Liu Zichen (Talk | contribs) |
|||
(96 intermediate revisions by 5 users not shown) | |||
Line 1: | Line 1: | ||
− | {{:Team:Tianjin/Templates/ | + | {{:Team:Tianjin/Templates/leftbarforHP}} |
<html> | <html> | ||
Line 7: | Line 7: | ||
<link rel="stylesheet" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:video?action=raw&ctype=text/css"> | <link rel="stylesheet" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:video?action=raw&ctype=text/css"> | ||
+ | <link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:style6666?action=raw&ctype=text/css" rel="stylesheet"> | ||
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:stylesub?action=raw&ctype=text/css" /> | <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:stylesub?action=raw&ctype=text/css" /> | ||
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:demo?action=raw&ctype=text/css" /> | <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:demo?action=raw&ctype=text/css" /> | ||
− | <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS: | + | <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:photo2?action=raw&ctype=text/css" /> |
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:fonts?action=raw&ctype=text/css"> | <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Tianjin/Resources/CSS:fonts?action=raw&ctype=text/css"> | ||
<link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:maincssmap?action=raw&ctype=text/css" rel="stylesheet"> | <link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:maincssmap?action=raw&ctype=text/css" rel="stylesheet"> | ||
Line 21: | Line 22: | ||
$('div.small_pic_one a').fancyZoom({scaleImg: true, closeOnClick: true}); | $('div.small_pic_one a').fancyZoom({scaleImg: true, closeOnClick: true}); | ||
$('div.small_pic_mid a').fancyZoom({scaleImg: true, closeOnClick: true}); | $('div.small_pic_mid a').fancyZoom({scaleImg: true, closeOnClick: true}); | ||
+ | $('div.small_pic_demo a').fancyZoom({scaleImg: true, closeOnClick: true}); | ||
+ | $('div.small_pic_demo_q a').fancyZoom({scaleImg: true, closeOnClick: true}); | ||
+ | $('div.small_pic_demo_qq a').fancyZoom({scaleImg: true, closeOnClick: true}); | ||
$('#zoom_word_1').fancyZoom({width:400, height:200}); | $('#zoom_word_1').fancyZoom({width:400, height:200}); | ||
$('#zoom_word_2').fancyZoom(); | $('#zoom_word_2').fancyZoom(); | ||
Line 214: | Line 218: | ||
font-family: 'Montserrat', sans-serif; | font-family: 'Montserrat', sans-serif; | ||
} | } | ||
− | #map p | + | #map p { |
− | + | font-size: 1.2em; | |
− | + | font-weight: 400; | |
− | + | line-height: 1em; | |
− | + | text-align: justify; | |
− | + | font-family: 'LiberationSerif-Regular', sans-serif; | |
+ | margin: 0; | ||
+ | padding: 0 1em 1em 1em; | ||
+ | color: #f8f8f8; | ||
+ | border: none; | ||
} | } | ||
− | #map h2 | + | #map h2 { |
− | + | font-size: 1.2em; | |
− | + | font-weight: 700; | |
− | + | text-align: center; | |
− | + | font-family: 'raleway', sans-serif; | |
− | + | text-shadow: none; | |
− | + | background: none; | |
− | + | border: none; | |
− | + | color: #f8f8f8; | |
− | + | box-shadow: none; | |
+ | padding: 0 2em 0 2em; | ||
+ | } | ||
+ | |||
+ | #mappppp | ||
+ | { | ||
+ | position: relative; | ||
+ | -moz-box-sizing: border-box; | ||
+ | box-sizing: border-box; | ||
+ | } | ||
+ | |||
+ | |||
+ | #newstyle .twopic{ | ||
+ | -moz-column-count: 2; | ||
+ | -moz-column-gap: 0.8em; | ||
+ | -webkit-column-count: 2; | ||
+ | -webkit-column-gap: 0.8em; | ||
+ | -ms-column-count: 2; | ||
+ | -ms-column-gap: 0.8em; | ||
+ | -o-column-count: 2; | ||
+ | -o-column-gap: 0.8em; | ||
+ | column-count: 2; | ||
+ | column-gap: 0.8em; | ||
+ | text-align: center; | ||
+ | margin:1em 2em; | ||
+ | } | ||
+ | #newstyle .middleone{ | ||
+ | text-align:center; | ||
+ | margin:0 auto; | ||
+ | } | ||
+ | #fudong #img1 { | ||
+ | float: right; | ||
+ | margin: 0.5em 2em 0.5em 2em; | ||
+ | max-width: 25em; | ||
+ | } | ||
+ | #fudong #img1 p { | ||
+ | font-size: 1.1em; | ||
+ | font-weight: 400; | ||
+ | line-height: 1em; | ||
+ | margin: 1em auto auto 0; | ||
+ | text-align: center; | ||
+ | padding-bottom: 1em; | ||
} | } | ||
Line 256: | Line 305: | ||
<article id="description"> | <article id="description"> | ||
<h1>Collaborations</h1> | <h1>Collaborations</h1> | ||
− | + | <a title="huge suprise" href="https://2017.igem.org/Team:Tianjin/surprise23333" target="_blank"><hr></a> | |
</article> | </article> | ||
Line 277: | Line 326: | ||
<h2>Sent a Collaboration Request and constructed an alliance to build a worldwide database.</h2> | <h2>Sent a Collaboration Request and constructed an alliance to build a worldwide database.</h2> | ||
− | <p>We came up with the idea that we could gather all the iGEM teams whose projects were about water pollution treatment and | + | <p>We came up with the idea that we could gather all the iGEM teams whose projects were about water pollution treatment and built an alliance to unite all information and data concerning the social impacts, knowledge and geographical advantages they collected during the conduction of their project.</p> |
− | <h3> | + | <h3>Built an alliance</h3> |
− | <p> | + | <p> On 12th of August, we had a voice conferencing with SJTU/SCUT/XMU/UCAS/JLU/FAFU, during which we discussed about how we wanted to use this alliance, and the discussion led to 2 conclusions:</p> |
− | 1. Build a worldwide database for the contents of heavy metals in local soil. | + | <p>1. Build a worldwide database for the contents of heavy metals in local soil.</p> |
− | 2. Mutually promote the social impact of each parties in this alliance. | + | <p>2. Mutually promote the social impact of each parties in this alliance.</p> |
− | </p> | + | |
− | <h3> | + | <h3>Constructed a world-wide database</h3> |
<p>On 23th of August, we sent a Collaboration Request to iGEM official website. And the next day, Ana Sifuentes replied our message and posted our request in the iGEM official website.</p> | <p>On 23th of August, we sent a Collaboration Request to iGEM official website. And the next day, Ana Sifuentes replied our message and posted our request in the iGEM official website.</p> | ||
Line 293: | Line 341: | ||
<div class="small_pic_one" style="float:left;"> | <div class="small_pic_one" style="float:left;"> | ||
<a href="#pic_nine"> | <a href="#pic_nine"> | ||
− | <img src="https://static.igem.org/mediawiki/2017/ | + | <img src="https://static.igem.org/mediawiki/2017/8/8f/Tianjin-HP823.jpg"></a> |
<div style="padding-left:20%;"><p></p> | <div style="padding-left:20%;"><p></p> | ||
</div> | </div> | ||
Line 300: | Line 348: | ||
</div> | </div> | ||
− | <div id="pic_nine" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/ | + | <div id="pic_nine" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/8/8f/Tianjin-HP823.jpg"/></div> |
− | <p> we received the response of many teams like heretofore team EXETER and team CSMU NCHU TAIWAN. With their information, we constructed a database which contained the global data of contents of Cu2+/Cd2+ in soil or water. And we built it based on the world map. We received team CSMU NCHU TAIWAN's kindly help——they offered us information about major metal pollution incidents in Taiwan as well as the real time monitoring data of places that | + | <p> we received the response of many teams like heretofore team EXETER and team CSMU NCHU TAIWAN. With their information, we constructed a database which contained the global data of contents of Cu2+/Cd2+ in soil or water. And we built it based on the world map. We received team CSMU NCHU TAIWAN's kindly help——they offered us information about major metal pollution incidents in Taiwan as well as the real time monitoring data of places that had the potential risk of occurrence of serious pollution incidents.</p> |
− | <div class="set_5_button3"><a href="https://static.igem.org/mediawiki/2017/1/18/Tianjin-hp-taiwanmetal.xls"> | + | <div class="middleone"> |
+ | |||
+ | <img | ||
+ | |||
+ | src="https://static.igem.org/mediawiki/2017/0/0e/122%E5%89%AF%E6%9C%AC.png"> | ||
+ | <div align="center"><p style="font-size:1.7rem;text-align:center">E-mails sent by iGEM EXETER and Nazarbayev University</p></div> | ||
+ | </div> | ||
+ | |||
+ | <div class="zxx_zoom_demo_q"> | ||
+ | <div class="small_pic_demo_q" style="float:left;"> | ||
+ | <a href="#pic_twentyttwo"> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/1/19/Tianjin_hp_int_A.png"></a><p style="font-size:15px;text-align:center"><br/>e-mail sent by CSMU X NCHU TAIWAN. | ||
+ | </p> | ||
+ | </div> | ||
+ | <div class="small_pic_demo_q" style="float:right;"> | ||
+ | <a href="#pic_twentytthree" > | ||
+ | <img src="https://static.igem.org/mediawiki/2017/e/ee/C.png"/> | ||
+ | </a> <p style="font-size:15px;text-align:center"><br/>e-mail sent by CSMU X NCHU TAIWAN.</p> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | <div id="pic_twentyttwo" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/2/23/Tianjin-xinru7.jpg"/><p style="font-size:15px;text-align:center"><br/>e-mail sent by CSMU X NCHU TAIWAN. | ||
+ | </p></div> | ||
+ | <div id="pic_twentytthree" style="display:none;"><img src="http://211.81.63.130/cache/12/04/2017.igem.org/de4549e774d5628e5d37b1fd8cfac22a/234.png"/><p style="font-size:15px;text-align:center"><br/>e-mail sent by CSMU X NCHU TAIWAN.</p></div> | ||
+ | |||
+ | |||
+ | |||
+ | <p>original information that CSMU NCHU TAIWAN offered | ||
+ | </p> | ||
+ | |||
+ | <div class="set_5_button3"><a href="https://static.igem.org/mediawiki/2017/e/ed/%E5%8F%B0%E7%81%A3%E9%87%8D%E9%87%91%E5%B1%AC%E6%B1%99%E6%9F%93%E7%B5%B1%E8%A8%88%E8%B3%87%E6%96%99%283%29.xls"><i class="fa fa-file-excel-o" aria-hidden="true"></i> | ||
+ | EXCEL</a></div> | ||
+ | |||
+ | <div class="set_5_button5"><a href="https://static.igem.org/mediawiki/2017/3/3b/%E5%8F%B0%E7%81%A3%E9%87%8D%E5%A4%A7%E9%87%8D%E9%87%91%E5%B1%AC%E6%B1%99%E6%9F%93%E4%BA%8B%E4%BB%B6.docx"><i class="fa fa-file-word-o" aria-hidden="true"></i> | ||
+ | WORD</a></div> | ||
+ | |||
+ | <br><br> | ||
+ | <p>translation copy of the imformation</p> | ||
+ | <div class="set_5_button3"><a href="https://static.igem.org/mediawiki/2017/1/18/Tianjin-hp-taiwanmetal.xls"><i class="fa fa-file-excel-o" aria-hidden="true"></i> | ||
+ | EXCEL</a></div> | ||
+ | <div class="set_5_button5"><a href="https://static.igem.org/mediawiki/2017/8/89/English_translation.docx"><i class="fa fa-file-word-o" aria-hidden="true"></i> | ||
+ | WORD</a></div> | ||
Line 315: | Line 404: | ||
<button class="map-point" style="top:32%;left:32%"> | <button class="map-point" style="top:32%;left:32%"> | ||
− | <div class="content"> | + | <div id="mappppp" class="content"> |
<div class="centered-y"> | <div class="centered-y"> | ||
<h2>USA</h2> | <h2>USA</h2> | ||
− | <p>Seen form the data got from National Wetland Condition Assessment (NWCA), the copper concentration is general low when compared to the world. </p> | + | <p>Seen form the data we got from National Wetland Condition Assessment (NWCA), the copper concentration is general low when compared to the world. </p> |
</div> | </div> | ||
</div> | </div> | ||
Line 324: | Line 413: | ||
<button class="map-point" style="top:25%;left:55%"> | <button class="map-point" style="top:25%;left:55%"> | ||
− | <div class="content"> | + | <div id="mappppp" class="content"> |
<div class="centered-y"> | <div class="centered-y"> | ||
<h2>Europe</h2> | <h2>Europe</h2> | ||
− | <p>Seen form the data | + | <p>Seen form the data from FOREGS-EuroGeoSurveys Geochemical Baseline Database, the copper concentration is general low when compared to the world. </p> |
</div> | </div> | ||
</div> | </div> | ||
Line 333: | Line 422: | ||
<button class="map-point" style="top:56%;left:43%"> | <button class="map-point" style="top:56%;left:43%"> | ||
− | <div class="content"> | + | <div id="mappppp" class="content"> |
<div class="centered-y"> | <div class="centered-y"> | ||
<h2>Brazil</h2> | <h2>Brazil</h2> | ||
− | <p>We get data from web of science, so it cannot represent Brazilian soil copper concentration comprehensively. Seen form the data got from web of science, many regions in Brazil have a high and even | + | <p>We get data from web of science, so it cannot represent Brazilian soil copper concentration comprehensively. Seen form the data got from web of science, many regions in Brazil have a high and even extremely high concentration.</p> |
</div> | </div> | ||
</div> | </div> | ||
</button> | </button> | ||
− | <button class="map-point" style="top: | + | <button class="map-point" style="top:62%;left:56%"> |
− | <div class="content"> | + | <div id="mappppp" class="content"> |
<div class="centered-y"> | <div class="centered-y"> | ||
<h2>Africa</h2> | <h2>Africa</h2> | ||
− | <p>We get data from web of science, so it cannot represent African soil copper concentration comprehensively. Seen form the data got from web of science, many regions in Africa have a high and even | + | <p>We get data from web of science, so it cannot represent African soil copper concentration comprehensively. Seen form the data got from web of science, many regions in Africa have a high and even extremely high concentration.</p> |
</div> | </div> | ||
</div> | </div> | ||
Line 351: | Line 440: | ||
<button class="map-point" style="top:40%;left:68%"> | <button class="map-point" style="top:40%;left:68%"> | ||
− | <div class="content"> | + | <div id="mappppp" class="content"> |
<div class="centered-y"> | <div class="centered-y"> | ||
<h2>India</h2> | <h2>India</h2> | ||
− | <p>We get data from web of science, so it cannot represent Indian soil copper concentration comprehensively. Seen form the data got from web of science, many regions in India have a high and even | + | <p>We get data from web of science, so it cannot represent Indian soil copper concentration comprehensively. Seen form the data got from web of science, many regions in India have a high and even extremely high concentration.</p> |
</div> | </div> | ||
</div> | </div> | ||
</button> | </button> | ||
<button class="map-point" style="top:35%;left:74%"> | <button class="map-point" style="top:35%;left:74%"> | ||
− | <div class="content"> | + | <div id="mappppp" class="content"> |
<div class="centered-y"> | <div class="centered-y"> | ||
<h2>China</h2> | <h2>China</h2> | ||
− | <p>Seen form the data got from Team Jianchao Li, Shaanxi Normal University, when the copper concentration is general low or moderate, some regions have high and even | + | <p>Seen form the data got from Team Jianchao Li, Shaanxi Normal University, when the copper concentration is general low or moderate, some regions have high and even extremely high concentration when compared to the world. </p> |
</div> | </div> | ||
</div> | </div> | ||
Line 370: | Line 459: | ||
</div> | </div> | ||
− | <p> | + | <p style="text-align:center">The pollution of copper worldwide</p> |
+ | <img src="https://static.igem.org/mediawiki/2017/thumb/9/9a/Tianjin-cadmiumworldwideBLUE.jpg/1600px-Tianjin-cadmiumworldwideBLUE.jpg"> | ||
+ | <p style="text-align:center">The pollution of cadmium worldwide</p> | ||
+ | <p>The portal of every school: | ||
+ | <a href="https://2017.igem.org/Team:XMU-China/Collaborations">XMU</a> | ||
+ | <a href="https://2017.igem.org/Team:Jilin_China/Collaborations">JLU</a> | ||
+ | <a href=" https://2017.igem.org/Team:FAFU-China/Collaborations">FAFU</a> | ||
+ | <a href="https://2017.igem.org/Team:SJTU-BioX-Shanghai/Collaborations">SJTU</a> | ||
+ | <a href="https://2017.igem.org/Team:SCUT-China_A/Collaborations">SCUT</a> | ||
+ | <a href="https://2017.igem.org/Team:UCAS/Collaborations">UCAS</a></P> | ||
+ | |||
+ | |||
+ | |||
+ | <div id="one" name="one"></div> | ||
<h2>Filmed a biosafety video together with other 12 teams</h2> | <h2>Filmed a biosafety video together with other 12 teams</h2> | ||
− | <p>12 teams | + | <p>Biosafety is one of the most important knowledge everyone should master before starting their experiments. Unluckily, biosafety education in China is far too lagged behind compared with the exploding need; not only because of the out-dated education material but also due to the language problem accessing such resources overseas.</p> |
+ | <p>We’ve taken part in an intercollegiate cooperation project to produce series of Biosafety education materials in Chinese. With the tremendous amount of work of our collaborating partners and our team members, the video collection was finally published online and freely available at our homepage on YouTube and Bilibili, a popular Chinese video-sharing website.</p> | ||
+ | <p>12 teams gathered together to film a biosafety video, every team took different topics, but all based on Yale biosafety manual.</p> | ||
+ | <p>Our theme is about transportation of biological materials. </p> | ||
<div id="demovi" style="text-align:center;"> | <div id="demovi" style="text-align:center;"> | ||
Line 381: | Line 486: | ||
<ul> | <ul> | ||
− | <li><button type="button" class="btn demovi-media" data-src="https://static.igem.org/mediawiki/2017/4/48/Team_Tianjin_Safety.mp4"><img src="https://static.igem.org/mediawiki/2017/4/ | + | <li><button type="button" class="btn demovi-media" data-src="https://static.igem.org/mediawiki/2017/4/48/Team_Tianjin_Safety.mp4"><img src="https://static.igem.org/mediawiki/2017/4/4c/Tianjin_safety_coverimg.jpg"></button></li> |
<script src="https://2017.igem.org/Team:Tianjin/Resources/JS:MODALitmin?action=raw&ctype=text/javascript"></script> | <script src="https://2017.igem.org/Team:Tianjin/Resources/JS:MODALitmin?action=raw&ctype=text/javascript"></script> | ||
<script src="https://2017.igem.org/Team:Tianjin/Resources/JS:script?action=raw&ctype=text/javascript"></script> | <script src="https://2017.igem.org/Team:Tianjin/Resources/JS:script?action=raw&ctype=text/javascript"></script> | ||
Line 390: | Line 495: | ||
+ | <div align="center"> | ||
+ | <div class="info" style="padding-top:40px; margin:0 auto;"> | ||
+ | <div class="buttons"> | ||
+ | <p><a href="" style="text-decoration:none; font-size:2rem;" data-modal="#modal" class="modal__trigger"><b>other team's video</b></a></p> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | </div> | ||
+ | |||
+ | |||
+ | <!-- Modal --> | ||
+ | <div id="modal" class="modal modal__bg" role="dialog" aria-hidden="true"> | ||
+ | <div class="modal__dialog"> | ||
+ | <div class="modal__content"> | ||
+ | <div class="hahaha" style="width:46em;" align="center"> | ||
+ | <style> | ||
+ | a{ | ||
+ | text-decoration:none; | ||
+ | color:#FFBC2C; | ||
+ | } | ||
+ | .hahaha button{ | ||
+ | background: #5E63B6; | ||
+ | color:#fff; | ||
+ | border:none; | ||
+ | position:relative; | ||
+ | height:40px; | ||
+ | width:30em; | ||
+ | font-size:1.4em; | ||
+ | padding:0 2em; | ||
+ | cursor:pointer; | ||
+ | transition:800ms ease all; | ||
+ | outline:none; | ||
+ | margin-top:0.1em; | ||
+ | margin-bottom:0.2em; | ||
+ | border-radius:2em; | ||
+ | } | ||
+ | .hahaha button:hover{ | ||
+ | background:#fff; | ||
+ | color:#1AAB8A; | ||
+ | } | ||
+ | .hahaha button:before,button:after{ | ||
+ | content:''; | ||
+ | position:absolute; | ||
+ | top:0; | ||
+ | right:0; | ||
+ | height:2px; | ||
+ | width:0; | ||
+ | background: #1AAB8A; | ||
+ | transition:400ms ease all; | ||
+ | } | ||
+ | .hahaha button:after{ | ||
+ | right:inherit; | ||
+ | top:inherit; | ||
+ | left:0; | ||
+ | bottom:0; | ||
+ | } | ||
+ | .hahaha button:hover:before,button:hover:after{ | ||
+ | width:93%; | ||
+ | right:1em; | ||
+ | left:1em; | ||
+ | transition:800ms ease all; | ||
+ | } | ||
+ | |||
+ | |||
+ | </style> | ||
+ | <button onClick="window.open('https://youtube.com/channel/UCZEYJNccLLPRro1SX1AfVAA')">YouTube</button> | ||
+ | <button onClick="window.open('https://www.bilibili.com/video/av15520383/')">bilibili</button> | ||
+ | <button onClick="window.open('https://2017.igem.org/Team:Shanghaitech/BioSafety')">ShanghaiTech University</button> | ||
+ | <button onClick="window.open('https://2017.igem.org/Team:UCAS/Collaborations#biosafety')">University of Chinese Academy of Science</button> | ||
+ | <button onClick="window.open('https://2017.igem.org/Team:TUST_China/Collaborations')">Tianjin University of Science & Technology</button> | ||
+ | <button onClick="window.open('https://2017.igem.org/Team:UESTC-China/Collaborations')">University of Electronic Science and Technology of China</button> | ||
+ | <button onClick="window.open('https://2017.igem.org/Team:BNU-China/Collaborations#biosafety')">Beijing Normal University</button> | ||
+ | <button onClick="window.open('https://2017.igem.org/Team:WHU-China/Collaborations')">Wuhan University</button> | ||
+ | <button onClick="window.open('https://2017.igem.org/Team:AHUT_China/Collaborations')">Anhui University of Technology</button> | ||
+ | <button onClick="window.open('https://2017.igem.org/Team:NAU-CHINA/Collaborations')">Nanjing Agricultural University</button> | ||
+ | <button onClick="window.open('https://2017.igem.org/Team:FAFU-CHINA/Collaborations')">Fujian Agriculture and Forestry Universiy</button> | ||
+ | </div> | ||
+ | <!-- modal close button --> | ||
+ | <a href="" class="modal__close demo-close"> | ||
+ | <svg class="" viewBox="0 0 24 24"> | ||
+ | <path d="M19 6.41l-1.41-1.41-5.59 5.59-5.59-5.59-1.41 1.41 5.59 5.59-5.59 5.59 1.41 1.41 5.59-5.59 5.59 5.59 1.41-1.41-5.59-5.59z"/> | ||
+ | <path d="M0 0h24v24h-24z" fill="none"/> | ||
+ | </svg> | ||
+ | </a> </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | |||
+ | <script src="https://2017.igem.org/Team:Tianjin/Resources/JS:index?action=raw&ctype=text/javascript"></script> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <div id="two" name="two"></div> | ||
− | <h2>Helping TUST prepare for their first year of competition.</h2> | + | <h2>Helping <a href="https://2017.igem.org/Team:TUST_China/Collaborations">TUST</a> prepare for their first year of competition.</h2> |
<p>To begin with, we offered them some constructive suggestions, and communicated with their team adviser. In 24/3/2017, we were invited to TUST to carried out a recruiting propaganda for them, and helped them form a team.</p> | <p>To begin with, we offered them some constructive suggestions, and communicated with their team adviser. In 24/3/2017, we were invited to TUST to carried out a recruiting propaganda for them, and helped them form a team.</p> | ||
<div id="middle" name="middle"> | <div id="middle" name="middle"> | ||
− | <h3> | + | <h3>Giving TUST Constructing and experimental advice</h3> |
<p>In 2017.08.01, TUST and Tianjin held a meeting together, during which TUST gave an account of their recent progress, we suggested them to add some new synthetic routes and elements in their project, and probably a new strain instead of simply Xylinus for fibrin.</p> | <p>In 2017.08.01, TUST and Tianjin held a meeting together, during which TUST gave an account of their recent progress, we suggested them to add some new synthetic routes and elements in their project, and probably a new strain instead of simply Xylinus for fibrin.</p> | ||
</div> | </div> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
+ | <div class="twopic"> | ||
+ | <div> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/7/75/Tianjin_collaboration_weixin_4.jpeg"><p style="font-size:15px;text-align:center">Figure 1. communicating with TUST team leader. </p></div> | ||
+ | <div><img src="https://static.igem.org/mediawiki/2017/6/64/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003130215.jpg"/> | ||
+ | <p style="font-size:15px;text-align:center">Figure 2. Group photo of TUST and Tianjin.</p></div> | ||
+ | </div> | ||
<div id="two" name="two"> | <div id="two" name="two"> | ||
− | <h3> | + | <h3>What We Did For Them</h3> |
<p>TUST came to us again with their modeling problem, we gladly suggested them to share the Fluorescence method and modeling method with us. Since it's their first year competition, we offered them to design Fluorescence experience and modeling together. </p> | <p>TUST came to us again with their modeling problem, we gladly suggested them to share the Fluorescence method and modeling method with us. Since it's their first year competition, we offered them to design Fluorescence experience and modeling together. </p> | ||
</div> | </div> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
+ | <div class="twopic"> | ||
+ | <div> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/8/80/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003132121.jpg"><p style="font-size:15px;text-align:center">Fugure 3. Group photo of the team leaders. </p></div> | ||
+ | <div><img src="https://static.igem.org/mediawiki/2017/7/7d/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171003132127.jpg"/> | ||
+ | <p style="font-size:15px;text-align:center">Figure 4. Group photo of team member.</p></div> | ||
+ | </div> | ||
+ | <p>TUST asked us to test GFP fluorescence intensity of the plasmid in their <i>E.coli</i> | ||
+ | <i><p>Rrotocol</p> | ||
+ | <p><i>E.coli</i> overnight cultured in LB+CM<p> | ||
+ | <p>Remove bacteria liquid to LB+CM , regulate OD600 to 0.1 to culture 12 hr</p> | ||
+ | <p>Measure the fluorescence value</p> | ||
+ | <p>Stimulate 488 nm</p> | ||
+ | <p>Radiate 511 nm</p> | ||
+ | <p>Test OD600</p> | ||
+ | <p>Run data processing</p></i> | ||
+ | |||
+ | <div class="zxx_zoom_demo_q" align="center"> | ||
+ | <script type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:zoom?action=raw&ctype=text/javascript"></script> | ||
+ | <div class="small_pic_demo_q" align="center"> | ||
+ | <a href="#pic_eightyone"> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/a/a8/TK.png"></a> | ||
+ | <p style="font-size:15px;text-align:center"><br/>Testing results for TUST.</p> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | <div id="pic_eightyone" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/a/a8/TK.png"><p style="font-size:15px;text-align:center"><br/>Testing results for TUST.</p></div> | ||
− | <h2>Test the mini system for OUC</h2> | + | <div id="three" name="three"></div> |
+ | <h2>Test the mini system for <a href="https://static.igem.org/mediawiki/2017/b/b2/Tianjin_collaboration_ouc_3.png">OUC</a></h2> | ||
<h3>What we did:</h3> | <h3>What we did:</h3> | ||
− | <p>To verify whether the system built by China Ocean University was still available in other species of Saccharomyces cerevisiae.In that case, we used our laboratory-specific Saccharomyces cerevisiae with synthetic chromosome 10 to test its value of fluorescence intensity.</p> | + | <p>To verify whether the system built by China Ocean University was still available in other species of <i>Saccharomyces cerevisiae</i>. In that case, we used our laboratory-specific <i>Saccharomyces cerevisiae</i> with synthetic chromosome 10 to test its value of fluorescence intensity.</p> |
− | <p>Protocol for fluorescence | + | <p><i>Protocol for fluorescence detection</i>:</p> |
− | <p>Yeast with plasmid was incubated overnight in YPD + G418 medium<br> | + | <p><i>Yeast with plasmid was incubated overnight in YPD + G418 medium<br> |
Transfer the yeast suspension to the new YPD + G418 and adjusted the OD to 0.1<br> | Transfer the yeast suspension to the new YPD + G418 and adjusted the OD to 0.1<br> | ||
After incubation for 20 hours, the fluorescence was measured<br> | After incubation for 20 hours, the fluorescence was measured<br> | ||
Excitation light 502nm<br> | Excitation light 502nm<br> | ||
Emitting light 532nm<br> | Emitting light 532nm<br> | ||
− | The OD600 values were measured after fluorescence measurements</p> | + | The OD600 values were measured after fluorescence measurements</i></p> |
<P>Results</p> | <P>Results</p> | ||
<p>Having compared our results with that provided by Ocean University, except for some slight deviation of measurements, we found that the experimental results in both labs were consistent, which indicated that the mini system had similar expression in different laboratories and yeast strains.</p> | <p>Having compared our results with that provided by Ocean University, except for some slight deviation of measurements, we found that the experimental results in both labs were consistent, which indicated that the mini system had similar expression in different laboratories and yeast strains.</p> | ||
Line 457: | Line 664: | ||
− | <div class=" | + | |
− | <div class=" | + | |
− | <a href="# | + | <div class="zxx_zoom_demo_q"> |
− | <img src="https://static.igem.org/mediawiki/2017/ | + | <div class="small_pic_demo_q" style="float:left;"> |
− | + | <a href="#pic_onehundredone"> | |
+ | <img src="https://static.igem.org/mediawiki/2017/c/cb/Onehundredone.jpeg"></a><p style="font-size:15px;text-align:center"><br/>Figure 5. Testing results for OUC | ||
+ | </p> | ||
</div> | </div> | ||
− | <div class=" | + | <div class="small_pic_demo_q" style="float:right;"> |
− | <a href="# | + | <a href="#pic_onehundredones" > |
− | + | <img src="https://static.igem.org/mediawiki/2017/9/93/Tianjin_collaboration_ouc_2.png"/> | |
− | </a> | + | </a> <p style="font-size:15px;text-align:center"><br/>Figure 6. Testing results for OUC</p> |
</div> | </div> | ||
+ | |||
</div> | </div> | ||
− | <div id=" | + | <div id="pic_onehundredone" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/0/0b/Qwerrt.jpg"/><p style="font-size:15px;text-align:center"><br/>Figure 5. Testing results for OUC |
− | <div id=" | + | </p></div> |
+ | <div id="pic_onehundredones" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/9/93/Tianjin_collaboration_ouc_2.png"/><p style="font-size:15px;text-align:center"><br/>Figure 6. Testing results for OUC</p></div> | ||
+ | |||
<h3>What we asked OUC to do</h3> | <h3>What we asked OUC to do</h3> | ||
+ | |||
+ | <div id="fudong"> | ||
+ | <div id="img1"> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/8/8e/Tianjin-WWWWWWWWWWWW.jpg"> | ||
+ | <p align="center"></p> | ||
+ | </div> | ||
<p>Easy - to - error PCR library development. They were supposed to amplify our existing error-prone PCR library by conducting error-prone PCR for the CUP1 promoter we used in our project.<br> | <p>Easy - to - error PCR library development. They were supposed to amplify our existing error-prone PCR library by conducting error-prone PCR for the CUP1 promoter we used in our project.<br> | ||
Specific steps:<br> | Specific steps:<br> | ||
Line 478: | Line 696: | ||
3. Purification / Adsorption<br> | 3. Purification / Adsorption<br> | ||
4. Connect<br> | 4. Connect<br> | ||
− | 5. E.Coli | + | 5. <i>E.Coli</i> transformation<br> |
− | < | + | <i>Easy-to-error PCR protocol (100μl):<br> |
5X buffer(140mM MgCl2, 250mM KCl, 50mM Tris, and 0.1%(wt/vol) gelatin)20μl<br> | 5X buffer(140mM MgCl2, 250mM KCl, 50mM Tris, and 0.1%(wt/vol) gelatin)20μl<br> | ||
Template (iGEM-Tianjin provided) 4μl<br> | Template (iGEM-Tianjin provided) 4μl<br> | ||
Line 495: | Line 713: | ||
recycle for 35 times<br> | recycle for 35 times<br> | ||
</p> | </p> | ||
+ | |||
+ | |||
+ | |||
+ | </div> | ||
+ | |||
+ | |||
<p>The PCR products were obtained and digested with BamHI and XbaI, and ligated with vector pRS416.<br> | <p>The PCR products were obtained and digested with BamHI and XbaI, and ligated with vector pRS416.<br> | ||
− | After E.Coli transformation, we collected the target bacteria and plasmids</p> | + | After <i>E.Coli</i> transformation, we collected the target bacteria and plasmids</p> |
− | <div class=" | + | |
− | <div class=" | + | |
+ | |||
+ | <div class="zxx_zoom_demo_q" align="center"> | ||
+ | <div class="small_pic_demo_q"> | ||
<a href="#pic_nineteen"> | <a href="#pic_nineteen"> | ||
− | <img src="https://static.igem.org/mediawiki/2017/ | + | <img src="https://static.igem.org/mediawiki/2017/1/1c/OUC3.png"></a> |
<div align="center"><p style="font-size:1.7rem;text-align:center"></p></div> | <div align="center"><p style="font-size:1.7rem;text-align:center"></p></div> | ||
</div> | </div> | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</div> | </div> | ||
− | + | <div id="pic_nineteen" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/b/b7/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171002211622.jpg"/></div> | |
− | + | ||
− | + | ||
− | + | ||
+ | |||
+ | |||
+ | |||
+ | <div id="four" name="four"></div> | ||
− | <h2>Helping NKU with their plasmid construction</h2> | + | <h2>Helping <a href="https://2017.igem.org/Team:NKU_China/Collaborations">NKU</a> with their plasmid construction</h2> |
<h3>What we did:</h3> | <h3>What we did:</h3> | ||
<p>Helping NKU-iGEM construct their plasmid<br>The cleavage sites XbaI and SacI were added by PCR before and after lysase (lys)<br>Forward Primer:GCTCTAGAATGAAATACCTGCTGCCGAC<br>Reverse Primer:CGAGCTCtCAATGCGTTTCCATAATAGCAGC</p> | <p>Helping NKU-iGEM construct their plasmid<br>The cleavage sites XbaI and SacI were added by PCR before and after lysase (lys)<br>Forward Primer:GCTCTAGAATGAAATACCTGCTGCCGAC<br>Reverse Primer:CGAGCTCtCAATGCGTTTCCATAATAGCAGC</p> | ||
<p>After the PCR product was obtained, then came cleavage:</p> | <p>After the PCR product was obtained, then came cleavage:</p> | ||
<p>After overnight digestion, it was linking with the linearized plasmid pEX18 for 1 hr. | <p>After overnight digestion, it was linking with the linearized plasmid pEX18 for 1 hr. | ||
− | Then the linking product was transformed into E.Coli.<br>PxylA-xylR was cleaved by SacI on plasmid pAX01<br>The pEX18-lys, which has been added with lys, was linearized by SacI single restrict digestion<br>The two were connected after 1hr<br> Then the linking product was transformed into E.coli.</p> | + | Then the linking product was transformed into <i>E.Coli.</i><br>PxylA-xylR was cleaved by SacI on plasmid pAX01<br>The pEX18-lys, which has been added with lys, was linearized by SacI single restrict digestion<br>The two were connected after 1hr<br> Then the linking product was transformed into E.coli.</p> |
− | <p>Helped us to test the fluorescence intensity of pRS416-CUP1p-RFP without copper induction in Saccharomyces cerevisiae BY4742 and BY4741.</p> | + | <p>Helped us to test the fluorescence intensity of pRS416-CUP1p-RFP without copper induction in <i>Saccharomyces cerevisiae</i> BY4742 and BY4741.</p> |
− | |||
− | <div class=" | + | <div class="zxx_zoom_demo_qq" align="center"> |
− | <div class=" | + | <div class="small_pic_demo_qq" style="float:left;"> |
− | <a href="# | + | <a href="#pic_eightyseven"> |
− | <img src="https://static.igem.org/mediawiki/2017/9/ | + | <img src="https://static.igem.org/mediawiki/2017/9/90/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171030224823.png"></a><p style="font-size:15px;text-align:center"><br/>Plamids we constructed for NKU. |
− | < | + | </p> |
</div> | </div> | ||
− | <div class=" | + | <div class="small_pic_demo_qq" style="float:right;"> |
− | <a href="# | + | <a href="#pic_eightyeight" > |
− | + | <img src="https://static.igem.org/mediawiki/2017/f/f8/Tianjin_collaboration_nku_22.png"/> | |
− | </a> | + | </a> <p style="font-size:15px;text-align:center"><br/>Plasmid</p> |
</div> | </div> | ||
+ | |||
</div> | </div> | ||
− | <div id=" | + | <div id="pic_eightyseven" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/d/d3/Tianjin_collaboration_nku_1.png"><br/>Plamids we constructed for NKU. |
− | <div id=" | + | </p></div> |
− | + | <div id="pic_eightyeight" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/d/d3/Tianjin_collaboration_nku_2.png"/><p style="font-size:15px;text-align:center"><br/>Plasmid</p></div> | |
Line 552: | Line 777: | ||
− | <div class=" | + | <div class="zxx_zoom_demo_qq" align="center"> |
− | <div class=" | + | <script type="text/javascript" src="https://2017.igem.org/Team:Tianjin/Resources/JS:zoom?action=raw&ctype=text/javascript"></script> |
− | <a href="# | + | <div class="small_pic_demo_qq" align="center"> |
− | + | <a href="#pic_ninety"> | |
− | + | <img src="https://static.igem.org/mediawiki/2017/1/15/%E5%BE%AE%E4%BF%A1%E5%9B%BE%E7%89%87_20171030224739.jpg"></a> | |
+ | <p style="font-size:15px;text-align:center"><br/>After transformation</p> | ||
</div> | </div> | ||
− | + | ||
</div> | </div> | ||
− | <div id=" | + | |
+ | <div id="pic_ninety" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/a/ae/Tianjin_collaboration_nku_3.jpeg"><p style="font-size:15px;text-align:center"><br/>After transformation</p></div> | ||
+ | |||
+ | |||
<p>Protocol</p> | <p>Protocol</p> | ||
− | <p><i>Cultures were incubated overnight in SC-URA medium.<br> | + | <p><i>Cultures were incubated overnight in SC-URA medium.<br>Took some yeast suspension to the new SC-URA medium, then adjusted the OD600 value to 0.1 for 24 hours.<br>Fluorescence was measured, and the results were presented below:<br>Excitation 472nm<br>Radiation 532nm.</i></p> |
<div class="zxx_zoom_left" align="center"> | <div class="zxx_zoom_left" align="center"> | ||
Line 572: | Line 801: | ||
</div> | </div> | ||
− | + | ||
<div id="pic_sixteen" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/7/76/Qazwsx.png"/><br>the data they obtained in their lab was provided for iGEM-Tianjin as reference</div> | <div id="pic_sixteen" style="display:none;"><img src="https://static.igem.org/mediawiki/2017/7/76/Qazwsx.png"/><br>the data they obtained in their lab was provided for iGEM-Tianjin as reference</div> | ||
</div> | </div> | ||
− | + | </div> | |
Line 595: | Line 824: | ||
<div class="go"> | <div class="go"> | ||
<a title="top" class="top" href="#gotop"></a> | <a title="top" class="top" href="#gotop"></a> | ||
− | <a title=" | + | <a title="11" class="feedback" href="#one"></a> |
<a title="22" class="two" href="#two"></a> | <a title="22" class="two" href="#two"></a> | ||
<a title="33" class="three" href="#three"></a> | <a title="33" class="three" href="#three"></a> | ||
<a title="44" class="four" href="#four"></a> | <a title="44" class="four" href="#four"></a> | ||
− | <a title=" | + | <a title="go find a surprise" class="bottom" href="#gobottom"></a> |
</div> | </div> | ||
</div> | </div> |
Latest revision as of 03:21, 2 November 2017
/* OVERRIDE IGEM SETTINGS */
Sent a Collaboration Request and constructed an alliance to build a worldwide database.
We came up with the idea that we could gather all the iGEM teams whose projects were about water pollution treatment and built an alliance to unite all information and data concerning the social impacts, knowledge and geographical advantages they collected during the conduction of their project.
Built an alliance
On 12th of August, we had a voice conferencing with SJTU/SCUT/XMU/UCAS/JLU/FAFU, during which we discussed about how we wanted to use this alliance, and the discussion led to 2 conclusions:
1. Build a worldwide database for the contents of heavy metals in local soil.
2. Mutually promote the social impact of each parties in this alliance.
Constructed a world-wide database
On 23th of August, we sent a Collaboration Request to iGEM official website. And the next day, Ana Sifuentes replied our message and posted our request in the iGEM official website.
we received the response of many teams like heretofore team EXETER and team CSMU NCHU TAIWAN. With their information, we constructed a database which contained the global data of contents of Cu2+/Cd2+ in soil or water. And we built it based on the world map. We received team CSMU NCHU TAIWAN's kindly help——they offered us information about major metal pollution incidents in Taiwan as well as the real time monitoring data of places that had the potential risk of occurrence of serious pollution incidents.
E-mails sent by iGEM EXETER and Nazarbayev University
original information that CSMU NCHU TAIWAN offered
translation copy of the imformation
The pollution of copper worldwide
The pollution of cadmium worldwide
The portal of every school: XMU JLU FAFU SJTU SCUT UCAS
Filmed a biosafety video together with other 12 teams
Biosafety is one of the most important knowledge everyone should master before starting their experiments. Unluckily, biosafety education in China is far too lagged behind compared with the exploding need; not only because of the out-dated education material but also due to the language problem accessing such resources overseas.
We’ve taken part in an intercollegiate cooperation project to produce series of Biosafety education materials in Chinese. With the tremendous amount of work of our collaborating partners and our team members, the video collection was finally published online and freely available at our homepage on YouTube and Bilibili, a popular Chinese video-sharing website.
12 teams gathered together to film a biosafety video, every team took different topics, but all based on Yale biosafety manual.
Our theme is about transportation of biological materials.
Helping TUST prepare for their first year of competition.
To begin with, we offered them some constructive suggestions, and communicated with their team adviser. In 24/3/2017, we were invited to TUST to carried out a recruiting propaganda for them, and helped them form a team.
Giving TUST Constructing and experimental advice
In 2017.08.01, TUST and Tianjin held a meeting together, during which TUST gave an account of their recent progress, we suggested them to add some new synthetic routes and elements in their project, and probably a new strain instead of simply Xylinus for fibrin.
Figure 1. communicating with TUST team leader.
Figure 2. Group photo of TUST and Tianjin.
What We Did For Them
TUST came to us again with their modeling problem, we gladly suggested them to share the Fluorescence method and modeling method with us. Since it's their first year competition, we offered them to design Fluorescence experience and modeling together.
Fugure 3. Group photo of the team leaders.
Figure 4. Group photo of team member.
TUST asked us to test GFP fluorescence intensity of the plasmid in their E.coli
Rrotocol
E.coli overnight cultured in LB+CM
Remove bacteria liquid to LB+CM , regulate OD600 to 0.1 to culture 12 hr
Measure the fluorescence value
Stimulate 488 nm
Radiate 511 nm
Test OD600
Run data processing
Test the mini system for OUC
What we did:
To verify whether the system built by China Ocean University was still available in other species of Saccharomyces cerevisiae. In that case, we used our laboratory-specific Saccharomyces cerevisiae with synthetic chromosome 10 to test its value of fluorescence intensity.
Protocol for fluorescence detection:
Yeast with plasmid was incubated overnight in YPD + G418 medium
Transfer the yeast suspension to the new YPD + G418 and adjusted the OD to 0.1
After incubation for 20 hours, the fluorescence was measured
Excitation light 502nm
Emitting light 532nm
The OD600 values were measured after fluorescence measurements
Results
Having compared our results with that provided by Ocean University, except for some slight deviation of measurements, we found that the experimental results in both labs were consistent, which indicated that the mini system had similar expression in different laboratories and yeast strains.
What we asked OUC to do
Easy - to - error PCR library development. They were supposed to amplify our existing error-prone PCR library by conducting error-prone PCR for the CUP1 promoter we used in our project.
Specific steps:
1.Error-prone PCR
2. digestion
3. Purification / Adsorption
4. Connect
5. E.Coli transformation
Easy-to-error PCR protocol (100μl):
5X buffer(140mM MgCl2, 250mM KCl, 50mM Tris, and 0.1%(wt/vol) gelatin)20μl
Template (iGEM-Tianjin provided) 4μl
Primers (iGEM-Tianjin provided) 4μl*2
10X dNTP (2mM dGTP, 2mM dATP, 10mM dCTP, and 10 mM TTP) 10μl
Taq polymerase 2μl
5mM MnCl2 10μl
ddH2O 46μl
94℃ 3min
94℃ 30s
53℃ 30s
72℃ 30s
72℃ 1min
recycle for 35 times
The PCR products were obtained and digested with BamHI and XbaI, and ligated with vector pRS416.
After E.Coli transformation, we collected the target bacteria and plasmids
Helping NKU with their plasmid construction
What we did:
Helping NKU-iGEM construct their plasmid
The cleavage sites XbaI and SacI were added by PCR before and after lysase (lys)
Forward Primer:GCTCTAGAATGAAATACCTGCTGCCGAC
Reverse Primer:CGAGCTCtCAATGCGTTTCCATAATAGCAGC
After the PCR product was obtained, then came cleavage:
After overnight digestion, it was linking with the linearized plasmid pEX18 for 1 hr.
Then the linking product was transformed into E.Coli.
PxylA-xylR was cleaved by SacI on plasmid pAX01
The pEX18-lys, which has been added with lys, was linearized by SacI single restrict digestion
The two were connected after 1hr
Then the linking product was transformed into E.coli.
Helped us to test the fluorescence intensity of pRS416-CUP1p-RFP without copper induction in Saccharomyces cerevisiae BY4742 and BY4741.
protocol
Cutsmart® buffer 5μl
XbaI 1μl
SacI 1μl
PCR product 43μl
Protocol
Cultures were incubated overnight in SC-URA medium.
Took some yeast suspension to the new SC-URA medium, then adjusted the OD600 value to 0.1 for 24 hours.
Fluorescence was measured, and the results were presented below:
Excitation 472nm
Radiation 532nm.