Difference between revisions of "Team:NJU-China/Collaborations"

Line 1: Line 1:
−
{{NJU-China}}
+
<html lang="en">
−
<html>
+
<head>
 +
    <meta charset="UTF-8">
 +
    <title>COLLABORATION</title>
 +
   
 +
        <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:Bootstrap?action=raw&ctype=text/css">
 +
        <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:vicstyle?action=raw&ctype=text/css">
 +
    <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:jumpto?action=raw&ctype=text/css">
 +
    <script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-2-1-4?  action=raw&ctype=text/javascript"></script>
 +
    <script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-scripts?action=raw&ctype=text/javascript"></script>
 +
    <script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-jumpto?action=raw&ctype=text/javascript"></script>
  
 +
<style>
 +
#sideMenu,
 +
#top_title{
 +
    display: none;
 +
    box-sizing: content-box;
 +
}
 +
#content{
 +
    width: 100%;
 +
    margin: 0px;
 +
    padding:0;
 +
}
 +
#top_menu_14{
 +
    height: 22px;
 +
}
 +
#top_menu_under{
 +
    height: 0px;
 +
}
 +
#toplink a{
 +
display:none;
 +
}
 +
#top_menu_inside{
 +
padding-top:3;
 +
font-size:13px;
 +
}
 +
#HQ_page p {
 +
    font-family: proxima-nova,"Arial",Helvetica,sans-serif;
 +
    font-size: 19px;
 +
    text-align: justify;
 +
}
 +
i{
 +
font-size:13px;
 +
}
 +
#globalWrapper{
 +
padding-bottom:0;
 +
font-size:19px;
 +
}
 +
a:visited{
 +
color:white;
 +
}
 +
.set_1_btn {
 +
    color: white;
 +
    cursor: pointer;
 +
    display: block;
 +
    font-size: 24px;
 +
    font-weight: 400;
 +
    line-height: 65px;
 +
    margin-right: 2em;
 +
    text-align: center;
 +
    max-width: 250px;
 +
    position: relative;
 +
    text-decoration: none;
 +
    text-transform: uppercase;
 +
    vertical-align: middle;
 +
    width: 100%;
 +
}
 +
.set_1_btn:hover {
 +
    text-decoration: none;
 +
    color: #72261E;
 +
}
 +
.Vbtn-1 {
 +
    background:transparent;
 +
    text-align: center;
 +
    float:left;
 +
}
 +
.Vbtn-1 svg {
 +
    height: 65px;
 +
    left: 0;
 +
    position: absolute;
 +
    top: 0;
 +
    width: 100%;
 +
}
 +
.Vbtn-1 rect {
 +
    fill: none;
 +
    stroke: white;
 +
    stroke-width: 3;
 +
    stroke-dasharray: 422, 0;
 +
    transition: all 600ms linear 0s;
 +
}
 +
.Vbtn-1:hover {
 +
    background: none;
 +
    font-weight: 900;
 +
    letter-spacing: 1px;
 +
    transition: all 150ms linear 0s;
 +
}
 +
.Vbtn-1:hover rect {
 +
    stroke-width: 5;
 +
    stroke-dasharray: 25, 300;
 +
    stroke-dashoffset: 385;
 +
    -webkit-transition: all 1.35s cubic-bezier(0.19, 1, 0.22, 1);
 +
    transition: all 1.35s cubic-bezier(0.19, 1, 0.22, 1);
 +
}
  
−
 
+
</style>
−
 
+
</head>
−
 
+
<body>
−
<div class="clear"></div>
+
    <div id="wrapper">
−
 
+
        <div class="overlay"></div>
−
<div class="column full_size">
+
   
−
<h1>Collaborations</h1>
+
        <!-- Sidebar -->
−
 
+
        <nav class="navbar navbar-inverse navbar-fixed-top" id="sidebar-wrapper" role="navigation">
−
<p>
+
            <ul class="nav sidebar-nav">
−
Sharing and collaboration are core values of iGEM. We encourage you to reach out and work with other teams on difficult problems that you can more easily solve together.
+
                <li class="sidebar-brand">
−
</p>
+
                    <a href="https://2017.igem.org/Team:NJU-China">
−
 
+
                      NJU-CHINA
−
<h3>Silver Medal Criterion #2</h3>
+
                    </a>
−
<p>
+
                </li>
−
Complete this page if you intend to compete for the silver medal criterion #2 on collaboration. Please see the <a href="https://2017.igem.org/Judging/Medals">2017 Medals Page</a> for more information.  
+
                <li>
−
</p>
+
                    <a href="https://2017.igem.org/Team:NJU-China"><i class="fa fa-fw fa-home"></i> Home</a>
−
 
+
                </li>
−
<div class="column half_size">
+
                <li class="dropdown">
−
 
+
                    <a href="https://2017.igem.org/Team:NJU-China/Project" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Project <span class="caret"></span></a>
−
<h4> Which other teams can we work with? </h4>
+
                    <ul class="dropdown-menu" role="menu">
−
<p>  
+
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/Project">Project</a></li>
−
You can work with any other team in the competition, including software, hardware, high school and other tracks. You can also work with non-iGEM research groups, but they do not count towards the iGEM team collaboration silver medal criterion.
+
                    <li><a href="https://2017.igem.org/Team:NJU-China/Project#Background">Description</a></li>
−
</p>
+
                    <li><a href="https://2017.igem.org/Team:NJU-China/InterLab">InterLab</a></li>
−
 
+
                    </ul>
−
<p>
+
                </li>
−
In order to meet the silver medal criteria on helping another team, you must complete this page and detail the nature of your collaboration with another iGEM team.
+
                <li class="dropdown">
−
</p>
+
                    <a href="https://2017.igem.org/Team:NJU-China/Results/Conclusions" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Results <span class="caret"></span></a>
−
 
+
                    <ul class="dropdown-menu" role="menu">
 +
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/Results/Conclusions">Results</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Results/Conclusions">Conclusions</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Demonstrate">Demonstrate</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Safety">Safety</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Improve">Improve</a></li>
 +
                    </ul>
 +
                </li>
 +
                <li>
 +
                    <a href="https://2017.igem.org/Team:NJU-China/Basic_Part"><i class="fa fa-fw fa-plus"></i> Parts </a>
 +
                </li>                <li class="dropdown">
 +
                  <a href="https://2017.igem.org/Team:NJU-China/Notebook" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Notebook <span class="caret"></span></a>
 +
                  <ul class="dropdown-menu" role="menu">
 +
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/Notebook">Notebook</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Experiments">Experiments</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Protocol">Protocol</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Calendar">Calendar</a></li>
 +
                  </ul>
 +
                </li>
 +
                <li class="dropdown">
 +
                  <a href="https://2017.igem.org/Team:NJU-China/HP" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Human Practice <span class="caret"></span></a>
 +
                  <ul class="dropdown-menu" role="menu">
 +
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/HP">Human Practice</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/HP/Silver">Silver HP</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/HP/Gold_Integrated">Intergrated and Gold</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Part_Collection">Public Engagement</a></li>
 +
                  </ul>
 +
                </li>
 +
                <li class="dropdown">
 +
                  <a href="https://2017.igem.org/Team:NJU-China/Team" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Team <span class="caret"></span></a>
 +
                  <ul class="dropdown-menu" role="menu">
 +
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/Team">Team</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Attributions">Attributions</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Collaborations">Collaborations</a></li>
 +
                  </ul>
 +
                </li>                               
 +
            </ul>
 +
        </nav>
 +
        <!-- /#sidebar-wrapper -->
 +
<nav id="cd-vertical-nav">
 +
            <ul>
 +
                <li>
 +
                    <a href="Collaborations" data-number="1">
 +
                        <span class="cd-dot"></span>
 +
                        <span class="cd-label">Collaborations</span>
 +
                    </a>
 +
                </li>
 +
            </ul>
 +
        </nav>       
 +
        <!-- Page Content -->
 +
       
 +
<div id="page-content-wrapper">
 +
          <button type="button" class="hamburger is-closed animated fadeInLeft" data-toggle="offcanvas">
 +
            <span class="hamb-top"></span>
 +
            <span class="hamb-middle"></span>
 +
            <span class="hamb-bottom"></span>
 +
          </button>
 +
        <div class="projecttop">
 +
           
 +
        </div>
 +
        <div class="page_container">
 +
        <div id="BCL2" class="first" style="padding: 50px 0;">
 +
        <div id="page_edge1">
 +
        </div>
 +
            <h2>Collaborations</h2>
 +
            <div class="container">
 +
            <div class="row">
 +
                    These four parts are artificially designed RNA strands that function as the silencing tool for BCL2 gene’s expression through base-pairing with corresponding mRNAs. BCL2 protein is anti-apoptotic, mainly located in the cytoplasm side of the nuclear membrane, the endoplasmic reticulum and the outer membrane of mitochondria. By muting BCL2 gene’s expression, we can induce more cells’ apoptosis theoretically. We design four sequences and have a DNA synthesis company produce plasmids with codes inserted for each of them.                   
 +
                </div>
 +
                <h3>SYSU-Software Team</h3>
 +
                <div class="row">
 +
                    As we showed our concern to people’s attitude towards obesity, the SYSU-Software helped us record emoji netizens would use when netizens talk about weight-related topics through web-crawling. Their work provided us with interesting data about netizens’ true reaction to weight-loss and enabled us to cater to ordinaries’ need.
 +
                </div>
 +
                <h3>CPU_China</h3>
 +
                <div class="row">
 +
                    CPU_China were very willing to help us so designed two other BCL2 siRNA (si-RNA 3 and 4 ) after we designed two.
 +
                </div>
 +
                <div class="row" >
 +
                    <div class="col-md-offset-2 col-md-8" style="text-align: center;border: 1px solid black;">
 +
                        BCL2-si RNA – 1 sequence: CCGGGAGAACAGGGTATGATA
 +
                        <br />
 +
                        BCL2-si RNA – 2 sequence: TACGAGTGGGATGCTGGAGAT
 +
                        <br />
 +
                        BCL2-si RNA – 3 sequence: GTGGATGACTGAGTACCTGAA
 +
                        <br />
 +
                        BCL2-si RNA – 4 sequence: CTGCATCACTCTGGGTGCATA
 +
                    </div> 
 +
                </div>
 +
                <div style="text-align: center;margin-top: -15px;">
 +
                    <i>our siRNA ( 1&2 is designed by us and 3&4 is designed by them)</i>
 +
                </div>
 +
                <h3>NUDT_China</h3>
 +
                <div class="row">
 +
                    As soon as our siRNAs have been designed, we sent the sequence of them to NUDT_China. They synthesized the siRNA for us and tested the gene silencing effect of these four sequence. The result showed it is the BCL2 siRNA-2 that has the best effect.
 +
                </div>                                                    
 +
            </div>
 +
        </div>
 +
    </div>
 +
    <div id="NJU-CHINA" class="foot" style="padding: 10px 0;background-color: black;color: white;"> 
 +
            <div class="container">
 +
                <div class="row">
 +
                    <div class="col-sm-4 col-md-4">
 +
                        <h2 style="float: left;font-size: 35px;padding: 0 0 13px 100px;font-family: 'Microsoft YaHei';letter-spacing: 1.5px;">NJU-CHINA</h2>
 +
                    </div>
 +
                    <div class="col-sm-8 col-md-8">
 +
                        <a href="https://2017.igem.org/Team:NJU-China/InterLab" class="set_1_btn Vbtn-1" style="float: right;;margin: 10px 200px 0;"> <svg>
 +
                        <rect x="0" y="0" fill="none" width="100%" height="100%"></rect>
 +
                        </svg> READ MORE </a>
 +
                    </div>
 +
                </div>
 +
            </div>       
 +
    </div>
 
</div>
 
</div>
 +
<!--page-->
 +
</div>
 +
<!-- /#wrapper -->
 +
   
 +
    <script src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-1110-min?action=raw&ctype=text/javascript" type="text/javascript"></script>
 +
    <script src="https://2017.igem.org/Team:NJU-China/Javascript:bootstrap-min-js?action=raw&ctype=text/javascript" type="text/javascript"></script>
 +
    <script type="text/javascript">
 +
        $(document).ready(function () {
 +
          var trigger = $('.hamburger'),
 +
              overlay = $('.overlay'),
 +
            isClosed = false;
  
 +
            trigger.click(function () {
 +
              hamburger_cross();     
 +
            });
  
 +
            function hamburger_cross() {
  
−
<div class="column half_size">
+
              if (isClosed == true) {         
−
<p>
+
                overlay.hide();
−
Here are some suggestions for projects you could work on with other teams:
+
                trigger.removeClass('is-open');
−
</p>
+
                trigger.addClass('is-closed');
−
 
+
                isClosed = false;
−
<ul>
+
              } else { 
−
<li> Improve the function of another team's BioBrick Part or Device</li>
+
                overlay.show();
−
<li> Characterize another team's part </li>
+
                trigger.removeClass('is-closed');
−
<li> Debug a construct </li>
+
                trigger.addClass('is-open');
−
<li> Model or simulating another team's system </li>
+
                isClosed = true;
−
<li> Test another team's software</li>
+
              }
−
<li> Help build and test another team's hardware project</li>
+
          }
−
<li> Mentor a high-school team</li>
+
         
−
</ul>
+
          $('[data-toggle="offcanvas"]').click(function () {
−
</div>
+
                $('#wrapper').toggleClass('toggled');
−
 
+
          }); 
−
 
+
        });
 +
    </script>
 +
</body>
 
</html>
 
</html>

Revision as of 03:26, 28 October 2017

COLLABORATION

Collaborations

These four parts are artificially designed RNA strands that function as the silencing tool for BCL2 gene’s expression through base-pairing with corresponding mRNAs. BCL2 protein is anti-apoptotic, mainly located in the cytoplasm side of the nuclear membrane, the endoplasmic reticulum and the outer membrane of mitochondria. By muting BCL2 gene’s expression, we can induce more cells’ apoptosis theoretically. We design four sequences and have a DNA synthesis company produce plasmids with codes inserted for each of them.

SYSU-Software Team

As we showed our concern to people’s attitude towards obesity, the SYSU-Software helped us record emoji netizens would use when netizens talk about weight-related topics through web-crawling. Their work provided us with interesting data about netizens’ true reaction to weight-loss and enabled us to cater to ordinaries’ need.

CPU_China

CPU_China were very willing to help us so designed two other BCL2 siRNA (si-RNA 3 and 4 ) after we designed two.
BCL2-si RNA – 1 sequence: CCGGGAGAACAGGGTATGATA
BCL2-si RNA – 2 sequence: TACGAGTGGGATGCTGGAGAT
BCL2-si RNA – 3 sequence: GTGGATGACTGAGTACCTGAA
BCL2-si RNA – 4 sequence: CTGCATCACTCTGGGTGCATA
our siRNA ( 1&2 is designed by us and 3&4 is designed by them)

NUDT_China

As soon as our siRNAs have been designed, we sent the sequence of them to NUDT_China. They synthesized the siRNA for us and tested the gene silencing effect of these four sequence. The result showed it is the BCL2 siRNA-2 that has the best effect.

NJU-CHINA

READ MORE