|
|
| (78 intermediate revisions by 2 users not shown) |
| Line 1: |
Line 1: |
| − | {{Aix-Marseille}}
| |
| | | | |
| − | <h1>M13 protein III</h1>
| |
| − |
| |
| − | The molecular interactions that mediate the entry of Escherichia coli derived filamentous phages into their hosts have been studied in considerable detail. The 424-amino-acid pIII is thought to consist of a leader sequence and three domains, separated by glycine-rich regions, that serve distinct roles in phage entry and release. The first two pIII domains, D1 and D2, are required for M13 adsorption and entry, while the third domain D3 is required for the assembly and release of M13 particles from host.<ref name="Heilpern">Heilpern, A. J. & Waldor, M. K. pIIICTX, a predicted CTXphi minor coat protein, can expand the host range of coliphage fd to include Vibrio cholerae. J. Bacteriol. 185, 1037–1044 (2003).</ref>
| |
| − |
| |
| − | nimage
| |
| − |
| |
| − | Thus in order to engineered multiple phages to infect various pathogenes we decided to remove D1 and D2. As we wanted to insert those two domains in the p3 of the M13 genome. Thus we use M13KO7 from New England BioLab. '''M13KO7''' is an M13 derivative which carries the mutation Met40Ile in gII. M13KO7 is able to replicate in the absence of phagemid DNA.
| |
| − |
| |
| − | To make a large biobrick collection we decided to search for differents pIII include in phages which infect differents bacterias. In order to find theses proteins, we searched in variety of scientific articles about virus genome. We also ran multiple BLAST on virus genome with pIII from M13 phage.
| |
| − |
| |
| − | In our design we wanted to keep the signal sequence and D3 of M13, because their are crucial for the formation of the phage. We just want to insert D1 and D2 from another phages (we’ll call it X).
| |
| − |
| |
| − | nimage
| |
| − |
| |
| − | In M13KO7, we manage to insert to restriction site (AvrII and BspI) which are compatible with XbaI and AgeI. Thus, we will create two types of biobrick, one with the signal sequence of M13, and the other one with D1 and D2 of another p3 from another filamentous phages.
| |
| − |
| |
| − | nimage
| |
| − |
| |
| − | To assess if a phages are actually constructed by E. coli, instead of insert the biobrick containing D1 and D2 we will insert a GFP gene (BBa_K1321337).
| |
| − |
| |
| − | nimage
| |
| − |
| |
| − | Finally, to assess if the chosen domain are specific, we’ll construct a D1D2-GFP-tag in pSB1C3.
| |
| − |
| |
| − | nimage
| |
| − |
| |
| − | ==Signal sequence==
| |
| − |
| |
| − | The signal sequence is crucial for the excretion of p3 in the periplasm. As we remove it with our construction, we must put another one. We choose to use the one coming from M13 as we use E. coli to produce our phage.
| |
| − | Here you can see in black the transmembrane part of the signal sequence, the rest of the sequence is in blue.
| |
| − |
| |
| − | <code>
| |
| − | >pIII from M13<br>
| |
| − | '''MKKLLFAIPLVVPFYSHS'''<span style="color:blue">AETVESCLAKPHTENSFTNV...</span>
| |
| − | </code>
| |
| − |
| |
| − |
| |
| − | In order to be functional, the signal peptide must be cut down from the rest of the protein. Thus, we must add the cleavage site. Using the logiciel SignalP 4.1, we saw that the cleavage is made between the alanine and the glutamate.
| |
| − |
| |
| − | nimage
| |
| − |
| |
| − | In order to gain flexibility, which will help the enzyme to cleave the signal sequence, we add two glycine and one serine residue.
| |
| − |
| |
| − | <code>
| |
| − | >Signal Sequence M13<br>
| |
| − | MKKLLFAIPLVVPFYSHSAEGSG
| |
| − | </code>
| |
| − |
| |
| − | Which is retrotranslate, with the codon biais of E. coli K12 to :
| |
| − |
| |
| − | <code>
| |
| − | >Signal Sequence M13
| |
| − |
| |
| − | ATGAAAAAACTGCTGTTTGCGATTCCGCTGGTGGTGCCGTTTTATAGCCATAGCGCGGAAGGCAGCGGCA
| |
| − | </code>
| |
| − |
| |
| − | ==D1-D2 biobricks==
| |
| − | Our goal is to create a engineered M13 phage that will be specific to an other bacteria. Thus we started to look in the bibliography and in the NCBI data base, filamentous phages that were able to infect various pathogens.
| |
| − |
| |
| − | {|
| |
| − | ! scope="col" |Pathogene
| |
| − | ! scope="col" |Filamentous phage
| |
| − | ! scope="col" |gene ID
| |
| − | |-
| |
| − | |E. coli
| |
| − | |M13 (fd,ff)
| |
| − | |927334
| |
| − | |-
| |
| − | |Neisseria gonorrheae
| |
| − | |NgoΦ6
| |
| − | |1260906
| |
| − | |-
| |
| − | |Pseudomonas aeruginosa
| |
| − | |Pf3
| |
| − | |1260906
| |
| − | |-
| |
| − | | rowspan="2" | Ralstonia solanacearum
| |
| − | |RSM1Φ
| |
| − | |5179368
| |
| − | |-
| |
| − | |RSS1Φ
| |
| − | |4525385
| |
| − | |-
| |
| − | | rowspan="3" | Vibrio Cholerea
| |
| − | |CTXΦ
| |
| − | |26673076
| |
| − | |-
| |
| − | |VFJΦ(fs2)
| |
| − | |1261866
| |
| − | |-
| |
| − | |VGJΦ
| |
| − | |1260523
| |
| − | |-
| |
| − | |Xanthomonas campestris
| |
| − | |ΦLf
| |
| − | |3730653
| |
| − | |-
| |
| − | |Xanthomonas fucans
| |
| − | |XacF1
| |
| − | |17150318
| |
| − | |-
| |
| − | |Xylella fastidiosa
| |
| − | |XfasM23
| |
| − | |6203562
| |
| − | |}
| |
| − |
| |
| − | D3 and the signal sequence are both the best conserved part from the attachment protein. So with protein global alignment (Needleman-Wunsch alignment), from two or three sequence at one time, we were able to determinate D1 and D2.
| |
| − |
| |
| − | Biobrick formation
| |
| − | The signal sequence and D1-D2 sequence are designed to make fusion protein, thus we choose to make them Freiburg assembly standard with Rfc25 prefix and sufix. This will be helpful in order to assemble our biobrick.
| |
| − |
| |
| − | ==References==
| |
| − |
| |
| − | Tseng, Y.-H., Lo, M.-C., Lin, K.-C., Pan, C.-C. & Chang, R.-Y. Characterization of filamentous bacteriophage ΦLf from Xanthomonas campestris pv. campestris. Journal of general virology 71, 1881–1884 (1990).
| |
| − |
| |
| − | T, K. et al. Genomic characterization of the filamentous integrative bacteriophages {phi}RSS1 and {phi}RSM1, which infect Ralstonia solanacearum., Genomic Characterization of the Filamentous Integrative Bacteriophages φRSS1 and φRSM1, Which Infect Ralstonia solanacearum. J Bacteriol 189, 189, 5792, 5792–5802 (2007).
| |
| − |
| |
| − | Piekarowicz, A. et al. Neisseria gonorrhoeae Filamentous Phage NgoΦ6 Is Capable of Infecting a Variety of Gram-Negative Bacteria. J Virol 88, 1002–1010 (2014).
| |
| − |
| |
| − | Heilpern, A. J. & Waldor, M. K. pIIICTX, a predicted CTXphi minor coat protein, can expand the host range of coliphage fd to include Vibrio cholerae. J. Bacteriol. 185, 1037–1044 (2003).
| |
| − |
| |
| − | Campos, J. et al. VGJφ, a Novel Filamentous Phage of Vibrio cholerae, Integrates into the Same Chromosomal Site as CTXφ. J. Bacteriol. 185, 5685–5696 (2003).
| |
| − |
| |
| − | <references/>
| |
