasmid
The cleavage sites XbaI and SacI were added by PCR before and after lysase (lys)
Forward Primer：GCTCTAGAATGAAATACCTGCTGCCGAC
Reverse Primer：CGAGCTCtCAATGCGTTTCCATAATAGCAGC

After the PCR product was obtained, then came cleavage：

After overnight digestion, it was linking with the linearized plasmid pEX18 for 1 hr. Then the linking product was transformed into E.Coli.
PxylA-xylR was cleaved by SacI on plasmid pAX01
The pEX18-lys, which has been added with lys, was linearized by SacI single restrict digestion
The two were connected after 1hr
Then the linking product was transformed into E.coli.

Helped us to test the fluorescence intensity of pRS416-CUP1p-RFP without copper induction in Saccharomyces cerevisiae BY4742 and BY4741.

Plamids we constructed for NKU.

Plasmid

Plamids we constructed for NKU.

Plasmid

protocol
Cutsmart® buffer 5μl
XbaI 1μl
SacI 1μl
PCR product 43μl

After transformation

After transformation

Protocol

Cultures were incubated overnight in SC-URA medium.
Took some yeast suspension to the new SC-URA medium, then adjusted the OD600 value to 0.1 for 24 hours.
Fluorescence was measured, and the results were presented below:
Excitation 472nm
Radiation 532nm.

the data they obtained in their lab was provided for iGEM-Tianjin as reference

the data they obtained in their lab was provided for iGEM-Tianjin as reference