Difference between revisions of "Team:Tianjin/Collaborations"

 
(200 intermediate revisions by 6 users not shown)
Line 1: Line 1:
{{:Team:Tianjin/Templates/leftbar}}
+
{{:Team:Tianjin/Templates/leftbarforHP}}
  
 
<html>
 
<html>
 
<head>
 
<head>
 +
 +
<link rel="stylesheet" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:videostyle?action=raw&ctype=text/css">
 +
<link rel="stylesheet" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:video?action=raw&ctype=text/css">
 +
 +
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:style6666?action=raw&ctype=text/css" rel="stylesheet">
 
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:stylesub?action=raw&ctype=text/css" />
 
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:stylesub?action=raw&ctype=text/css" />
 
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:demo?action=raw&ctype=text/css" />
 
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:demo?action=raw&ctype=text/css" />
<link href="https://fonts.googleapis.com/css?family=Baloo+Bhaijaan|Montserrat:300i,400,400i,500i,600i,700,700i|PT+Sans:400,400i,700" rel="stylesheet">
+
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:photo2?action=raw&ctype=text/css" />
<link href='http://fonts.googleapis.com/css?family=Titillium+Web:400,700|Muli' rel='stylesheet' type='text/css'>
+
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:fonts?action=raw&ctype=text/css">
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:photoframe?action=raw&ctype=text/css
+
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:maincssmap?action=raw&ctype=text/css" rel="stylesheet">
" rel="stylesheet">
+
  
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:titledemo?action=raw&ctype=text/css
+
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:button?action=raw&ctype=text/css
" rel="stylesheet">
+
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:titlelinkstyle?action=raw&ctype=text/css
+
 
" rel="stylesheet">
 
" rel="stylesheet">
 +
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:zoom?action=raw&ctype=text/javascript"></script> 
 +
<script type="text/javascript">
 +
$(document).ready(function() {
 +
$('div.small_pic a').fancyZoom({scaleImg: true, closeOnClick: true});
 +
        $('div.small_pic_one a').fancyZoom({scaleImg: true, closeOnClick: true});
 +
        $('div.small_pic_mid a').fancyZoom({scaleImg: true, closeOnClick: true});
 +
        $('div.small_pic_demo a').fancyZoom({scaleImg: true, closeOnClick: true});
 +
        $('div.small_pic_demo_q a').fancyZoom({scaleImg: true, closeOnClick: true});
 +
        $('div.small_pic_demo_qq a').fancyZoom({scaleImg: true, closeOnClick: true});
 +
$('#zoom_word_1').fancyZoom({width:400, height:200});
 +
$('#zoom_word_2').fancyZoom();
 +
$('#zoom_flash').fancyZoom();
 +
});
 +
</script>
  
  
<link href="https://maxcdn.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet">
 
 
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:maincss?action=raw&ctype=text/css
 
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:maincss?action=raw&ctype=text/css
 
" rel="stylesheet">
 
" rel="stylesheet">
 +
 +
  
 
/* OVERRIDE IGEM SETTINGS */
 
/* OVERRIDE IGEM SETTINGS */
Line 81: Line 98:
 
*{padding:0;margin:0;list-style-type:none;}
 
*{padding:0;margin:0;list-style-type:none;}
 
/* go */
 
/* go */
.go{width:95px;height:390px;background-color:#FFF;position:fixed;_position:absolute;_top:expression(eval(document.documentElement.scrollTop+document.documentElement.clientHeight-this.offsetHeight-(parseInt(this.currentStyle.marginTop,10)||200)-(parseInt(this.currentStyle.marginBottom,10)||0)));right:12px;bottom:25%;border-radius:5px;box-shadow:0 0 2px #6E6E6E;*border:solid 1px #ddd;}
+
.go{width:95px;height:390px;background-color:#FFF;position:fixed;_position:absolute;_top:expression(eval(document.documentElement.scrollTop+document.documentElement.clientHeight-this.offsetHeight-(parseInt(this.currentStyle.marginTop,10)||200)-(parseInt(this.currentStyle.marginBottom,10)||0)));right:12px;bottom:25%;border-radius:5px;box-shadow:0 0 2px #6E6E6E;*border:solid 1px #ddd; z-index:999;}
 
.go a{background: url(https://static.igem.org/mediawiki/2017/7/70/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171004122500.png) no-repeat;display:block;text-indent:999em;width:95px;margin:5px;border:0;overflow:hidden;float:left}
 
.go a{background: url(https://static.igem.org/mediawiki/2017/7/70/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171004122500.png) no-repeat;display:block;text-indent:999em;width:95px;margin:5px;border:0;overflow:hidden;float:left}
 
.go .top{background-position:-8px 7px;height:60px}
 
.go .top{background-position:-8px 7px;height:60px}
Line 108: Line 125:
 
     z-index:9999;
 
     z-index:9999;
 
}
 
}
#description img{
+
 
text-align:center;
+
margin:3rem auto 3rem auto;
+
padding-top:1.2rem;
+
padding-bottom:1.2rem;
+
max-width:90%;
+
}
+
 
#description h1{
 
#description h1{
 
clear: both;
 
clear: both;
Line 123: Line 134:
 
font-size: 3.5 em;
 
font-size: 3.5 em;
 
         font-weight: 400;
 
         font-weight: 400;
font-family: 'Baloo Bhaijaan', cursive;
+
font-family: 'righteous',Verdana,sans-serif;
 
text-align:center;
 
text-align:center;
 
}
 
}
 +
 +
 
#description h3{
 
#description h3{
 
font-size:1.2 em;
 
font-size:1.2 em;
 
font-weight:bold;
 
font-weight:bold;
 
color:#0D0F3D;
 
color:#0D0F3D;
         margin-bottom:2em
+
         margin-bottom:2em;
 +
        text-align: justify;
 
}
 
}
 
#description a{
 
#description a{
Line 161: Line 175:
 
}
 
}
  
#description p {
+
#newstyle p {
 
     font-size: 1.225em;
 
     font-size: 1.225em;
 
     margin-bottom: 1.500em;
 
     margin-bottom: 1.500em;
Line 203: Line 217:
 
     text-align:justify;
 
     text-align:justify;
 
     font-family: 'Montserrat', sans-serif;
 
     font-family: 'Montserrat', sans-serif;
 +
}
 +
#map p {
 +
font-size: 1.2em;
 +
font-weight: 400;
 +
line-height: 1em;
 +
text-align: justify;
 +
font-family: 'LiberationSerif-Regular', sans-serif;
 +
margin: 0;
 +
padding: 0 1em 1em 1em;
 +
color: #f8f8f8;
 +
border: none;
 +
}
 +
#map h2 {
 +
font-size: 1.2em;
 +
font-weight: 700;
 +
text-align: center;
 +
font-family: 'raleway', sans-serif;
 +
text-shadow: none;
 +
background: none;
 +
border: none;
 +
color: #f8f8f8;
 +
box-shadow: none;
 +
padding: 0 2em 0 2em;
 +
}
 +
 +
#mappppp
 +
{
 +
    position: relative;
 +
    -moz-box-sizing: border-box;
 +
    box-sizing: border-box;
 +
}
 +
 +
       
 +
#newstyle .twopic{
 +
-moz-column-count: 2;
 +
-moz-column-gap: 0.8em;
 +
-webkit-column-count: 2;
 +
-webkit-column-gap: 0.8em;
 +
-ms-column-count: 2;
 +
-ms-column-gap: 0.8em;
 +
-o-column-count: 2;
 +
-o-column-gap: 0.8em;
 +
column-count: 2;
 +
column-gap: 0.8em;
 +
text-align: center;
 +
        margin:1em 2em;
 +
}
 +
#newstyle .middleone{
 +
        text-align:center;
 +
        margin:0 auto;
 +
}
 +
#fudong #img1 {
 +
float: right;
 +
margin: 0.5em 2em 0.5em 2em;
 +
max-width: 25em;
 +
}
 +
#fudong #img1 p {
 +
font-size: 1.1em;
 +
font-weight: 400;
 +
line-height: 1em;
 +
margin: 1em auto auto 0;
 +
text-align: center;
 +
padding-bottom: 1em;
 
}
 
}
  
Line 216: Line 293:
  
 
<div  class="page">
 
<div  class="page">
 +
    <div id="gotop" name="gotop">
  
      <div class="container">
+
</div>
<div class="grid">
+
     
<div class="grid__item color-7">
+
<a class="link link--mallki" href="#">Collaborations
+
                <span data-letters="Collaborations"></span>
+
                <span data-letters="Collaborations"></span>
+
                </a>
+
</div>
+
 
+
</div>
+
 
+
</div>
+
 
+
  
 
<div id="page" class="hfeed site">
 
<div id="page" class="hfeed site">
Line 237: Line 304:
 
<main id="main" class="about-main" role="main">
 
<main id="main" class="about-main" role="main">
 
             <article id="description">       
 
             <article id="description">       
                
+
                 <h1>Collaborations</h1>
                    <hr />
+
                    <a title="huge suprise" href="https://2017.igem.org/Team:Tianjin/surprise23333" target="_blank"><hr></a>
                 
+
  
+
</article>
  
 +
</main>
 +
 +
</div><!-- #primary -->
  
 
  
<div class="demo-2">
+
<div id="newstyle" class="demo-2">
 
<div class="container">
 
<div class="container">
  
 
 
 
<section class="main">
 
<section class="main">
    <div id="gotop" name="gotop">
 
  
 +
 +
 +
 +
 +
 +
<h2>Sent a Collaboration Request and constructed an alliance to build a worldwide database.</h2>
 +
<p>We came up with the idea that we could gather all the iGEM teams whose projects were about water pollution treatment and built an alliance to unite all information and data concerning the social impacts, knowledge and geographical advantages they collected during the conduction of their project.</p>
 +
 +
<h3>Built an alliance</h3>
 +
<p> On 12th of August, we had a voice conferencing with SJTU/SCUT/XMU/UCAS/JLU/FAFU, during which we discussed about how we wanted to use this alliance, and the discussion led to 2 conclusions:</p>
 +
<p>1. Build a worldwide database for the contents of heavy metals in local soil.</p>
 +
<p>2. Mutually promote the social impact of each parties in this alliance.</p>
 +
 +
 +
<h3>Constructed a world-wide database</h3>
 +
<p>On 23th of August, we sent a Collaboration Request to iGEM official website. And the next day, Ana Sifuentes replied our message and posted our request in the iGEM official website.</p>
 +
 +
 +
<div class="zxx_zoom_one" style="left:0%;">
 +
                    <div class="small_pic_one" style="float:left;">
 +
                        <a href="#pic_nine">
 +
                            <img src="https://static.igem.org/mediawiki/2017/8/8f/Tianjin-HP823.jpg"></a>
 +
<div style="padding-left:20%;"><p></p>
 
</div>
 
</div>
 +
                    </div>
 +
                   
 +
                    </div>
 +
                 
 +
                  <div id="pic_nine" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/8/8f/Tianjin-HP823.jpg"/></div>
  
 +
 +
                <p> we received the response of many teams like heretofore team EXETER and team CSMU NCHU TAIWAN. With their information, we constructed a database which contained the global data of contents of Cu2+/Cd2+ in soil or water. And we built it based on the world map. We received team CSMU NCHU TAIWAN's kindly help——they offered us information about major metal pollution incidents in Taiwan as well as the real time monitoring data of places that had the potential risk of occurrence of serious pollution incidents.</p>
 +
 +
<div class="middleone">
 +
                       
 +
                            <img
 +
 +
src="https://static.igem.org/mediawiki/2017/0/0e/122%E5%89%AF%E6%9C%AC.png">
 +
<div align="center"><p style="font-size:1.7rem;text-align:center">E-mails sent by iGEM EXETER and Nazarbayev University</p></div>
 +
                    </div>
 +
 +
<div class="zxx_zoom_demo_q">
 +
                    <div class="small_pic_demo_q" style="float:left;">
 +
                        <a href="#pic_twentyttwo">
 +
                            <img src="https://static.igem.org/mediawiki/2017/1/19/Tianjin_hp_int_A.png"></a><p style="font-size:15px;text-align:center"><br/>e-mail sent by CSMU X NCHU TAIWAN.
 +
</p>
 +
                    </div>
 +
                    <div class="small_pic_demo_q" style="float:right;">
 +
                        <a href="#pic_twentytthree" >
 +
                          <img src="https://static.igem.org/mediawiki/2017/e/ee/C.png"/>
 +
                        </a> <p style="font-size:15px;text-align:center"><br/>e-mail sent by CSMU X NCHU TAIWAN.</p>
 +
                    </div>
 +
                   
 +
                    </div>
 +
                  <div id="pic_twentyttwo" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/2/23/Tianjin-xinru7.jpg"/><p style="font-size:15px;text-align:center"><br/>e-mail sent by CSMU X NCHU TAIWAN.
 +
</p></div>
 +
                  <div id="pic_twentytthree" style="display:none;"><img src="http://211.81.63.130/cache/12/04/2017.igem.org/de4549e774d5628e5d37b1fd8cfac22a/234.png"/><p style="font-size:15px;text-align:center"><br/>e-mail sent by CSMU X NCHU TAIWAN.</p></div>
 +
 +
 +
 +
<p>original information that CSMU NCHU TAIWAN offered
 +
</p>
 +
 +
<div class="set_5_button3"><a href="https://static.igem.org/mediawiki/2017/e/ed/%E5%8F%B0%E7%81%A3%E9%87%8D%E9%87%91%E5%B1%AC%E6%B1%99%E6%9F%93%E7%B5%B1%E8%A8%88%E8%B3%87%E6%96%99%283%29.xls"><i class="fa fa-file-excel-o" aria-hidden="true"></i>
 +
EXCEL</a></div>
 +
 +
<div class="set_5_button5"><a href="https://static.igem.org/mediawiki/2017/3/3b/%E5%8F%B0%E7%81%A3%E9%87%8D%E5%A4%A7%E9%87%8D%E9%87%91%E5%B1%AC%E6%B1%99%E6%9F%93%E4%BA%8B%E4%BB%B6.docx"><i class="fa fa-file-word-o" aria-hidden="true"></i>
 +
WORD</a></div>
 +
 +
<br><br>
 +
<p>translation copy of the imformation</p>
 +
<div class="set_5_button3"><a href="https://static.igem.org/mediawiki/2017/1/18/Tianjin-hp-taiwanmetal.xls"><i class="fa fa-file-excel-o" aria-hidden="true"></i>
 +
EXCEL</a></div>
 +
<div class="set_5_button5"><a href="https://static.igem.org/mediawiki/2017/8/89/English_translation.docx"><i class="fa fa-file-word-o" aria-hidden="true"></i>
 +
WORD</a></div>
 +
 +
 +
 +
<div id="map">
 +
<div class="distribution-map">
 +
 +
    <img src="https://static.igem.org/mediawiki/2017/1/15/Tianjin-copperworldwide.jpg" />
 +
 +
    <button class="map-point" style="top:32%;left:32%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>USA</h2>
 +
                <p>Seen form the data we got from National Wetland Condition Assessment (NWCA), the copper concentration is general low when compared to the world. </p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
 +
    <button class="map-point" style="top:25%;left:55%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>Europe</h2>
 +
                <p>Seen form the data from FOREGS-EuroGeoSurveys Geochemical Baseline Database, the copper concentration is general low when compared to the world. </p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
 +
    <button class="map-point" style="top:56%;left:43%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>Brazil</h2>
 +
                <p>We get data from web of science, so it cannot represent Brazilian soil copper concentration comprehensively. Seen form the data got from web of science, many regions in Brazil have a high and even extremely high concentration.</p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
 +
    <button class="map-point" style="top:62%;left:56%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>Africa</h2>
 +
                <p>We get data from web of science, so it cannot represent African soil copper concentration comprehensively. Seen form the data got from web of science, many regions in Africa have a high and even extremely high concentration.</p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
 +
    <button class="map-point" style="top:40%;left:68%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>India</h2>
 +
                <p>We get data from web of science, so it cannot represent Indian soil copper concentration comprehensively. Seen form the data got from web of science, many regions in India have a high and even extremely high concentration.</p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
    <button class="map-point" style="top:35%;left:74%">
 +
        <div id="mappppp" class="content">
 +
            <div class="centered-y">
 +
                <h2>China</h2>
 +
                <p>Seen form the data got from Team Jianchao Li, Shaanxi Normal University, when the copper concentration is general low or moderate, some regions have high and even extremely high concentration when compared to the world. </p>
 +
            </div>
 +
        </div>
 +
    </button>
 +
 +
</div>
 +
</div>
 +
 +
<p style="text-align:center">The pollution of copper worldwide</p>
 +
 +
<img src="https://static.igem.org/mediawiki/2017/thumb/9/9a/Tianjin-cadmiumworldwideBLUE.jpg/1600px-Tianjin-cadmiumworldwideBLUE.jpg">
 +
 +
 +
<p style="text-align:center">The pollution of cadmium worldwide</p>
 +
<p>The portal of every school:
 +
<a href="https://2017.igem.org/Team:XMU-China/Collaborations">XMU</a>
 +
<a href="https://2017.igem.org/Team:Jilin_China/Collaborations">JLU</a>
 +
<a href=" https://2017.igem.org/Team:FAFU-China/Collaborations">FAFU</a>
 +
<a href="https://2017.igem.org/Team:SJTU-BioX-Shanghai/Collaborations">SJTU</a>
 +
<a href="https://2017.igem.org/Team:SCUT-China_A/Collaborations">SCUT</a>
 +
<a href="https://2017.igem.org/Team:UCAS/Collaborations">UCAS</a></P>
 +
 +
 +
 +
<div id="one" name="one"></div>
 +
<h2>Filmed a biosafety video together with other 12 teams</h2>
 +
<p>Biosafety is one of the most important knowledge everyone should master before starting their experiments. Unluckily, biosafety education in China is far too lagged behind compared with the exploding need; not only because of the out-dated education material but also due to the language problem accessing such resources overseas.</p>
 +
<p>We’ve taken part in an intercollegiate cooperation project to produce series of Biosafety education materials in Chinese. With the tremendous amount of work of our collaborating partners and our team members, the video collection was finally published online and freely available at our homepage on YouTube and Bilibili, a popular Chinese video-sharing website.</p>
 +
<p>12 teams gathered together to film a biosafety video, every team took different topics, but all based on Yale biosafety manual.</p>
 +
<p>Our theme is about transportation of biological materials. </p>
 +
 +
<div id="demovi" style="text-align:center;">
 +
             
 +
                <ul>
 +
                   
 +
                    <li><button type="button" class="btn demovi-media" data-src="https://static.igem.org/mediawiki/2017/4/48/Team_Tianjin_Safety.mp4"><img src="https://static.igem.org/mediawiki/2017/4/4c/Tianjin_safety_coverimg.jpg"></button></li>
 +
                    <script src="https://2017.igem.org/Team:Tianjin/Resources/JS:MODALitmin?action=raw&ctype=text/javascript"></script>
 +
    <script src="https://2017.igem.org/Team:Tianjin/Resources/JS:script?action=raw&ctype=text/javascript"></script>
 +
 +
                </ul>
 +
            </div>
 +
 +
 +
 +
<div align="center">
 +
  <div class="info" style="padding-top:40px; margin:0 auto;">
 +
    <div class="buttons">
 +
      <p><a href="" style="text-decoration:none; font-size:2rem;" data-modal="#modal" class="modal__trigger"><b>other team's video</b></a></p>
 +
    </div>
  
 
    
 
    
<h2>Helping TUST prepare for their first year of competition.</h2>
+
  </div>
<p>To begin with, we gave them construct suggestions, communicated with their team adviser. In 24/3/2017, we were invited to TUST to carried out recruiting propaganda for them, and provided our construction guide.</p>
+
 
<div id="middle" name="middle">
+
 
<h3>2017.08.01</h3>
+
<!-- Modal -->
<p>In 2017.08.01, TUST and Tianjin held a meeting together, during the meeting, TUST gave an account of their recent progress, we suggested them to add some new synthetic routes and elements, and probably new strain instead of simply Xylinus for fibrin.</p>
+
<div id="modal" class="modal modal__bg" role="dialog" aria-hidden="true">
 +
  <div class="modal__dialog">
 +
    <div class="modal__content">
 +
<div class="hahaha" style="width:46em;" align="center">
 +
<style>
 +
a{
 +
text-decoration:none;
 +
color:#FFBC2C;
 +
}
 +
.hahaha button{
 +
  background: #5E63B6;
 +
  color:#fff;
 +
  border:none;
 +
  position:relative;
 +
  height:40px;
 +
  width:30em;
 +
  font-size:1.4em;
 +
  padding:0 2em;
 +
  cursor:pointer;
 +
  transition:800ms ease all;
 +
  outline:none;
 +
  margin-top:0.1em;
 +
  margin-bottom:0.2em;
 +
  border-radius:2em;
 +
}
 +
.hahaha button:hover{
 +
  background:#fff;
 +
  color:#1AAB8A;
 +
}
 +
.hahaha button:before,button:after{
 +
  content:'';
 +
  position:absolute;
 +
  top:0;
 +
  right:0;
 +
  height:2px;
 +
  width:0;
 +
  background: #1AAB8A;
 +
  transition:400ms ease all;
 +
}
 +
.hahaha button:after{
 +
  right:inherit;
 +
  top:inherit;
 +
  left:0;
 +
  bottom:0;
 +
}
 +
.hahaha button:hover:before,button:hover:after{
 +
  width:93%;
 +
  right:1em;
 +
  left:1em;
 +
  transition:800ms ease all;
 +
}
 +
 
 +
 
 +
</style>
 +
<button onClick="window.open('https://youtube.com/channel/UCZEYJNccLLPRro1SX1AfVAA')">YouTube</button>
 +
<button onClick="window.open('https://www.bilibili.com/video/av15520383/')">bilibili</button>
 +
<button onClick="window.open('https://2017.igem.org/Team:Shanghaitech/BioSafety')">ShanghaiTech University</button>
 +
<button onClick="window.open('https://2017.igem.org/Team:UCAS/Collaborations#biosafety')">University of Chinese Academy of Science</button>
 +
<button onClick="window.open('https://2017.igem.org/Team:TUST_China/Collaborations')">Tianjin University of Science & Technology</button>
 +
<button onClick="window.open('https://2017.igem.org/Team:UESTC-China/Collaborations')">University of Electronic Science and Technology of China</button>
 +
<button onClick="window.open('https://2017.igem.org/Team:BNU-China/Collaborations#biosafety')">Beijing Normal University</button>
 +
<button onClick="window.open('https://2017.igem.org/Team:WHU-China/Collaborations')">Wuhan University</button>
 +
<button onClick="window.open('https://2017.igem.org/Team:AHUT_China/Collaborations')">Anhui University of Technology</button>
 +
<button onClick="window.open('https://2017.igem.org/Team:NAU-CHINA/Collaborations')">Nanjing Agricultural University</button>
 +
<button onClick="window.open('https://2017.igem.org/Team:FAFU-CHINA/Collaborations')">Fujian Agriculture and Forestry Universiy</button>
 +
</div>
 +
      <!-- modal close button -->
 +
      <a href="" class="modal__close demo-close">
 +
      <svg class="" viewBox="0 0 24 24">
 +
        <path d="M19 6.41l-1.41-1.41-5.59 5.59-5.59-5.59-1.41 1.41 5.59 5.59-5.59 5.59 1.41 1.41 5.59-5.59 5.59 5.59 1.41-1.41-5.59-5.59z"/>
 +
        <path d="M0 0h24v24h-24z" fill="none"/>
 +
      </svg>
 +
      </a> </div>
 +
  </div>
 
</div>
 
</div>
  
  
<div id="two" name="two">
+
 
<h3>Later on</h3>
+
<script src="https://2017.igem.org/Team:Tianjin/Resources/JS:index?action=raw&ctype=text/javascript"></script>  
<p>Later on, TUST came again with their modeling problem, we gave them suggestion that we can share the Fluorescence method and modeling method with them, design Fluorescence experience and modeling together since it’s their first year competition.</p>
+
 
</div>
 
</div>
  
<div class="carousel photo-frame" >
+
    <ul class="list">
+
 
        <li><img src="https://static.igem.org/mediawiki/2017/5/54/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003130153.jpg"></li>
+
 
        <li><img src="https://static.igem.org/mediawiki/2017/6/64/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003130215.jpg"/></li>
+
<div id="two" name="two"></div>
        <li><img src="https://static.igem.org/mediawiki/2017/c/ca/20171003132121.jpg"/></li>
+
 
        <li><img src="https://static.igem.org/mediawiki/2017/5/53/20171003132127.jpg"/></li>
+
<h2>Helping <a href="https://2017.igem.org/Team:TUST_China/Collaborations">TUST</a> prepare for their first year of competition.</h2>
    </ul>
+
<p>To begin with, we offered them some constructive suggestions, and communicated with their team adviser. In 24/3/2017, we were invited to TUST to carried out a recruiting propaganda for them, and helped them form a team.</p>
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:index2?action=raw&ctype=text/javascript"></script> 
+
<div id="middle" name="middle">
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:jqueryminjs?action=raw&ctype=text/javascript"></script>
+
<h3>Giving TUST Constructing and experimental advice</h3>
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:photo?action=raw&ctype=text/javascript"></script>  
+
<p>In 2017.08.01, TUST and Tianjin held a meeting together, during which TUST gave an account of their recent progress, we suggested them to add some new synthetic routes and elements in their project, and probably a new strain instead of simply Xylinus for fibrin.</p>
 
</div>
 
</div>
  
  
<h2>Helping NKU with their plasmid construction</h2>
+
<div class="twopic">
<p>1. NKU asked us to help them construct a plasmid. Using pEX18Gm as the supporter, we ought to added Lyase gene sequence(which they had already provided) and xyR-xyA sequence from pAX01 as well.</p>
+
<div>
<div id="three" name="three">
+
<img src="https://static.igem.org/mediawiki/2017/7/75/Tianjin_collaboration_weixin_4.jpeg"><p style="font-size:15px;text-align:center">Figure 1. communicating with TUST team leader. </p></div>
<h3>After construction</h3>
+
<div><img src="https://static.igem.org/mediawiki/2017/6/64/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003130215.jpg"/>
<p>After construction, they sent us plasmid pAX01 and the plasmid which contains Lyase gene sequence, we helped them with ligasion and transformation.</p>
+
<p style="font-size:15px;text-align:center">Figure 2. Group photo of TUST and Tianjin.</p></div>
 
</div>
 
</div>
  
<div class="carousel photo-frame" >
+
<div id="two" name="two">
    <ul class="list">
+
<h3>What We Did For Them</h3>
        <li><img src="https://static.igem.org/mediawiki/2017/9/92/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171002211559.jpg"></li>
+
<p>TUST came to us again with their modeling problem, we gladly suggested them to share the Fluorescence method and modeling method with us. Since it's their first year competition, we offered them to design Fluorescence experience and modeling together. </p>
        <li><img src="https://static.igem.org/mediawiki/2017/b/b7/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171002211622.jpg"/></li>
+
        <li><img src="https://static.igem.org/mediawiki/2017/9/92/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171002211559.jpg"></li>
+
        <li><img src="https://static.igem.org/mediawiki/2017/b/b7/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171002211622.jpg"/></li>
+
    </ul>
+
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:index2?action=raw&ctype=text/javascript"></script> 
+
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:jqueryminjs?action=raw&ctype=text/javascript"></script> 
+
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:photo?action=raw&ctype=text/javascript"></script>  
+
 
</div>
 
</div>
  
Line 305: Line 615:
  
  
 +
<div class="twopic">
 +
<div>
 +
<img src="https://static.igem.org/mediawiki/2017/8/80/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003132121.jpg"><p style="font-size:15px;text-align:center">Fugure 3. Group photo of the team leaders. </p></div>
 +
<div><img src="https://static.igem.org/mediawiki/2017/7/7d/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003132127.jpg"/>
 +
<p style="font-size:15px;text-align:center">Figure 4. Group photo of team member.</p></div>
 +
</div>
  
  
 +
<p>TUST asked us to test GFP fluorescence intensity of the plasmid in their <i>E.coli</i>
 +
<i><p>Rrotocol</p>
 +
<p><i>E.coli</i> overnight cultured in LB+CM<p>
 +
<p>Remove bacteria liquid to LB+CM , regulate OD600 to 0.1 to culture 12 hr</p>
 +
<p>Measure the fluorescence value</p>
 +
<p>Stimulate 488 nm</p>
 +
<p>Radiate 511 nm</p>
 +
<p>Test OD600</p>
 +
<p>Run data processing</p></i>
  
 +
<div class="zxx_zoom_demo_q" align="center">
 +
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:zoom?action=raw&ctype=text/javascript"></script>
 +
                    <div class="small_pic_demo_q" align="center">
 +
                        <a href="#pic_eightyone">
 +
                          <img src="https://static.igem.org/mediawiki/2017/a/a8/TK.png"></a>
 +
<p style="font-size:15px;text-align:center"><br/>Testing results for TUST.</p>
 +
                    </div>
 +
                 
 +
                    </div>
 +
                 
 +
                  <div id="pic_eightyone" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/a/a8/TK.png"><p style="font-size:15px;text-align:center"><br/>Testing results for TUST.</p></div>
  
  
<p><a class="ref" href=""></a></p>
+
<div id="three" name="three"></div>
     
+
<h2>Test the mini system for <a href="https://static.igem.org/mediawiki/2017/b/b2/Tianjin_collaboration_ouc_3.png">OUC</a></h2>
<h2>Test the mini system for OUC</h2>
+
<h3>What we did:</h3>
<p>Mini system is a system composed of a mini promoter (about 100bp) and a mini terminator, and it is applicable for yeast. Because of the similarity of our biological chassis, they reached out to us and wanted us to run some control experiments for them. Using the same protocol and their mini system, we need to transform the system into our Saccharomyces cerevisiae in order to test if the plasmid will still function the same. </p>
+
<p>To verify whether the system built by China Ocean University was still available in other species of <i>Saccharomyces cerevisiae</i>. In that case, we used our laboratory-specific <i>Saccharomyces cerevisiae</i> with synthetic chromosome 10 to test its value of fluorescence intensity.</p>
  
<h3>Protocol</h3>
+
<p><i>Protocol for fluorescence detection</i></p>
<p>2. Protocol: initial OD600 = 0.01
+
        Test OD600 and threshold fluorescence every other 5-6 hours
+
            Exciting light λ=502/Emissive light λ=532
+
</p>
+
<div class="carousel photo-frame" >
+
    <ul class="list">
+
        <li><img src="https://static.igem.org/mediawiki/2017/b/b4/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003144056.jpg"></li>
+
        <li><img src="https://static.igem.org/mediawiki/2017/3/35/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003144102.jpg"/></li>
+
        <li><img src="https://static.igem.org/mediawiki/2017/b/b4/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003144056.jpg"></li>
+
        <li><img src="https://static.igem.org/mediawiki/2017/3/35/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003144102.jpg"/></li>
+
    </ul>
+
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:index2?action=raw&ctype=text/javascript"></script> 
+
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:jqueryminjs?action=raw&ctype=text/javascript"></script> 
+
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:photo?action=raw&ctype=text/javascript"></script>
+
</div>
+
  
+
<p><i>Yeast with plasmid was incubated overnight in YPD + G418 medium<br>
<h2>Sent a Collaboration Request and construct an alliance to build a worldwide database.</h2>
+
Transfer the yeast suspension to the new YPD + G418 and adjusted the OD to 0.1<br>
<p>We came up with the idea that we could gather all the iGEM team whose project is about water pollution treatment together and build an alliance to unite all our social impact, knowledge and geographical advantages.</p>
+
After incubation for 20 hours, the fluorescence was measured<br>
 +
Excitation light 502nm<br>
 +
Emitting light 532nm<br>
 +
The OD600 values were measured after fluorescence measurements</i></p>
 +
<P>Results</p>
 +
<p>Having compared our results with that provided by Ocean University, except for some slight deviation of measurements, we found that the experimental results in both labs were consistent, which indicated that the mini system had similar expression in different laboratories and yeast strains.</p>
  
<h3>2017.08.12</h3>
+
 
<p>2. In 12th of August, we had a voice conferencing with SJTU/SCUT/XMU/UCAS/JLU/FAFU, we discussed about how we want to use this alliance and came up with 2 conclusion:
+
 
1. Build a worldwide database containing contents of heavy metals in soil
+
 
2. Mutual improve our social impact
+
 
 +
<div class="zxx_zoom_demo_q">
 +
                    <div class="small_pic_demo_q" style="float:left;">
 +
                        <a href="#pic_onehundredone">
 +
                            <img src="https://static.igem.org/mediawiki/2017/c/cb/Onehundredone.jpeg"></a><p style="font-size:15px;text-align:center"><br/>Figure 5. Testing results for OUC
 
</p>
 
</p>
 +
                    </div>
 +
                    <div class="small_pic_demo_q" style="float:right;">
 +
                        <a href="#pic_onehundredones" >
 +
                          <img src="https://static.igem.org/mediawiki/2017/9/93/Tianjin_collaboration_ouc_2.png"/>
 +
                        </a> <p style="font-size:15px;text-align:center"><br/>Figure 6. Testing results for OUC</p>
 +
                    </div>
 +
                   
 +
                    </div>
 +
                  <div id="pic_onehundredone" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/0/0b/Qwerrt.jpg"/><p style="font-size:15px;text-align:center"><br/>Figure 5. Testing results for OUC
 +
</p></div>
 +
                  <div id="pic_onehundredones" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/9/93/Tianjin_collaboration_ouc_2.png"/><p style="font-size:15px;text-align:center"><br/>Figure 6. Testing results for OUC</p></div>
  
+
<h3>What we asked OUC to do</h3>
<h3>2017.08.23</h3>
+
<p>In 23th of August, we sent a Collaboration Request to iGEM official website, the next day Ana Sifuentes replied our message and posted our request in the iGEM official website, and we received the response of many teams like team EXETER and team CSMU NCHU TAIWAN, with their information, we construct a database which contains the worldwide data of contents of Cu2+/Cd2+ in soil or water. And we build it based on map of the world.</p>
+
  
 +
<div id="fudong">
 +
  <div id="img1">     
 +
  <img src="https://static.igem.org/mediawiki/2017/8/8e/Tianjin-WWWWWWWWWWWW.jpg">                       
 +
  <p align="center"></p>                 
 +
</div>
 +
<p>Easy - to - error PCR library development. They were supposed to amplify our existing error-prone PCR library by conducting error-prone PCR  for the CUP1 promoter we used in our project.<br>
 +
Specific steps:<br>
 +
1.Error-prone PCR<br>
 +
2. digestion<br>
 +
3. Purification / Adsorption<br>
 +
4. Connect<br>
 +
5. <i>E.Coli</i> transformation<br>
 +
<i>Easy-to-error PCR protocol (100μl):<br>
 +
5X buffer(140mM MgCl2, 250mM KCl, 50mM Tris, and 0.1%(wt/vol) gelatin)20μl<br>
 +
Template (iGEM-Tianjin provided) 4μl<br>
 +
Primers (iGEM-Tianjin provided) 4μl*2<br>
 +
10X dNTP (2mM dGTP, 2mM dATP, 10mM dCTP, and 10 mM TTP) 10μl<br>
 +
Taq polymerase 2μl<br>
 +
5mM MnCl2 10μl<br>
 +
ddH2O 46μl<br></i>
 +
</p>
 +
<p>94℃ 3min<br>
 +
94℃ 30s<br>
 +
53℃ 30s<br>     
 +
72℃ 30s<br>
 +
72℃ 1min<br>
 +
recycle for 35 times<br>
 +
</p>
  
<h2>Helping CQU construct their team and sign up for their first year</h2>
 
<p>First, I believe that this nation should commit itself to achieving the goal, before this decade is out, of landing a man on the moon and returning him safely to the earth. No single space project in this period will be more impressive to mankind, or more important for the long-range exploration of space; and none will be so difficult or expensive to accomplish. </p>
 
  
<h3>This one goes deeper</h3>
 
<p>A good rule for rocket experimenters to follow is this: always assume that it will explode. The vehicle explodes, literally explodes, off the pad. The simulator shakes you a little bit, but the actual liftoff shakes your entire body and soul.</p>
 
  
<h4>Even deeper</h4>
 
<p>The path of the righteous man is beset on all sides by the iniquities of the selfish and the tyranny of evil men. Blessed is he who, in the name of charity and good will, shepherds the weak through the valley of darkness, for he is truly his brother's keeper and the finder of lost children.</p>
 
<div id="gobottom" name="gobottom">
 
<h3>And a level-3 title again</h3>
 
<p>It has been said that astronomy is a humbling and character-building experience. There is perhaps no better demonstration of the folly of human conceits than this distant image of our tiny world. To me, it underscores our responsibility to deal more kindly with one another, and to preserve and cherish the pale blue dot, the only home we've ever known.</p>
 
 
</div>
 
</div>
  
<h2>Filmed a biosafety video together with other 12 teams</h2>
 
<p>12 teams gather together to film a biosafety video, every team took different topics, but all based on Yale biosafety manual.</p>
 
  
<h3>This one goes deeper</h3>
+
<p>The PCR products were obtained and digested with BamHI and XbaI, and ligated with vector pRS416.<br>
<p>A good rule for rocket experimenters to follow is this: always assume that it will explode. The vehicle explodes, literally explodes, off the pad. The simulator shakes you a little bit, but the actual liftoff shakes your entire body and soul.</p>
+
After <i>E.Coli</i> transformation, we collected the target bacteria and plasmids</p>
  
<h4>Even deeper</h4>
 
<p>The path of the righteous man is beset on all sides by the iniquities of the selfish and the tyranny of evil men. Blessed is he who, in the name of charity and good will, shepherds the weak through the valley of darkness, for he is truly his brother's keeper and the finder of lost children.</p>
 
<div id="gobottom" name="gobottom">
 
<h3>And a level-3 title again</h3>
 
<p>It has been said that astronomy is a humbling and character-building experience. There is perhaps no better demonstration of the folly of human conceits than this distant image of our tiny world. To me, it underscores our responsibility to deal more kindly with one another, and to preserve and cherish the pale blue dot, the only home we've ever known.</p>
 
</div>
 
<p><a class="ref" href=""></a></p>
 
</section>
 
</div>
 
<div class="go">
 
<a title="top" class="top" href="#gotop"></a>
 
<a title="middle" class="feedback" href="#middle"></a>
 
    <a title="22" class="two" href="#two"></a>
 
    <a title="33" class="three" href="#three"></a>
 
    <a title="44" class="four" href="#four"></a>
 
<a title="bottom" class="bottom" href="#gobottom"></a>
 
</div>
 
</div>
 
  
</article>
 
  
</main>
 
  
</div><!-- #primary -->
 
<script>
 
window.requestAnimFrame = (function(callback) {
 
return window.requestAnimationFrame || window.webkitRequestAnimationFrame || window.mozRequestAnimationFrame || window.oRequestAnimationFrame || window.msRequestAnimationFrame ||
 
function(callback) {
 
window.setTimeout(callback, 1000 / 60);
 
};
 
})();
 
  
var requestId, jolttime;
+
<div class="zxx_zoom_demo_q" align="center">
 +
                    <div class="small_pic_demo_q">
 +
                        <a href="#pic_nineteen">
 +
                            <img src="https://static.igem.org/mediawiki/2017/1/1c/OUC3.png"></a>
 +
<div align="center"><p style="font-size:1.7rem;text-align:center"></p></div>
 +
                    </div>
 +
                   
 +
                    </div>
 +
<div id="pic_nineteen" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/b/b7/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171002211622.jpg"/></div>
  
var c = document.getElementById('canv');
+
                 
var $ = c.getContext('2d');
+
                 
 +
 +
<div id="four" name="four"></div>
  
var s = 18; //grid square size
+
                 
var mv = 10; //moving areas
+
<h2>Helping <a href="https://2017.igem.org/Team:NKU_China/Collaborations">NKU</a> with their plasmid construction</h2>
var sp = 1; //move speed
+
<h3>What we did:</h3>
var clm = 23; //columns
+
<p>Helping NKU-iGEM construct their plasmid<br>The cleavage sites XbaI and SacI were added by PCR before and after lysase (lys)<br>Forward Primer:GCTCTAGAATGAAATACCTGCTGCCGAC<br>Reverse Primer:CGAGCTCtCAATGCGTTTCCATAATAGCAGC</p>
var rw = 10; //rows
+
<p>After the PCR product was obtained, then came cleavage:</p>
var x = []; //x array
+
<p>After overnight digestion, it was linking with the linearized plasmid pEX18 for 1 hr.
var y = []; //y array
+
Then the linking product was transformed into <i>E.Coli.</i><br>PxylA-xylR was cleaved by SacI on plasmid pAX01<br>The pEX18-lys, which has been added with lys, was linearized by SacI single restrict digestion<br>The two were connected after 1hr<br> Then the linking product was transformed into E.coli.</p>
var X = []; //starting X array
+
<p>Helped us to test the fluorescence intensity of pRS416-CUP1p-RFP without copper induction in <i>Saccharomyces cerevisiae</i> BY4742 and BY4741.</p>
var Y = []; //starting Y array
+
  
c.width  = c.offsetWidth;
 
c.height = c.offsetHeight;
 
  
for (var i = 0; i < clm * rw; i++) {
 
x[i] = ((i % clm) - 0.5) * s;
 
y[i] = (Math.floor(i / clm) - 0.5) * s;
 
X[i] = x[i];
 
Y[i] = y[i];
 
}
 
var t = 0;
 
  
function jolt() {
+
<div class="zxx_zoom_demo_qq" align="center">
$.fillRect(0, 0, c.width, c.height);
+
                    <div class="small_pic_demo_qq" style="float:left;">
 +
                        <a href="#pic_eightyseven">
 +
                            <img src="https://static.igem.org/mediawiki/2017/9/90/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171030224823.png"></a><p style="font-size:15px;text-align:center"><br/>Plamids we constructed for NKU.
 +
</p>
 +
                    </div>
 +
                    <div class="small_pic_demo_qq" style="float:right;">
 +
                        <a href="#pic_eightyeight" >
 +
                          <img src="https://static.igem.org/mediawiki/2017/f/f8/Tianjin_collaboration_nku_22.png"/>
 +
                        </a> <p style="font-size:15px;text-align:center"><br/>Plasmid</p>
 +
                    </div>
 +
                   
 +
                    </div>
 +
                  <div id="pic_eightyseven" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/d/d3/Tianjin_collaboration_nku_1.png"><br/>Plamids we constructed for NKU.
 +
</p></div>
 +
                  <div id="pic_eightyeight" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/d/d3/Tianjin_collaboration_nku_2.png"/><p style="font-size:15px;text-align:center"><br/>Plasmid</p></div>
  
for (var i = 0; i < clm * rw; i++) {
 
if (i % clm != clm - 1 && i < clm * (rw - 1) - 1) {
 
$.fillStyle = "hsla(0,0,0,1)";
 
$.strokeStyle = "#95D384";
 
$.lineWidth = 1;
 
$.beginPath();
 
$.moveTo(x[i], y[i]);
 
$.lineTo(x[i + 1], y[i + 1]);
 
$.lineTo(x[i + clm + 1], y[i + clm + 1]);
 
$.lineTo(x[i + clm], y[i + clm]);
 
$.closePath();
 
$.stroke();
 
$.fill();
 
}
 
}
 
for (var i = 0; i < rw * clm; i++) {
 
if ((x[i] < X[i] + mv) && (x[i] > X[i] - mv) && (y[i] < Y[i] + mv) && (y[i] > Y[i] - mv)) {
 
x[i] = x[i] + Math.floor(Math.random() * (sp * 2 + 1)) - sp;
 
y[i] = y[i] + Math.floor(Math.random() * (sp * 2 + 1)) - sp;
 
} else if (x[i] >= X[i] + mv) {
 
x[i] = x[i] - sp;
 
} else if (x[i] <= X[i] - mv) {
 
x[i] = x[i] + sp;
 
} else if (y[i] >= Y[i] + mv) {
 
y[i] = y[i] - sp;
 
} else if (y[i] <= Y[i] + mv) {
 
y[i] = y[i] + sp;
 
}
 
}
 
//controls time of electric shake> when counter equals 0, it will reset for 5s then start again.
 
if (t % c.width == 0) {
 
jolttime = setTimeout('jolt()', 5);
 
t++;
 
} else {
 
jolttime = setTimeout('jolt()', 5);
 
t++;
 
}
 
}
 
  
function start() {
 
if (!requestId) {
 
requestId = window.requestAnimFrame(jolt);
 
}
 
}
 
  
function stop() {
+
if (requestId) {
+
clearTimeout(jolttime);
+
                <p><i>protocol<br>
window.cancelAnimationFrame(requestId);
+
Cutsmart® buffer 5μl<br>XbaI 1μl<br>SacI 1μl<br>PCR product 43μl</i></p>
requestId = undefined;
+
}
+
}
+
  
document.querySelector('a.link--asiri').addEventListener('mouseenter', start);
 
document.querySelector('a.link--asiri').addEventListener('mouseleave', stop);
 
</script>
 
<script>
 
// For Demo purposes only (show hover effect on mobile devices)
 
[].slice.call( document.querySelectorAll('.grid a') ).forEach( function(el) {
 
el.onclick = function() { return false; }
 
} );
 
</script>
 
  
 +
<div class="zxx_zoom_demo_qq" align="center">
 +
<script  type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:zoom?action=raw&ctype=text/javascript"></script>
 +
                    <div class="small_pic_demo_qq" align="center">
 +
                        <a href="#pic_ninety">
 +
                          <img src="https://static.igem.org/mediawiki/2017/1/15/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171030224739.jpg"></a>
 +
<p style="font-size:15px;text-align:center"><br/>After transformation</p>
 +
                    </div>
 +
                 
 +
                    </div>
 +
                 
 +
                  <div id="pic_ninety" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/a/ae/Tianjin_collaboration_nku_3.jpeg"><p style="font-size:15px;text-align:center"><br/>After transformation</p></div>
 +
 +
 +
 +
<p>Protocol</p>
 +
<p><i>Cultures were incubated overnight in SC-URA medium.<br>Took some yeast suspension to the new SC-URA medium, then adjusted the OD600 value to 0.1 for 24 hours.<br>Fluorescence was measured, and the results were presented below:<br>Excitation 472nm<br>Radiation 532nm.</i></p>
 +
 +
<div class="zxx_zoom_left"  align="center">
 +
                    <div class="small_pic">
 +
                        <a href="#pic_sixteen">
 +
                            <img src="https://static.igem.org/mediawiki/2017/7/76/Qazwsx.png"></a>
 +
<div align="center"><p style="font-size:1.7rem;text-align:center"><br/>the data they obtained in their lab was provided for iGEM-Tianjin as reference</p></div>
 +
                    </div>
 +
                   
 +
                 
 +
                  <div id="pic_sixteen" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/7/76/Qazwsx.png"/><br>the data they obtained in their lab was provided for iGEM-Tianjin as reference</div>
 +
</div>
 +
 +
</div>
 +
 +
 +
 +
 +
 +
 +
 +
<p><a class="ref" href=""></a></p>
 +
     
 +
 +
 
 +
 +
 +
<div id="gobottom" name="gobottom">
 +
</section>
 +
</div>
 +
<div class="go">
 +
<a title="top" class="top" href="#gotop"></a>
 +
<a title="11" class="feedback" href="#one"></a>
 +
    <a title="22" class="two" href="#two"></a>
 +
    <a title="33" class="three" href="#three"></a>
 +
    <a title="44" class="four" href="#four"></a>
 +
<a title="go find a surprise" class="bottom" href="#gobottom"></a>
 +
</div>
 +
</div>
  
  

Latest revision as of 03:21, 2 November 2017

/* OVERRIDE IGEM SETTINGS */

Collaborations


Sent a Collaboration Request and constructed an alliance to build a worldwide database.

We came up with the idea that we could gather all the iGEM teams whose projects were about water pollution treatment and built an alliance to unite all information and data concerning the social impacts, knowledge and geographical advantages they collected during the conduction of their project.

Built an alliance

On 12th of August, we had a voice conferencing with SJTU/SCUT/XMU/UCAS/JLU/FAFU, during which we discussed about how we wanted to use this alliance, and the discussion led to 2 conclusions:

1. Build a worldwide database for the contents of heavy metals in local soil.

2. Mutually promote the social impact of each parties in this alliance.

Constructed a world-wide database

On 23th of August, we sent a Collaboration Request to iGEM official website. And the next day, Ana Sifuentes replied our message and posted our request in the iGEM official website.

we received the response of many teams like heretofore team EXETER and team CSMU NCHU TAIWAN. With their information, we constructed a database which contained the global data of contents of Cu2+/Cd2+ in soil or water. And we built it based on the world map. We received team CSMU NCHU TAIWAN's kindly help——they offered us information about major metal pollution incidents in Taiwan as well as the real time monitoring data of places that had the potential risk of occurrence of serious pollution incidents.

E-mails sent by iGEM EXETER and Nazarbayev University


e-mail sent by CSMU X NCHU TAIWAN.


e-mail sent by CSMU X NCHU TAIWAN.

original information that CSMU NCHU TAIWAN offered



translation copy of the imformation

The pollution of copper worldwide

The pollution of cadmium worldwide

The portal of every school: XMU JLU FAFU SJTU SCUT UCAS

Filmed a biosafety video together with other 12 teams

Biosafety is one of the most important knowledge everyone should master before starting their experiments. Unluckily, biosafety education in China is far too lagged behind compared with the exploding need; not only because of the out-dated education material but also due to the language problem accessing such resources overseas.

We’ve taken part in an intercollegiate cooperation project to produce series of Biosafety education materials in Chinese. With the tremendous amount of work of our collaborating partners and our team members, the video collection was finally published online and freely available at our homepage on YouTube and Bilibili, a popular Chinese video-sharing website.

12 teams gathered together to film a biosafety video, every team took different topics, but all based on Yale biosafety manual.

Our theme is about transportation of biological materials.

Helping TUST prepare for their first year of competition.

To begin with, we offered them some constructive suggestions, and communicated with their team adviser. In 24/3/2017, we were invited to TUST to carried out a recruiting propaganda for them, and helped them form a team.

Giving TUST Constructing and experimental advice

In 2017.08.01, TUST and Tianjin held a meeting together, during which TUST gave an account of their recent progress, we suggested them to add some new synthetic routes and elements in their project, and probably a new strain instead of simply Xylinus for fibrin.

Figure 1. communicating with TUST team leader.

Figure 2. Group photo of TUST and Tianjin.

What We Did For Them

TUST came to us again with their modeling problem, we gladly suggested them to share the Fluorescence method and modeling method with us. Since it's their first year competition, we offered them to design Fluorescence experience and modeling together.

Fugure 3. Group photo of the team leaders.

Figure 4. Group photo of team member.

TUST asked us to test GFP fluorescence intensity of the plasmid in their E.coli

Rrotocol

E.coli overnight cultured in LB+CM

Remove bacteria liquid to LB+CM , regulate OD600 to 0.1 to culture 12 hr

Measure the fluorescence value

Stimulate 488 nm

Radiate 511 nm

Test OD600

Run data processing


Testing results for TUST.

Test the mini system for OUC

What we did:

To verify whether the system built by China Ocean University was still available in other species of Saccharomyces cerevisiae. In that case, we used our laboratory-specific Saccharomyces cerevisiae with synthetic chromosome 10 to test its value of fluorescence intensity.

Protocol for fluorescence detection

Yeast with plasmid was incubated overnight in YPD + G418 medium
Transfer the yeast suspension to the new YPD + G418 and adjusted the OD to 0.1
After incubation for 20 hours, the fluorescence was measured
Excitation light 502nm
Emitting light 532nm
The OD600 values were measured after fluorescence measurements

Results

Having compared our results with that provided by Ocean University, except for some slight deviation of measurements, we found that the experimental results in both labs were consistent, which indicated that the mini system had similar expression in different laboratories and yeast strains.


Figure 5. Testing results for OUC


Figure 6. Testing results for OUC

What we asked OUC to do

Easy - to - error PCR library development. They were supposed to amplify our existing error-prone PCR library by conducting error-prone PCR for the CUP1 promoter we used in our project.
Specific steps:
1.Error-prone PCR
2. digestion
3. Purification / Adsorption
4. Connect
5. E.Coli transformation
Easy-to-error PCR protocol (100μl):
5X buffer(140mM MgCl2, 250mM KCl, 50mM Tris, and 0.1%(wt/vol) gelatin)20μl
Template (iGEM-Tianjin provided) 4μl
Primers (iGEM-Tianjin provided) 4μl*2
10X dNTP (2mM dGTP, 2mM dATP, 10mM dCTP, and 10 mM TTP) 10μl
Taq polymerase 2μl
5mM MnCl2 10μl
ddH2O 46μl

94℃ 3min
94℃ 30s
53℃ 30s
72℃ 30s
72℃ 1min
recycle for 35 times

The PCR products were obtained and digested with BamHI and XbaI, and ligated with vector pRS416.
After E.Coli transformation, we collected the target bacteria and plasmids

Helping NKU with their plasmid construction

What we did:

Helping NKU-iGEM construct their plasmid
The cleavage sites XbaI and SacI were added by PCR before and after lysase (lys)
Forward Primer:GCTCTAGAATGAAATACCTGCTGCCGAC
Reverse Primer:CGAGCTCtCAATGCGTTTCCATAATAGCAGC

After the PCR product was obtained, then came cleavage:

After overnight digestion, it was linking with the linearized plasmid pEX18 for 1 hr. Then the linking product was transformed into E.Coli.
PxylA-xylR was cleaved by SacI on plasmid pAX01
The pEX18-lys, which has been added with lys, was linearized by SacI single restrict digestion
The two were connected after 1hr
Then the linking product was transformed into E.coli.

Helped us to test the fluorescence intensity of pRS416-CUP1p-RFP without copper induction in Saccharomyces cerevisiae BY4742 and BY4741.


Plamids we constructed for NKU.


Plasmid

protocol
Cutsmart® buffer 5μl
XbaI 1μl
SacI 1μl
PCR product 43μl


After transformation

Protocol

Cultures were incubated overnight in SC-URA medium.
Took some yeast suspension to the new SC-URA medium, then adjusted the OD600 value to 0.1 for 24 hours.
Fluorescence was measured, and the results were presented below:
Excitation 472nm
Radiation 532nm.


the data they obtained in their lab was provided for iGEM-Tianjin as reference