Difference between revisions of "Team:CSU Fort Collins/Experiments"

Revision as of 00:13, 2 November 2017

MENU ▤

CSU iGEM

HOME

TEAM

PROJECT

Description

Interlab Study

Experiments

Protocols

Results

PARTS

Parts

Basic Parts

SAFETY

ATTRIBUTIONS

HUMAN PRACTICES

Silver

6.4.16

We picked E. Coli “Stellar” cells from an LB/amp plate. The cells had been transformed with pLC71. We put the cells into test tubes with 5 mL of LB and 5 µL of ampicillin and then put those in the shaker at 37℃ overnight.

Protocol for picking cells from plate to test tube:

Materials

Autoclaved test tubes

100mL LB

100mg/mL ampicillin

Test tube rack

Bunsen Burner

P10 or P20 pipette

Latex gloves

Procedure

Place test tubes into the rack, label, date, initial.

Light bunsen burner for flame umbrella.

In each test tube: add 5mL of LB first, then, add 5 µL of AMP. Be sure that your pipette tip is submerged in the LB when adding the AMP.

Remove lid from LB/AMP plate. Use a pipette tip, gently pick a colony.

Eject pipet tip into test tube.

Flame the opening of the tube and recap.

Incubate tubes in 37℃ for approx. 16 hours.

6.5.16

We performed plasmid purification according to steps outlined in the S.O.P. in Tom’s lab. After purification we had ≈120 µL of plasmid solution. Fluorimetry determined the concentration of DNA was 317 ng/µL. Plasmid stored in iGEM box in fourth floor “VWR” fridge. Now it’s in the 3rd floor fridge (igem limonene box) 8.30.16 Mini-Prep Protocol (Zymo Research): Materials

P1 buffer

P2 buffer

P3 buffer (refrigerated)

(3) 1.7mL eppes.
Procedure

Pour test tube contents (no more than 5mL) into (3) 1.7mL eppes.

Centrifuge the eppes for 3 minutes at max speed.

Discard supernatant, pour carefully into waste.

Centrifuge 1 minute.

Pipette and discard supernatant.

Add 200µL P1 buffer to 1st eppe.

Pipette up and down until the pellet is dissolved.

Pipette the buffer w/ dissolved pellet into 2nd eppe.

Pipette up and down until the pellet is dissolved.

Pipette the buffer w/ dissolved pellets into 3rd eppe.

Pipette up and down until the pellet is dissolved.

Eppe’s 1 & 2 should be empty. Discard.

Add 200µL P2 by shooting in.

Add to all of your tubes quickly.

Snap all closed.

Inversion mix.

Leave tubes with only P1 & P2 for no more than 5 minutes or DNA will be damaged. Be ready to add P3.

Add 400µL P3 (refrigerated)

Inversion mix until no pink remains.

Let sit for 1-2 minutes

Centrifuge full speed for 10 minutes.

Setup plasmid filter columns over large Zymo collection tubes.

Pipette supernatant into filter column.

Discard pellet

Spin column 1 minute.

Discard flowthrough

Add 200µL Endo Wash Buffer to filter

Spin 1 minute

Discard flowthrough

Add 400µL Plasmid DNA Wash Buffer

Spin 1 minute

Discard flowthrough

Spin 2 more minutes to dry (very important).

Move filter to labeled 1.7 mL eppes

Label

Add 16µL 10mM Tris HCl pH 8.0 to filter column

Let sit 2 minutes

Spin 1 minute

The flowthrough contains the DNA. Don’t throw it out.

(Repeat) Add 16µL 10mM Tris HCl pH 8.0 to filter column

Let sit 2 minutes

Spin 1 minute

The flowthrough contains the DNA. Don’t throw it out.

Throw away filter. Keep flowthrough in labeled eppe.

6.6.16

60 µL of plasmid were removed from our stock and digested with SAL1 and CutSmart buffer.

6.7.16

We ran a gel purification of our cut plasmid, stained and imaged it on the third floor. File name: limonene plasmid 1 2016-06-07

George cut our plasmid out of the gel (the largest band on the gel). Our cut gel weighed 0.48g

We then used a kit to dissolve the gel and purify the plasmid. Fluorimetry showed the concentration to be 220 ng/µL

6.8.16

First try at Infusion cloning.

35 µL Stellar E.coli and 2.5 µL of post infusion pLC71

Cells plated and left to incubate around noon.

gene block: 100ng (μL/25ng) = 4μL

pLC71: 100 ng (μL/220ng) = 0.45μL

In-Fusion pre-mix: 2μL

Distilled water: 3.55μL

50°C for 15 minutes

6.9.16

Took transformed cells out of 4th floor incubator at 11:00 AM. No growth on either plate.
Re-transforming with the same infusion mix that we made yesterday
Stellar cells - 1501846A

Cell & DNA mixed at 12:08

The cells were kept on an ice/water miss the whole time. The tubes where cells & DNA were mixed were also on ice before the mix.

The infusion mix was stored in the eppe block for about 5 minutes.

LB/amp plates by RZ 5/20/16

Heat shock at 12:34 at 44 celsius for 45s then directly back on ice.

Plated at 12:40

Incubate 4th floor 49°C at 12:47

6.10.16

Took stellar cells transformed w/ infusion mix out of the incubator at 11:40
No growth, only bubbles. Second try at infusion mix Everything on ice for 10 minutes Diluted plasmid w/ distilled water from sink.

0.9uL 220ng/uL + 1.1uL dH2O
Transformation:

E. Coli was pulled out of the freezer at 1:50.

1:55, infusion mix was put in heat block w/ water at 50°C

Infusion mix was then put on ice and then mixed with E. Coli 2 minutes later.

We also transformed the same cells with a control of cut pLC71

Incubate all 3 tubes on ice for 30 minutes

Heat shock at 43°C for 45s

Plated after a 5 minutes back on ice (2:45)

LB/amp plates - AS 5/26/16

Incubated on 4th floor at 37°C overnight

6.11.16 No growth on any plates except for 2 colonies on the control (disgested pLC71)

6.21.16

Resuspending primers

Uncap LS p1, p1000 to add 292 μL distilled autoclaved H2O.

A little bit of water would fall out of the pipet tip. Tip was not full. Still, only a very small amount missing.

Recap.

7.7.2016

These are the sequences for the two C. Limon gene blocks that are being used for our current experiments: Blue/White screening allowed colonies with the gene block to be isolated From the first plate with the C. Limon gene block 1, 3 colonies were picked and the miniprep protocol from the lab was followed, these samples are listed as 1A, 1B, 1C from here on out. The same goes for the second C. Limon gene, except one of the culture tubes was broken so there are only two samples 2B and 2C. Nano Dropped each of the following samples to determine the DNA concentration: 1A, 1B, 1C, 2B, 2C. Also, performed digestion on the concentrated plasmid using the NEB protocol with adjusted amounts of each material The nanodrop results are listed below: 1A: 325.5 ng/uL 1B: 325.9 ng/uL 1C: 381.6 ng/uL 2B: 243.9 ng/uL 2C: 332.7 ng/uL The 260/280 ratio for each measurement was around 1.83, which means that the DNA is pretty pure. After nano dropping each of the plasmids we used the following measurements for the digestion protocol: For amount of DNA: 1A: 3.1uL 1B:2.1 uL 1C: 2.6 uL 2B: 4.1uL 2C: 3.0uL 10X Cutsmart: 5uL, making it 1X concentration EcoR1: 1uL Sterile DI Water: 1A: 40.9uL 1B: 40.9 uL 1C: 41.4 uL 2B: 39.9uL 2C: 41.0 uL All of the reaction volumes came out to 50uL and were placed in the thermocycler following this program: 37°C for 1 hour and 30 minutes, then it is going to be heat inactivated at 65°C for 30 minutes, then held at 4°C until tomorrow 7.10.16 Took digested plasmid from 7.8.16 and ran it through a gel with 1kb+ ladder to confirm that the plasmid had been cut in the correct place. Results are shown below, the order of the wells are: LADDER, 1A, 1B, 2A, 2B, 2C. There seem to be bands at around 4,000 base pairs, which matches up with the StrataClone Blunt PCR Cloning Vector pSC-B-amp/kan containing 4.3 kb There are also bands around 1298 for 1B only, which is the correct number of bp’s for C.Limon 1, and there are also two bands for 2B and 2C at around 817 base pairs, confirming that the gene blocks were cut a out of the Strataclone vector at the correct spot 7.12.16 Primers were ordered from IDT today, there are corresponding colors that can be matched with the genes listed above, also we went ahead and ordered the primers for the two C. Sten gene blocks listed below Limonene Synthase Forward Primer (6.20.16) 5’- ATGCGCGTTGCGGCAGTCGACCGGCAAAAGG-3’ ( GC%= 64.5%, Tm=77.8°C, length:31 bp ) Limonene Synthase Reverse Primer (6.20.16) 5’- GATTTTTTTTGTCGACTTTTTTGCGGCCGCT -3’ 3’- AGCGGCCGCAAAAAAGTCGACAAAAAAAATC-5’(GC%=41.9%, Tm=70.2°C, length:31bp) C.Limon 1-Reverse Primer 5’- GATCTTCACCGACGCCGTCGAGAGGTGGG -3’ 3’-CCCACCTCTCGACGGCGTCGGTGAAGATC-5’ (GC%=65.5%, Tm=73.8°C, length: 29 bp) C.Limon 2-Forward Primer 5’-CCGTCGAGAGGTGGGACATAAACTACGCCC-3’ (GC%=60%, Tm=72.2°C, length:30 bp) C. Sten 1- Reverse Primer 5’-GATGGTGGAGGAATACCTGGTTCGTCGAGAA -3’ 3’-TTCTCGACGAACCAGGTATTCCTCCACCATC-5’ (GC%=51.6%, Tm=70.6°C, length:31bp) C.Sten 2- Forward Primer 5’-GGGCATGGTCCCAAGAAGGCAGCAC-3’ (GC%=64%, Tm=72.1°C, length: 25bp) C.Sten gene block 1 (1198 bp) ATGCGCGTTGCGGCAGTCGACCGGCAAAAGGCGAATTATGTGTAGGCATTAGGTTAAGCCTTCTTTTCATTTTTACGGCAATCAGCGAGCTTTTTTTGGCCGCTGAAAGGGTCTGAAAGCGAAAAGTATTTAAACCCCAAGTGGCCAGATAGGTATGACAACACTTAGTAGGGGCTAAAGCCCCAACAACCCAAGGAGGTGTTGTATGGCCCTCAAGATGACCAGCGCCGTCATGCAGATGGCGATACCGACCAAGCTCGCCAACTTCGTCAACAATAGCGACACCCACAAGCAAAGCCTGAAACTCCTGAGGAACGTTTCCACGATAAGCACCTCCGCGGCCGCGGCCACGCCGAGGCATAGACTCCCAGTCTGCTGCAGCGCGTCCAGCTCCAGCTCCAGCCAGCTGCCGACbCATAGAGAGGAGATCCGGCAATTACAAGCCAAGCAGGTGGGACGTTGATTTCATGCAATCCCTCAACAGCGACTACCAGGAGGAAAGACACAGGACGAAAGCCTCCGAGCTGATAACCCAAGTCAAGAATCTCCTGGAAAAAGAGACGAGCGATGACCCGATAAGACAGCTCGAACTGATCGATGACCTCCAAAGGCTGGGCCTCTCCGATCATTTCGAGCACGAATTTAAGGAGGTTCTGAACAGCATATACCTCGACAATAAATATTACAACATCAATATAATGAAGGAAACCACGTCCAGCAGAGATCTGTATTCCACCGCGCTCGCCTTCAGGCTGCTCAGAGAGCATGGCTTCCAGGTCGCGCAAGAAGTTTTTGACTGCTTCAAAAACGAGGAAGGCGAGTTTAAGGCCAGCCTGTCCGATGACCCAAGGGGCCTCCTGCAGCTCTACGAAGCGAGCTTCCTGTTTAAAGAGGGCGAAAATACGCTCGAGATCGCCAGAGAATTCGCGACCAAGCTGCTCCAAGAGAAAGTCAACTCCAGCGATGAAATAGACGATAATCTGCTCTCCAGCATCAGGTATTCCCTGGAGATACCGACGTACTGGAGCGTTATCAGACCAAACGTCTCCGTTTGGATAGACGCCTATAGGAAGAGACCGGATATGAATCCAGTCGTTCTCGAACTGGCGATCCTCGACGCCAACATAATGCAGGCGCAACTGCAGCAAGAGCTCAAAGAAGCCCTGGGATGGTGGAGGAATACCTGGTTCGTCGAGAA C.Sten gene block 2 (897) GGGCATGGTCCCAAGAAGGCAGCACAAAACCGCCAGACAACTCATGGCGAAGGTTATCGCCCTGATAACGGTCATGGACGATATCTATGACGTTTACGGAACCCTCGAGGAACTGGAGCTCTTCACGGATGCGTTTAGGAGATGGGACGTCAGCTCCATAGATCATCTGCCGACCTATATGCAGCTCTGCTTCCTGAGCATCAACAATTTTGTTGTTGACACGGCCTACAACATACTCAAAGAAACCGGCGTTAATGTCACGACCTATCTGGAGAAGTCCTGGGTTGATCAAGCGGAAAACTACCTCATGGAGAGCAAATGGTTCTACTCCGGACACAAGCCAAGCCTGGACGAATATCTCGAGAATTCCTGGATCAGCGTCTCCGGCCCGTGCGTTCTGACGCATGAATTCTTTGGAGTCACCGATAGCCTCGCCAAAGACACGCTGGATTCCCTCTACGAGTATCACGACATAGTTAGGTGGAGCTCCTACCTGCTCAGACTGGCGGATGACCTCGGCACCAGCGTCGAAGAGGTTTCCAGGGGAGATGTCCCAAAGAGCATCCAGTGCTATATGAACGACAATAACGCCTCCGAAGAGGAAGCGAGAGAGCATGTTAAAGGCCTGATAAGGGTCATGTGGAAGAAAATGAATGCCGAAAGAGTTAGCGAGGATTCCCCGTTCTGCAAGGACTTTATCAGGTGCTGCGAAGATCTCGGAAGAATGGCGCAATTCATGTACCACTATGGCGACGGACACGGCACGCAGCATGCCAAAATACACCAACAGATCACCGATTGCCTGTTCCAACCATTTGCCTACCCATACGACGTTCCGGACTACGCACACCATCACCATCACCATTGATTTTTTTTGTCGACTTTTTTGCGGCCGCT C. Limon gene block 1(A,B,C), bp=1298 ATGCGCGTTGCGGCAGTCGACCGGCAAAAGGCGAATTATGTGTAGGCATTAGGTTAAGCCTTCTTTTCATTTTTACGGCAATCAGCGAGCTTTTTTTGGCCGCTGAAAGGGTCTGAAAGCGAAAAGTATTTAAACCCCAAGTGGCCAGATAGGTATGACAACACTTAGTAGGGGCTAAAGCCCCAACAACCCAAGGAGGTGTTGTATGAGCAGCTGCATAAACCCGAGCACCCTCGTCACCAGCGTCAACGCCTTCAAGTGCCTCCCGCTCGCCACCAACAAGGCCGCCATAAGGATAATGGCCAAGTACAAGCCGGTCCAGTGCCTCATAAGCGCCAAGTACGACAACCTCACCGTCGACAGGAGGAGCGCCAACTACCAGCCGAGCATATGGGACCACGACTTCCTCCAGAGCCTCAACAGCAACTACACCGACGAGGCCTACAAGAGGAGGGCCGAGGAGCTCAGGGGCAAGGTCAAGATAGCCATAAAGGACGTCATAGAGCCGCTCGACCAGCTCGAGCTCATAGACAACCTCCAGAGGCTCGGCCTCGCCCACAGGTTCGAGACCGAGATAAGGAACATCCTCAACAATATATACAACAATAACAAGGACTACAACTGGAGGAAGGAGAATCTCTATGCCACCAGCCTGGAGTTCAGGCTCCTGAGGCAGCACGGCTACCCGGTCAGCCAGGAGGTTTTCAACGGCTTCAAGGACGATCAGGGCGGATTCATATGCGACGATTTCAAGGGCATACTCAGCCTGCACGAGGCCAGCTACTATTCCCTCGAGGGCGAAAGCATAATGGAGGAAGCCTGGCAGTTCACCAGCAAGCACCTCAAAGAGGTCATGATAAGCAAGAACATGGAGGAAGACGTTTTCGTCGCCGAGCAGGCGAAGAGGGCCCTCGAGCTGCCGCTCCACTGGAAGGTCCCGATGCTCGAGGCCAGGTGGTTCATACACATCTACGAGAGGCGCGAAGACAAGAACCACCTCCTGCTCGAGCTGGCCAAAATGGAGTTCAACACCCTCCAGGCGATATACCAGGAGGAACTCAAGGAGATCAGCGGCTGGTGGAAAGACACCGGCCTGGGAGAGAAGCTCAGCTTCGCCAGGAACCGCCTCGTCGCGAGCTTCCTGTGGTCCATGGGCATAGCCTTCGAGCCGCAGTTCGCGTACTGCAGGCGCGTCCTCACCATAAGCATCGCCCTGATAACCGTTATCGACGATATATACGACGTCTATGGCACCCTCGACGAGCTGGAGATCTTCACCGACGCCGTCGAGAGGTGGG C. Limon gene block 2(B,C), bp=817 CCGTCGAGAGGTGGGACATAAACTACGCCCTCAAGCACCTGCCGGGCTACATGAAGATGTGCTTCCTCGCGCTGTACAACTTCGTCAATGAGTTCGCCTACTATGTTCTCAAGCAGCAAGACTTCGATCTGCTCCTGAGCATAAAGAACGCCTGGCTCGGCCTGATACAGGCGTACCTCGTCGAGGCCAAGTGGTACCACAGCAAATACACCCCGAAGCTCGAGGAATATCTCGAGAACGGCCTCGTCAGCATAACCGGCCCGCTCATAATCACCATAAGCTACCTGTCCGGCACCAACCCGATAATCAAGAAAGAGCTCGAGTTCCTGGAAAGCAACCCGGACATAGTCCACTGGAGCTCCAAGATATTCAGGCTCCAGGACGACCTCGGCACCAGCAGCGACGAGATACAGAGGGGCGACGTCCCGAAGAGCATACAGTGCTACATGCACGAGACCGGCGCCAGCGAGGAGGTCGCCAGGCAGCACATAAAGGACATGATGAGGCAGATGTGGAAGAAGGTCAACGCCTACACCGCCGACAAGGACAGCCCGCTCACCGGCACCACCACCGAGTTCCTCCTCAACCTCGTCAGGATGAGCCACTTCATGTACCTCCACGGCGACGGCCACGGCGTCCAGAACCAGGAGACCATAGACGTCGGCTTCACCCTCCTCTTCCAGCCGATACCGCTCGAGGACAAGCACATGGCCTTCACCGCCAGCCCGGGCACCAAGGGCTACCCATACGACGTTCCGGACTACGCACACCATCACCATCACCATTGATTTTTTTTGTCGACTTTTTTGCGGCCGCT 7.14.16 Performed mini-prep on the prepared cultures from the white colonies on blunt cloning plate for: 1B, 2B, 2C (all of the plasmids that had bands on the gel) Received all four primers today and resuspended each so that the concentration was 100uM We are going to perform PCR with the phusion enzyme to amplify the C. Sten g-blocks before we try Blunt Cloning For all four of the primers, we created a 10uM concentration by diluting 1ul of primer with 9ul of sterile diH2O Component 50μl reaction Molecular grade H2O Added first. 32.5μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL L. Synthase forward (10μM) 2.5μL C. Sten 1 - Reverse (10μM) 2.5μL C. Sten g-block 1 1.0μL Tom’s Phusion DNA polymerase Added last. 0.5μL Component 50μl reaction Molecular grade H2O Added first. 32.5μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL L. synthase reverse (10μM) 2.5μL Sten 2 - Forward (10μM) 2.5μL Template DNA 1.0μL Tom’s Phusion DNA polymerase Added last. 0.5μL Ran the PCR reaction in the with Thermocycler Program as follows, for both of the C.Sten g-blocks, FROM NOW ON WE NEED TO USE EPPENDORF TEST FOLDER MAKE SURE TO LOG IN: Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 5 min 1 Denaturation 98 10s Annealing 67 15s 35 Extension 72 55s Final Extension 72 5 min 1 Hold 4 hold 7.15.16 Sent in mini-prepped tubes containing Blunt cloning plasmid and C. Limon g-blocks to quintarabio for sequencing results using the T3 and T7 primers that correspond with the blunt cloning kit primer binding sites, the concentrations for each of the g-blocks is listed below 1B-264.0ng/ml, 260/280-1.75 2B-338.0ng/ml, 260/280-1.78 2C-304.5ng/ml, 260/280-1.70 Ran the gel from the PCR performed on C. Sten 7.14.16 to see if the g-block was successfully amplified, results are shown below following this key: ladder, C. Sten 1, C. Sten 2, we are expecting 1198 bp’s for C.Sten 1, and 897 bp’s for C.Sten 2 It seems like the C. Sten 1 was unsuccessful, so we will instead perform a two step PCR corresponding to the table below, with adjusted temperatures and extension time, also we will use more of the Phusion enzyme, since it is not commercial grade C. Sten 2 seems to have bands at around 897 base pairs, which is the correct number, but there also seems to be some other bands, so we will run another gel on 7.16.16 with the C.Sten 1 Two-step PCR product and also, the 41ul of the rest of the C.Sten PCR product from 7.14.16, then we will cut it from the gel and purify it if there are bands at around 1198 base pairs (did not do this) C. Sten 1, 2-step PCR Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 5 min 1 Denaturation 98 10s Extension 72 1.5 min 35 Hold 4 hold Component 50μl reaction Molecular grade H2O Added first. 32.5μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL L. synthase reverse (10μM) 2.5μL C. Sten 2 - Forward (10μM) 2.5μL Template DNA 1.0μL Tom’s Phusion DNA polymerase Added last 5uL 7.16.16 Performed PCR on C. Sten 1 again, since gel did not have correct band Ran a gel with the 41ul of the rest of PCR product from C.Sten 2 and ran PCR product from today, ladder, 6 wells filled with C.Sten 1, 41ul of C.Sten 2 in last well It was a failure so we are going to reorder the limonene synthase forward primer, because the melting temp. was so high (77.8°C) This is the new primer we ordered: ATG CGC GTT GCG GCA GTC GAC (GC=66.7%, melting temp=71.3°C, bp=21) We will perform the two-step PCR again with both gene blocks, once the new forward primer arrives 7.19.16 Results from quintarabio for 1B, 2B, 2C were received today, results are as follows: 1B non conclusive, T3 and T7 sequences did not align 2B seemed to have worked, picture of aligned sequences is shown below 2C had some alignment, but a few couple of mismatched base pairs that proved to have non silent mutations when put into the Expasy program I aligned the second part of the g-block with a spliced sequence I created from the T3 sequence and the RC of the T7 sequence, this is the spliced sequence I used, the yellow highlighted area was the sequence chosen that splits the two gene blocks apart: Strataclone T3 sequence through PCR product,green is T3 primer binding site yellow is discrepancy in the spliced gene and the starting sequence in the strataclone vector CAATTAACCCTCACTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCCACTGTGGAATTCGCCCTT Strataclone PCR product through T7 Primer binding site, green is T7 primer binding site, the sequence still has two EcoRI cut sites AAGGGCGAATTCCACATTGGTCGCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCACCGCGGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTAC GGCATACTGGTACCGGGCCCCCCCTCGAGTCGACGGTATCGATAAGCTTGATATCCCTGTGGAATTCGCCCTTCCGTCGAGAGGTGGGACATAAACTACGCCCTCAAGCACCTGCCGGGCTACATGAAGATGTGCTTCCTCGCGCTGTACAACTTCGTCAATGAGTTCGCCTACTATGTTCTCAAGCAGCAAGACTTCGATCTGCTCCTGAGCATAAAGAACGCCTGGCTCGGCCTGATACAGGCGTACCTCGTCGAGGCCAAGTGGTACCACAGCAAATACACCCCGAAGCTCGAGGAATATCTCGAGAACGGCCTCGTCAGCATAACCGGCCCGCTCATAATCACCATAAGCTACCTGTCCGGCACCAACCCGATAATCAAGAAAGAGCTCGAGTTCCTGGAAAGCAACCCGGACATAGTCCACTGGAGCTCCAAGATATTCAGGCTCCAGGACGACCTCGGCACCAGCAGCGACGAGATACAGAGGGGCGACGTCCCGAAGAGCATACAGTGCTACATGCACGAGACCGGCGCCAGCGAGGAGGTCGCCAGGCAGCACATAAAGGACATGATGAGGCAGATGTGGAAGAAGGTCAACGCCTACACCGCCGACAAGGACAGCCCGCTCACCGGCACCACCACCGAGTTCCTCCTCAACCTCGTCAGGATGAGCCACTTCATGTACCTCCACGGCGACGGCCACGGCGTCCAGAACCAGGAGACCATAGACGTCGGCTTCACCCTCCTCTTCCAGCCGATACCGCTCGAGGACAAGCACATGGCCTTCACCGCCAGCCCGGGCACCAAGGGCTACCCATACGACGTTCCGGACTACGCACACCATCACCATCACCATTGATTTTTTTTGTCGACTTTTTTGCGGCCGCTAAGGGCGAATTCCACATTGGTCGCTGCAGCCCGGGGGATCCACTGTCTAGAGCGGCCGCACGCGAGTACAAGCC This is a picture of the alignment of the actual gene block sequence and this spliced sequence listed above, the top is the spliced sequence, the bottom is the g-block: 7.20.16 Casey & Alec miniprep cultures from 7/19 streak plate. Cells from strataclone kit w/ limon inserts, these samples were sent for sequencing today gBlock 1 (limon) samples A & B gBlock 2 (limon) samples A & B Fluorimetry to gather concentrations for sequencing 1A,Forgot to read error…-193.1 ng/uL 1B, Error: -7, 226 ng/uL 2B, Error: -10, 225 ng/uL 2A, Error: -2, 178.2 ng/uL 7.21.16 -Sequencing results came in for miniprep done on 7.20 and I am thinking that the first gene block was inserted in a reverse orientation into the plasmid, below is a picture of the 1B spliced seq aligned with the C. Limon 1st part of the gene block: Now here is a picture of the g-block aligned with the reverse complement of the spliced 1B seq from 7/20: Same exact thing happened to the sequencing results from 7/15 for 1B, below is the C.Limon first part of the g-block aligned with the RC of the 1A spliced seq: 7.21.16 PCR with sten 1 & 2 This time, using the new forward primer. Casey, Rusu, & Courtney prepared the reaction starting at 2:00 PM. Casey - I came back to the lab later to run a gel and I realized we made a few mistakes.. Did not dilute the primers.. Did not add water to sten 2.. We only had 20 uL in the tube.. (this one is pretty bad you guys) Casey - 7:00 PM I’m re-doing the PCR. Component 50μl reaction Molecular grade H2O Added first. 32.5μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL L. Synthase forward (10μM) (NEW) 2.5μL C. Sten 1 - Reverse (10μM) 2.5μL C. Sten g-block 1 1.0μL Tom’s Phusion DNA polymerase Added last. 0.5μL Component 50μl reaction Molecular grade H2O Added first. 32.5μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL L. synthase reverse (10μM) 2.5μL Sten 2 - Forward (10μM) 2.5μL Template DNA 1.0μL Tom’s Phusion DNA polymerase Added last. 0.5μL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 5 min 1 Denaturation 98 10s Annealing 67 30s 30 Extension 72 2 min Hold 4 hold I’m thinking we should nanodrop to check for amplification instead of running a gel as we can save more of our sample if the result is good. Also, the gel won’t tell us a concentration, and we already know the gene block is in the reaction mix. We need to check the concentration of DNA. After confirming that the gene blocks have been amplified, we should try the PCR assembly protocol or infusion cloning. We need to put the gene blocks together. After that, we can run a gel. 2 bands around 1000bp = we suck 1 band around 2000 = we’re awesome 7.22.16 Nanodrop (both gave error warnings) gBlock 1 25 ng/uL 30 ng/uL gBlock 2 21 ng/uL Running gel Poured last night 110 volts Set 45 min Well 1 = C.sten 1 PCR product Well 2 = C.sten 2 PCR product 7.24.16 Re-did the PCR on C.Sten 1 and 2 using this mixture protocol: I had to dilute all four of the primers, 1:10 and I also dilute the 25mM dntps to 10mM 2:5 Component 50μl reaction Molecular grade H2O Added first. 32.5μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL L. synthase reverse/forward(10μM) 2.5μL C. Sten 2 - Forward/reverse (10μM) 2.5μL Template DNA 1.0μL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 5 min 1 Denaturation 98 10s Extension 68-72 (gradient) 1.5 min 35 Hold 4 hold 7.25.16 Ran a gel with the PCR products from 7.24, pic is shown below 1A and 2B off of Madeline’s master plate, ladder c.sten 1 and c.sten 2 Confirmed with Sharon that the orientation of the gene block in the strataclone vector does not matter, so in this case, we can move forward with experimentation with the first gene block (miniprep, phusion PCR) 7.29.16 -Redid the PCR with a 66-70°C gradient, and started a culture with 1A and 2B from madeline’s master plate -Diluted the 4 C. sten primers to 10mM and dNTPs to 10mM -Fixed gradient to do PCR with C. sten 1 and 2 TM + 3 and -3 (4 total) C. Sten 1 Component 50μl reaction dH2O Added first. 28μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL L. Synthase forward (10μM) 2.5μL C. Sten 1 - Reverse (10μM) 2.5μL C. Sten g-block 1 1.0μL Tom’s Phusion DNA polymerase (D) Added last. 5μL C. Sten 2 Component 50μl reaction dH2O Added first. 28μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL C. Sten 2 forward (10μM) 2.5μL LS p2 (10μM) 2.5μL C. Sten g-block 2 1.0μL Tom’s Phusion DNA polymerase (D) Added last. 5μL Thermocycler setup: Cycle step Phusion Cycles Temp (oC) Time Initial denaturation 98 30s 1 Denaturation 98 10s 35 Annealing TM+/- 3 30s Extension Hold 72 4 1min ∞ 1 TM for C. Sten 1 Limonene Synthase forward primer - 77.8°C C. Sten 1 Reverse- 70.6°C TM for C. Sten 2 C. Sten 2 Forward- 72.1°C LS p2- 70.2°C C. Sten 1 -/+ 3°C LSF- 74.8/80.8°C C.Sten 1 R- 67.6/73.6°C C. Sten 2 -/+3°C C. Sten 2 F- 69.1/75.1°C°C LS p2- 67.2/73.2 Placement in Thermocycler column #: CS2 (-3) = 2 CS2 (+3) = 10 CS1 (-3) = 3 CS1 (+3) = 11 8.8.16 Running gel with PCR products of 7.29.16 Looks good 8.9.16 Performed the gel purification protocol from the lab, including the following changes: Only did 1 membrane wash Did not pre heat the elution buffer Did the final elution with 15uL of the 10mM tris-HCL ph 8.8 Both parts of the gene block will be nanodropped tomorrow to see how high the concentration of DNA is 8.10.16 PCR with minipreped stataclone vector + insert from culture started on 7.29.16 We have 4 samples, 1A, 1B, 2B, 2C Two different annealing temperatures for each sample. 68 & 72 So we will have 8 PCR reactions. For C. Limon 1 Component 50μl reaction Molecular grade H2O Added first. 28 μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL L. synthase forward (10μM) 2.5μL C. Limon 1 or 2 middle primer (10μM) 2.5μL Template DNA 1.0μL Tom’s Phusion DNA polymerase Added last 5uL So we’re going to need (4)(2.5μL) of each primer. In the end we want (10μL)(10μM) so.. dilute(10μL)(10μM) = 10-4μmol = 10-4μmol(1L/25μmol) = 4*10-6L = 4μL stock 4μL stock + 6μL H2O = 10μL(10μM) primers & 8μL of dNTP’s stock 25 mM We want (8μL)(10mM) Dilute (8μL)(10mM) = 8*10-5mmol = 8*10-5mmol (1L/25mmol) = 3.2*10-6L = 3.2μL 3.2μL + 4.8μL H2O = 8μL(10mM) dNTP’s For C. Limon 2 Component 50μl reaction Molecular grade H2O Added first. 32.5μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL LS p2(10μM) 2.5μL C. Limon 2 Forward (10μM) 2.5μL Template DNA 1.0μL Tom’s Phusion DNA polymerase Added last 5uL So we’re going to need (4)(2.5μL) of each primer. Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 5 min 1 Denaturation 98 10s Extension 68-72 (gradient) 1.5 min 35 Hold 4 hold 8.10.16 -Ran a gel with the completed C.Limon PCR products listed above from 8.9.16, results are shown below: ladder, next three were sharon’s stuff, 1A-68, 1B-68, 2B-68, 2C-68, 1A-72, 1B-72, 2B-72, 2C-72 -Nanodropped C. Sten 1 & 2 gel purification products results are shown below: C. Sten 1 green tube- 9.9 ng/ul, 260/280- 2.07 C. Sten 1 blue tube- 16.2 ng/ul, 260/280-1.92 C. Sten 2 orange tube- 14.1 ng/ul, 260/280-1.84 C. Sten 2 yellow tube- 17.4 ng/ul, 260/280-1.72 8.12.2016 Fluorimetry on C. limon gel purification calibration : 99.76 Concentration(ng/uL) Error 1A-68: 18.9k -1.172 1A-72: 76.58 6.4 1B-68: 53.96 -2.9 1B-72: 33.34 -2.472 2B-68: 27.93 -5.44 2B-72: 69.96 -10.76 2C-68: 76.63 ? 2C-72 : 13.27 -11.73 8.13.16 -We tried infusion cloning with C.sten 1 and 2 g-blocks, these were the ones that were not in the strataclone vector, so after PCR amplification and running a gel to confirm amplification, we attempted to just directly clone both g-blocks into the pLC71 vector We used a 1:1:1 molar ratio for 1st g-block:2nd g-block:pLC71 and the values for each are shown below, keep in mind we had two PCR products for each g-block, so they are separated by eppendorf tube color, in this case we only used C.sten 1 blue and C.sten 2 yellow C.Sten 1 blue: 1.36 uL C. Sten 2 yellow: 1.02uL pLC71:0.88uL, dilution- 2uL pLC71 + 2uL sterile H2O, this way we could use 1.8uL instead of 0.88 which is hard to achieve with a pipette 3.8uL of water We did a negative control that contained everything listed above, except for the infusion mix -After following the Infusion protocol, we followed the Interlab transformation protocol, except we added 2 uL of the plasmid instead of 1uL, also when we plated after the outgrowth period, we use 50uL on one plate, and the rest on another plate, ~200uL 9.2.16 Nanodropping: C. Limon 1B & 2B in the strataclone vector 1B: 361.4 ng/μL 260/280: 1.84 2B: 368.9 ng/μL 260/280: 1.84 PCR: M1V1 = M2V2 V1B = (2μL)(361.4 ng/μL) / (10ng/μL) = 72.28 μL V1B = (2μL)(361.4ng/μL) / (10ng/μL) = 73.78 μL So, to dilute the plasmids to 10 ng/μL.. 1B: 2μL stock + 70.3μL dH2O 1B: 2μL stock + 71.8μL dH2O Primers: 1B: Limonene Forward + C.limon1R 2B: C.limon2F + LSp2 We have 100μM primers, we want 10μM. M1V1 = M2V2 V = (2μL)(100μM) / (10μM) = 20μL So to dilute the primers… 2μL stock + 18μL dH2O Component 50μl reaction MMix (5 rxns) - 41uL Molecular grade H2O Added first. 27.5 μL 137.5µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL Template DNA 10ng/uL 3μL 15µL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 60 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold 9.3.16 PCR failed. New idea; add DSMO (5% volume). Also try raising the annealing temperature. DMSO: We have 100% DMSO from NEB (0.05)(50µL) = 2.5µL DMSO With DMSO: Component 50μl reaction MMix (5 rxns) - 40uL Molecular grade H2O Added first. 27μL 135µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL 100% DMSO 2.5µL 12.5µL Template DNA 10ng/uL 1μL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 65 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold Without: Component 50μl reaction MMix (5 rxns) - 40uL Molecular grade H2O Added first. 27.5 μL 147.5µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL Template DNA 10ng/uL 3μL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 65 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold Brett Burkart, an employee of the Santangelo lab, gave Casey this protocol for purifying PCR products. PB buffer Add 5x the volume of the combined PCR reactions. Combined PCR reactions PB Buffer 177µL 885µL 3M NaOAc pH 5.2 Add 1/100x the volume of the PCR reaction + PB buffer Working Volume 3M NaOAc pH 5.2 1062µL 10µL Spin through column (may take two runs). Discard flow through. Load column with 750µL ethanol, spin. Discard ethanol, spin 2 minutes to dry. Label 1.7mL eppe. Load 25µL 10mM tris HCl pH 8.5 Spin 2 mins. collect in labeled eppe. Load 25µL 10mM tris HCl pH 8.5 Spin 2 mins. collect in same labeled eppe. 9.20.16 Dr. Peebles discovered the there was no overlap between our insert and vector. The infusion cloning could not have worked. New primers Forward: GGC CGC AAA AAA GTC GAA TGC GCG TTG CGG CAG TCG melt temp: 77.7 ºC homologous region: A TGC GCG TTG CGG CAG TCG melt temp: 70.6 ºC Reverse: CAA AAT GCG CGT TGC GGC AGA GCG GCC GCA AAA AAG TCG AC melt temp: 78.4 homologous region: AGCGGCCGCAAAAAAGTCGAC melt temp: 68.3 ºC 9.22.16 Picked up new primers & resuspended. 9.26.16 PCR with new primers, from strataclone vector. Component 50μl reaction MMix (5 rxns) - 41uL Molecular grade H2O Added first. 27.5 μL 137.5µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL Template DNA 10ng/uL 3μL 15µL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 60 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold 7.25.17 Did a gDNA prep with non-confirmed strains: pHF10: 1L, 4N, 2M, 3L, 2O, 1C, 4M, 4K, 1M, 2L pLC71: 4E, 2E, 2A, 9E, 1C, 4P, 4D Positive control: pHF10 3S Negative control: pLC71 7.26.17 Performed PCR: Made a master mix with the following reagents 4.8 ul forward and reverse primers 12 ul dNTP 120 ul phusion 240 ul GC buffer 746.56 ul water 3 ul gDNA from extraction Ran a gel with the gDNA prep, but the gel was upside down so samples ran out 7.27.17 Ran the gel again correctly shown below, 120V for 50 minutes: pHF10: 1L-1, 4N-2, 2M-3, 3L-4, 2O-5, 1C-6, 4M-7, 4K-8, 1M-9, 2L-10 pLC71: 4A-11, 2E-12, 2A-13, 9E-14, 1C-15, 4P-16, 4D-17 pHF10 positive control-18 pLC71 negative control-19 Confirmed pHF10: 1C, 2L, 4K, 1L, 4N, 3L, 2O

8.8.16 Running gel with PCR products of 7.29.16 Looks good 8.9.16 Performed the gel purification protocol from the lab, including the following changes: Only did 1 membrane wash Did not pre heat the elution buffer Did the final elution with 15uL of the 10mM tris-HCL ph 8.8 Both parts of the gene block will be nanodropped tomorrow to see how high the concentration of DNA is 8.10.16 PCR with minipreped stataclone vector + insert from culture started on 7.29.16 We have 4 samples, 1A, 1B, 2B, 2C Two different annealing temperatures for each sample. 68 & 72 So we will have 8 PCR reactions. For C. Limon 1 Component 50μl reaction Molecular grade H2O Added first. 28 μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL L. synthase forward (10μM) 2.5μL C. Limon 1 or 2 middle primer (10μM) 2.5μL Template DNA 1.0μL Tom’s Phusion DNA polymerase Added last 5uL So we’re going to need (4)(2.5μL) of each primer. In the end we want (10μL)(10μM) so.. dilute(10μL)(10μM) = 10-4μmol = 10-4μmol(1L/25μmol) = 4*10-6L = 4μL stock 4μL stock + 6μL H2O = 10μL(10μM) primers & 8μL of dNTP’s stock 25 mM We want (8μL)(10mM) Dilute (8μL)(10mM) = 8*10-5mmol = 8*10-5mmol (1L/25mmol) = 3.2*10-6L = 3.2μL 3.2μL + 4.8μL H2O = 8μL(10mM) dNTP’s For C. Limon 2 Component 50μl reaction Molecular grade H2O Added first. 32.5μL 5x GC Buffer 10μL 10 mM dNTPs 1.0μL LS p2(10μM) 2.5μL C. Limon 2 Forward (10μM) 2.5μL Template DNA 1.0μL Tom’s Phusion DNA polymerase Added last 5uL So we’re going to need (4)(2.5μL) of each primer. Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 5 min 1 Denaturation 98 10s Extension 68-72 (gradient) 1.5 min 35 Hold 4 hold 8.10.16 -Ran a gel with the completed C.Limon PCR products listed above from 8.9.16, results are shown below: ladder, next three were sharon’s stuff, 1A-68, 1B-68, 2B-68, 2C-68, 1A-72, 1B-72, 2B-72, 2C-72 -Nanodropped C. Sten 1 & 2 gel purification products results are shown below: C. Sten 1 green tube- 9.9 ng/ul, 260/280- 2.07 C. Sten 1 blue tube- 16.2 ng/ul, 260/280-1.92 C. Sten 2 orange tube- 14.1 ng/ul, 260/280-1.84 C. Sten 2 yellow tube- 17.4 ng/ul, 260/280-1.72 8.12.2016 Fluorimetry on C. limon gel purification calibration : 99.76 Concentration(ng/uL) Error 1A-68: 18.9k -1.172 1A-72: 76.58 6.4 1B-68: 53.96 -2.9 1B-72: 33.34 -2.472 2B-68: 27.93 -5.44 2B-72: 69.96 -10.76 2C-68: 76.63 ? 2C-72 : 13.27 -11.73 8.13.16 -We tried infusion cloning with C.sten 1 and 2 g-blocks, these were the ones that were not in the strataclone vector, so after PCR amplification and running a gel to confirm amplification, we attempted to just directly clone both g-blocks into the pLC71 vector We used a 1:1:1 molar ratio for 1st g-block:2nd g-block:pLC71 and the values for each are shown below, keep in mind we had two PCR products for each g-block, so they are separated by eppendorf tube color, in this case we only used C.sten 1 blue and C.sten 2 yellow C.Sten 1 blue: 1.36 uL C. Sten 2 yellow: 1.02uL pLC71:0.88uL, dilution- 2uL pLC71 + 2uL sterile H2O, this way we could use 1.8uL instead of 0.88 which is hard to achieve with a pipette 3.8uL of water We did a negative control that contained everything listed above, except for the infusion mix -After following the Infusion protocol, we followed the Interlab transformation protocol, except we added 2 uL of the plasmid instead of 1uL, also when we plated after the outgrowth period, we use 50uL on one plate, and the rest on another plate, ~200uL

9.2.16 Nanodropping: C. Limon 1B & 2B in the strataclone vector 1B: 361.4 ng/μL 260/280: 1.84 2B: 368.9 ng/μL 260/280: 1.84 PCR: M1V1 = M2V2 V1B = (2μL)(361.4 ng/μL) / (10ng/μL) = 72.28 μL V1B = (2μL)(361.4ng/μL) / (10ng/μL) = 73.78 μL So, to dilute the plasmids to 10 ng/μL.. 1B: 2μL stock + 70.3μL dH2O 1B: 2μL stock + 71.8μL dH2O Primers: 1B: Limonene Forward + C.limon1R 2B: C.limon2F + LSp2 We have 100μM primers, we want 10μM. M1V1 = M2V2 V = (2μL)(100μM) / (10μM) = 20μL So to dilute the primers… 2μL stock + 18μL dH2O Component 50μl reaction MMix (5 rxns) - 41uL Molecular grade H2O Added first. 27.5 μL 137.5µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL Template DNA 10ng/uL 3μL 15µL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 60 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold 9.3.16 PCR failed. New idea; add DSMO (5% volume). Also try raising the annealing temperature. DMSO: We have 100% DMSO from NEB (0.05)(50µL) = 2.5µL DMSO With DMSO: Component 50μl reaction MMix (5 rxns) - 40uL Molecular grade H2O Added first. 27μL 135µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL 100% DMSO 2.5µL 12.5µL Template DNA 10ng/uL 1μL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 65 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold Without: Component 50μl reaction MMix (5 rxns) - 40uL Molecular grade H2O Added first. 27.5 μL 147.5µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL Template DNA 10ng/uL 3μL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 65 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold Brett Burkart, an employee of the Santangelo lab, gave Casey this protocol for purifying PCR products. PB buffer Add 5x the volume of the combined PCR reactions. Combined PCR reactions PB Buffer 177µL 885µL 3M NaOAc pH 5.2 Add 1/100x the volume of the PCR reaction + PB buffer Working Volume 3M NaOAc pH 5.2 1062µL 10µL Spin through column (may take two runs). Discard flow through. Load column with 750µL ethanol, spin. Discard ethanol, spin 2 minutes to dry. Label 1.7mL eppe. Load 25µL 10mM tris HCl pH 8.5 Spin 2 mins. collect in labeled eppe. Load 25µL 10mM tris HCl pH 8.5 Spin 2 mins. collect in same labeled eppe. 9.20.16 Dr. Peebles discovered the there was no overlap between our insert and vector. The infusion cloning could not have worked. New primers Forward: GGC CGC AAA AAA GTC GAA TGC GCG TTG CGG CAG TCG melt temp: 77.7 ºC homologous region: A TGC GCG TTG CGG CAG TCG melt temp: 70.6 ºC Reverse: CAA AAT GCG CGT TGC GGC AGA GCG GCC GCA AAA AAG TCG AC melt temp: 78.4 homologous region: AGCGGCCGCAAAAAAGTCGAC melt temp: 68.3 ºC 9.22.16 Picked up new primers & resuspended. 9.26.16 PCR with new primers, from strataclone vector. Component 50μl reaction MMix (5 rxns) - 41uL Molecular grade H2O Added first. 27.5 μL 137.5µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL Template DNA 10ng/uL 3μL 15µL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 60 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold

Experiments and daily lab notebook

05-16: Transformed pHF10 and pLC71 into TS559

Courtney

5-311: Colonies Alive

Courtney

05-24: Followed spot plate protocol with pHF10

Courtney, Kayla, Frankie, Cooper, Neil

05-29: Transferred colonies to 40 individual 5uL flasks using lab stock ASW media and ASW Additives, Sulfur was not added.

Carlos

5-30: Sulfur Added to cultures to 20 of those cultures

Carlos

5-31: No growth on pHF10(1)

Frankie, Kayla

6-01: Four pHF10(1) cultures survived. Performed a gPrep on these cultures. Made new 25mM lovastatin stock. Used 6-24 pHF10(2) spot plates to make 20 5uL serum bottle cultures via ASW Additives Protocol.

Frankie, Neil, Cooper, Kayla

6-02: Ran a PCR and gel on the gprepped DNA samples from 6-01.

Kayla, Cooper, Frankie, Melissa

6-03:Serum bottles checked at 11:10am

Melissa

6-04: Serum bottles checked at 1:30

Carlos

6-05: Primers for 6-02 gel were wrong, redid gel with 6-01 DNA. Surviving pLC71(2) colonies removed from incubator. Made ASW-yt media. Added additives to 2 100 mL bottles of ASW-yt and inoculated from bottle 2C from pLC71(1).

Robyn, Frankie Kayla, Melissa, Cooper

6-06: Some oxidized sulfur, but not enough in 6-05 strain. Picked colonies from old PLC71 streak plate into 10 5 mL bottles

Kayla, Carlos, Cooper, Neil

6-07: No growth on pLC71

Kayla, Neil, Carlos, Melissa

6-08: Started a 100 mL culture of TS559 for transformation. Made minimal ASW plates.

Frankie, Kayla

6-09: Performed transformation protocol with pLC71 plasmid

Frankie, Kayla

6-14: Made rich ASW plates. Spotted 10 colonies per plate onto the rich ASW media

Kayla, Courtney

6-17: Checked plates, but needed more time

Qianhui, Carlos

6-19: Took 5 5mL serum bottles per plate, and placed in incubator at 11:00 am.

Kayla

6-20: At 2:30, 9 cultures had grown.

Kayla

6-21: Performed a gPREP of 3pLC71 cultures and 1 pHF10 culture. Performed pCR protocol.

Cooper, Carlos, Jake, Robyn, Qianhui, Kayla

6-23: Made a gel and and ran the gPrepped cultures

Kayla, Jack

6-26: Started 2 100 mL bottles from pLC71 cultures, 2 bottles from pHF10(1), and two bottles of TS559.

Courtney, Skylar

6-27: Removed cultures at 7:15 am. Performed sonication protocol. Stored protein lysate in fridge.

Kayla

7-6: Performed a Bradford Assay on protein lysate

Neil, Kayla

7-12: Performed a western blot analysis according to protocol. Blott was not clear, and no reasonable results obtained.

Melissa, Carlos,Neil, Frankie, Robyn, Kayla

7-17: Made ASW media.

Melissa, Kayla

7-19 No grotwth on current cultures, started 3 each serum bottles of pLC71 and 3 each of 4 pHF10 strains

Kayla, Melissa, Frankie

7-25: Performed a Gprep on pLC71 and pHF10 samples

Kayla, Madeline

8-8: Inoculated 3, 100 mL ASW bottles with 1 mL cultures each (1 TS559, 1 pLC71, 1 pHF10)

Neil, Carlos

8-9: No growth. Used a bottle of laboratory stock media and inoculated with 9 pHF10 strains, 10 pLC71 strains.

Kayla

8-10: 11:00 am No growth

Kayla

8-16: Most cultures showed signs of growth.

Kayla

9-14:Inoculated 4, 100 mL bottles of media ( 2 pLC71, 2 pHF10)

Kayla

9-16: Made new ASW media.
Neil, Kayla

8-17: Inoculated 4 100 mL bottles of ASW media with 1 TS559, 2 pHF10, and 1 pLC71.

Kayla

8-19: No growth on cultures. Left in incubator. Made new, smaller cultures using 1 bottle ASW YT media according to protocol (3 bottles pLC71, 12 bottles pHF10)

Kayla

9-26: No growth in any culture.

Kayla

@@ Line 1: / Line 1: @@
 {{Team:CSU_Fort_Collins/CSS}}
 <html>
+<div class="column full_size" >
+<p>6.4.16</p>
+<p>
+We picked E. Coli “Stellar” cells from an LB/amp plate. The cells had been transformed with pLC71.
+We put the cells into test tubes with 5 mL of LB and 5 µL of ampicillin and then put those in the shaker at 37℃ overnight.
+</p>
+<p>Protocol for picking cells from plate to test tube:
+<ul>
+<li>Materials</li>
+<li>Autoclaved test tubes</li>
+<li>100mL LB</li>
+<li>100mg/mL ampicillin</li>
+<li>Test tube rack</li>
+<li>Bunsen Burner </li>
+<li>P10 or P20 pipette</li>
+<li>Latex gloves</li></p>
+<p>Procedure
+<ul>
+<li>Place test tubes into the rack, label, date, initial.</li>
+<li>Light bunsen burner for flame umbrella.</li>
+<li>In each test tube: add 5mL of LB first, then, add 5 µL of AMP. Be sure that your pipette tip is submerged in the LB when adding the AMP.</li>
+<li>Remove lid from LB/AMP plate. Use a pipette tip, gently pick a colony.</li>
+<li>Eject pipet tip into test tube.</li>
+<li>Flame the opening of the tube and recap.</li>
+<li>Incubate tubes in 37℃ for approx. 16 hours. </li>
+</ul>
+</p>
+<p>
+.5.16</p>
+<p>
+We performed plasmid purification according to steps outlined in the S.O.P. in Tom’s lab.
+After purification we had ≈120 µL of plasmid solution.
+Fluorimetry determined the concentration of DNA was 317 ng/µL.
+Plasmid stored in iGEM box in fourth floor “VWR” fridge.
+Now it’s in the 3rd floor fridge (igem limonene box) 8.30.16
+Mini-Prep Protocol (Zymo Research):
+Materials
+<ul>
+<li>P1 buffer</li>
+<li>P2 buffer</li>
+<li>P3 buffer (refrigerated)</li>
+<li>(3) 1.7mL eppes. </li></ul>
+Procedure
+<ol>
+<li>Pour test tube contents (no more than 5mL) into (3) 1.7mL eppes.</li>
+<li>Centrifuge the eppes for 3 minutes at max speed. </li>
+<li>Discard supernatant, pour carefully into waste.</li>
+<li>Centrifuge 1 minute. </li>
+<li>Pipette and discard supernatant.</li>
+<li>Add 200µL P1 buffer to 1st eppe.</li>
+<li>Pipette up and down until the pellet is dissolved.</li>
+<li>Pipette the buffer w/ dissolved pellet into 2nd eppe.</li>
+<li>Pipette up and down until the pellet is dissolved.</li>
+<li>Pipette the buffer w/ dissolved pellets into 3rd eppe.</li>
+<li>Pipette up and down until the pellet is dissolved.</li>
+<li>Eppe’s 1 & 2 should be empty. Discard.</li>
+<li>Add 200µL P2 by shooting in.</li>
+<li>Add to all of your tubes quickly. </li>
+<li>Snap all closed.</li>
+<li>Inversion mix.</li>
+<li>Leave tubes with only P1 & P2 for no more than 5 minutes or DNA will be damaged. Be ready to add P3.</li>
+<li>Add 400µL P3 (refrigerated) </li>
+<li>Inversion mix until no pink remains.</li>
+<li>Let sit for 1-2 minutes</li>
+<li>Centrifuge full speed for 10 minutes.</li>
+<li>Setup plasmid filter columns over large Zymo collection tubes.</li>
+<li>Pipette supernatant into filter column. </li>
+<li>Discard pellet</li>
+<li>Spin column 1 minute.</li>
+<li>Discard flowthrough </li>
+<li>Add 200µL Endo Wash Buffer to filter</li>
+<li>Spin 1 minute</li>
+<li>Discard flowthrough</li>
+<li>Add 400µL Plasmid DNA Wash Buffer</li>
+<li>Spin 1 minute</li>
+<li>Discard flowthrough</li>
+<li>Spin 2 more minutes to dry (very important).</li>
+<li>Move filter to labeled 1.7 mL eppes</li>
+<li>Label</li>
+<li>Add 16µL 10mM Tris HCl pH 8.0 to filter column</li>
+<li>Let sit 2 minutes</li>
+<li>Spin 1 minute</li>
+<li>The flowthrough contains the DNA. Don’t throw it out.</li>
+<li>(Repeat) Add 16µL 10mM Tris HCl pH 8.0 to filter column</li>
+<li>Let sit 2 minutes</li>
+<li>Spin 1 minute</li>
+<li>The flowthrough contains the DNA. Don’t throw it out.</li>
+<li>Throw away filter. Keep flowthrough in labeled eppe. </li></ol>
+</p>
+<p>
+.6.16</p>
+<p>
+µL of plasmid were removed from our stock and digested with SAL1 and CutSmart buffer.
+</p>
+<p>
+.7.16</p>
+<p>We ran a gel purification of our cut plasmid, stained and imaged it on the third floor.
+File name: limonene plasmid 1 2016-06-07</p>
+<p>George cut our plasmid out of the gel (the largest band on the gel).
+Our cut gel weighed 0.48g
+</p>
+<p>We then used a kit to dissolve the gel and purify the plasmid.
+Fluorimetry showed the concentration to be 220 ng/µL
+</p>
+<p>
+.8.16</p>
+<p>First try at Infusion cloning.
+<ol>
+<li>35 µL Stellar E.coli  and 2.5 µL of post infusion pLC71</li>
+<li>Cells plated and left to incubate around noon.</li>
+<li>gene block: 100ng (μL/25ng) = 4μL</li>
+<li>pLC71: 100 ng (μL/220ng) = 0.45μL</li>
+<li>In-Fusion pre-mix: 2μL</li>
+<li>Distilled water: 3.55μL</li>
+<li>50°C for 15 minutes</li>
+</p>
+<p>
+.9.16</p>
+<p>
+Took transformed cells out of 4th floor incubator at 11:00 AM. No growth on either plate.
+<p>Re-transforming with the same infusion mix that we made yesterday
+<ol><li>Stellar cells - 1501846A</li>
+<li>Cell & DNA mixed at 12:08 </li>
+<li>The cells were kept on an ice/water miss the whole time. The tubes where cells & DNA were mixed were also on ice before the mix.</li>
+<li>The infusion mix was stored in the eppe block for about 5 minutes.</li>
+<li>LB/amp plates by RZ 5/20/16</li>
+<li>Heat shock at 12:34 at 44 celsius for 45s then directly back on ice.</li>
+<li>Plated at 12:40</li>
+<li>Incubate 4th floor 49°C at 12:47</li></ol>
+</p>
+<p>
+.10.16</p>
+<ol><li>Took stellar cells transformed w/ infusion mix out of the incubator at 11:40</li>
+No growth, only bubbles.</li>
+Second try at infusion mix</li>
+Everything on ice for 10 minutes</li>
+Diluted plasmid w/ distilled water from sink.</li></ol>
+<ul><li>0.9uL 220ng/uL + 1.1uL dH2O</li></ul>
+Transformation:
+<ol>
+<li>E. Coli was pulled out of the freezer at 1:50.</li>
+<li>1:55, infusion mix was put in heat block w/ water at 50°C</li>
+<li>Infusion mix was then put on ice and then mixed with E. Coli 2 minutes later.</li>
+<li>We also transformed the same cells with a control of cut pLC71</li>
+<li>Incubate all 3 tubes on ice for 30 minutes</li>
+<li>Heat shock at 43°C for 45s</li>
+<li>Plated after a 5 minutes back on ice (2:45)</li>
+<li>LB/amp plates - AS 5/26/16</li>
+<li>Incubated on 4th floor at 37°C overnight</li></ol></p>
+<p>
+.11.16
+No growth on any plates except for 2 colonies on the control (disgested pLC71)
+</p>
+<p>
+.21.16</p>
+<p>Resuspending primers</p>
+<ol><li>Uncap LS p1, p1000 to add 292 μL distilled autoclaved H2O.</li>
+<li>A little bit of water would fall out of the pipet tip. Tip was not full. Still, only a very small amount missing.</li>
+<li>Recap.</li>
+<p/>
+<div class="column full_size" >
+<p>7.7.2016</p>
+<p>These are the sequences for the two C. Limon gene blocks that are being used for our current experiments:
+Blue/White screening allowed colonies with the gene block to be isolated
+From the first plate with the C. Limon gene block 1, 3 colonies were picked and the miniprep protocol from the lab was followed, these samples are listed as 1A, 1B, 1C from here on out.  The same goes for the second C. Limon gene, except one of the culture tubes was broken so there are only two samples 2B and 2C.
+Nano Dropped each of the following samples to determine the DNA concentration: 1A, 1B, 1C, 2B, 2C. Also, performed digestion on the concentrated plasmid using the NEB protocol with adjusted amounts of each material
+The nanodrop results are listed below:
+A: 325.5 ng/uL
+B: 325.9 ng/uL
+C: 381.6 ng/uL
+B: 243.9 ng/uL
+C: 332.7 ng/uL
+The 260/280 ratio for each measurement was around 1.83, which means that the DNA is pretty pure.
+After nano dropping each of the plasmids we used the following measurements for the digestion protocol:
+For amount of DNA:
+A: 3.1uL
+B:2.1 uL
+C: 2.6 uL
+B: 4.1uL
+C: 3.0uL
+X Cutsmart:
+uL, making it 1X concentration
+EcoR1:
+uL
+Sterile DI Water:
+A: 40.9uL
+B: 40.9 uL
+C: 41.4 uL
+B: 39.9uL
+C: 41.0 uL
+All of the reaction volumes came out to 50uL and were placed in the thermocycler following this program: 37°C for 1 hour and 30 minutes, then it is going to be heat inactivated at 65°C for 30 minutes, then held at 4°C until tomorrow
+.10.16
+Took digested plasmid from 7.8.16 and ran it through a gel with 1kb+ ladder to confirm that the plasmid had been cut in the correct place. Results are shown below, the order of the wells are: LADDER, 1A, 1B, 2A, 2B, 2C.
+There seem to be bands at around 4,000 base pairs, which matches up with the StrataClone Blunt PCR Cloning Vector pSC-B-amp/kan containing 4.3 kb
+There are also bands around 1298 for 1B only, which is the correct number of bp’s for C.Limon 1, and there are also two bands for 2B and 2C at around 817 base pairs, confirming that the gene blocks were cut a out of the Strataclone vector at the correct spot
+.12.16
+Primers were ordered from IDT today, there are corresponding colors that can be matched with the genes listed above, also we went ahead and ordered the primers for the two C. Sten gene blocks listed below
+Limonene Synthase Forward Primer (6.20.16)
+’- ATGCGCGTTGCGGCAGTCGACCGGCAAAAGG-3’ ( GC%= 64.5%, Tm=77.8°C, length:31 bp )
+Limonene Synthase Reverse Primer (6.20.16)
+’- GATTTTTTTTGTCGACTTTTTTGCGGCCGCT -3’
+’- AGCGGCCGCAAAAAAGTCGACAAAAAAAATC-5’(GC%=41.9%, Tm=70.2°C, length:31bp)
+C.Limon 1-Reverse Primer
+’- GATCTTCACCGACGCCGTCGAGAGGTGGG -3’
+’-CCCACCTCTCGACGGCGTCGGTGAAGATC-5’ (GC%=65.5%, Tm=73.8°C, length: 29 bp)
+C.Limon 2-Forward Primer
+’-CCGTCGAGAGGTGGGACATAAACTACGCCC-3’ (GC%=60%, Tm=72.2°C, length:30 bp)
+C. Sten 1- Reverse Primer
+’-GATGGTGGAGGAATACCTGGTTCGTCGAGAA -3’
+’-TTCTCGACGAACCAGGTATTCCTCCACCATC-5’ (GC%=51.6%, Tm=70.6°C, length:31bp)
+C.Sten 2- Forward Primer
+’-GGGCATGGTCCCAAGAAGGCAGCAC-3’ (GC%=64%, Tm=72.1°C, length: 25bp)
+C.Sten gene block 1  (1198 bp)
+ATGCGCGTTGCGGCAGTCGACCGGCAAAAGGCGAATTATGTGTAGGCATTAGGTTAAGCCTTCTTTTCATTTTTACGGCAATCAGCGAGCTTTTTTTGGCCGCTGAAAGGGTCTGAAAGCGAAAAGTATTTAAACCCCAAGTGGCCAGATAGGTATGACAACACTTAGTAGGGGCTAAAGCCCCAACAACCCAAGGAGGTGTTGTATGGCCCTCAAGATGACCAGCGCCGTCATGCAGATGGCGATACCGACCAAGCTCGCCAACTTCGTCAACAATAGCGACACCCACAAGCAAAGCCTGAAACTCCTGAGGAACGTTTCCACGATAAGCACCTCCGCGGCCGCGGCCACGCCGAGGCATAGACTCCCAGTCTGCTGCAGCGCGTCCAGCTCCAGCTCCAGCCAGCTGCCGACbCATAGAGAGGAGATCCGGCAATTACAAGCCAAGCAGGTGGGACGTTGATTTCATGCAATCCCTCAACAGCGACTACCAGGAGGAAAGACACAGGACGAAAGCCTCCGAGCTGATAACCCAAGTCAAGAATCTCCTGGAAAAAGAGACGAGCGATGACCCGATAAGACAGCTCGAACTGATCGATGACCTCCAAAGGCTGGGCCTCTCCGATCATTTCGAGCACGAATTTAAGGAGGTTCTGAACAGCATATACCTCGACAATAAATATTACAACATCAATATAATGAAGGAAACCACGTCCAGCAGAGATCTGTATTCCACCGCGCTCGCCTTCAGGCTGCTCAGAGAGCATGGCTTCCAGGTCGCGCAAGAAGTTTTTGACTGCTTCAAAAACGAGGAAGGCGAGTTTAAGGCCAGCCTGTCCGATGACCCAAGGGGCCTCCTGCAGCTCTACGAAGCGAGCTTCCTGTTTAAAGAGGGCGAAAATACGCTCGAGATCGCCAGAGAATTCGCGACCAAGCTGCTCCAAGAGAAAGTCAACTCCAGCGATGAAATAGACGATAATCTGCTCTCCAGCATCAGGTATTCCCTGGAGATACCGACGTACTGGAGCGTTATCAGACCAAACGTCTCCGTTTGGATAGACGCCTATAGGAAGAGACCGGATATGAATCCAGTCGTTCTCGAACTGGCGATCCTCGACGCCAACATAATGCAGGCGCAACTGCAGCAAGAGCTCAAAGAAGCCCTGGGATGGTGGAGGAATACCTGGTTCGTCGAGAA
+C.Sten gene block 2  (897)
+GGGCATGGTCCCAAGAAGGCAGCACAAAACCGCCAGACAACTCATGGCGAAGGTTATCGCCCTGATAACGGTCATGGACGATATCTATGACGTTTACGGAACCCTCGAGGAACTGGAGCTCTTCACGGATGCGTTTAGGAGATGGGACGTCAGCTCCATAGATCATCTGCCGACCTATATGCAGCTCTGCTTCCTGAGCATCAACAATTTTGTTGTTGACACGGCCTACAACATACTCAAAGAAACCGGCGTTAATGTCACGACCTATCTGGAGAAGTCCTGGGTTGATCAAGCGGAAAACTACCTCATGGAGAGCAAATGGTTCTACTCCGGACACAAGCCAAGCCTGGACGAATATCTCGAGAATTCCTGGATCAGCGTCTCCGGCCCGTGCGTTCTGACGCATGAATTCTTTGGAGTCACCGATAGCCTCGCCAAAGACACGCTGGATTCCCTCTACGAGTATCACGACATAGTTAGGTGGAGCTCCTACCTGCTCAGACTGGCGGATGACCTCGGCACCAGCGTCGAAGAGGTTTCCAGGGGAGATGTCCCAAAGAGCATCCAGTGCTATATGAACGACAATAACGCCTCCGAAGAGGAAGCGAGAGAGCATGTTAAAGGCCTGATAAGGGTCATGTGGAAGAAAATGAATGCCGAAAGAGTTAGCGAGGATTCCCCGTTCTGCAAGGACTTTATCAGGTGCTGCGAAGATCTCGGAAGAATGGCGCAATTCATGTACCACTATGGCGACGGACACGGCACGCAGCATGCCAAAATACACCAACAGATCACCGATTGCCTGTTCCAACCATTTGCCTACCCATACGACGTTCCGGACTACGCACACCATCACCATCACCATTGATTTTTTTTGTCGACTTTTTTGCGGCCGCT
+C. Limon gene block 1(A,B,C), bp=1298
+ATGCGCGTTGCGGCAGTCGACCGGCAAAAGGCGAATTATGTGTAGGCATTAGGTTAAGCCTTCTTTTCATTTTTACGGCAATCAGCGAGCTTTTTTTGGCCGCTGAAAGGGTCTGAAAGCGAAAAGTATTTAAACCCCAAGTGGCCAGATAGGTATGACAACACTTAGTAGGGGCTAAAGCCCCAACAACCCAAGGAGGTGTTGTATGAGCAGCTGCATAAACCCGAGCACCCTCGTCACCAGCGTCAACGCCTTCAAGTGCCTCCCGCTCGCCACCAACAAGGCCGCCATAAGGATAATGGCCAAGTACAAGCCGGTCCAGTGCCTCATAAGCGCCAAGTACGACAACCTCACCGTCGACAGGAGGAGCGCCAACTACCAGCCGAGCATATGGGACCACGACTTCCTCCAGAGCCTCAACAGCAACTACACCGACGAGGCCTACAAGAGGAGGGCCGAGGAGCTCAGGGGCAAGGTCAAGATAGCCATAAAGGACGTCATAGAGCCGCTCGACCAGCTCGAGCTCATAGACAACCTCCAGAGGCTCGGCCTCGCCCACAGGTTCGAGACCGAGATAAGGAACATCCTCAACAATATATACAACAATAACAAGGACTACAACTGGAGGAAGGAGAATCTCTATGCCACCAGCCTGGAGTTCAGGCTCCTGAGGCAGCACGGCTACCCGGTCAGCCAGGAGGTTTTCAACGGCTTCAAGGACGATCAGGGCGGATTCATATGCGACGATTTCAAGGGCATACTCAGCCTGCACGAGGCCAGCTACTATTCCCTCGAGGGCGAAAGCATAATGGAGGAAGCCTGGCAGTTCACCAGCAAGCACCTCAAAGAGGTCATGATAAGCAAGAACATGGAGGAAGACGTTTTCGTCGCCGAGCAGGCGAAGAGGGCCCTCGAGCTGCCGCTCCACTGGAAGGTCCCGATGCTCGAGGCCAGGTGGTTCATACACATCTACGAGAGGCGCGAAGACAAGAACCACCTCCTGCTCGAGCTGGCCAAAATGGAGTTCAACACCCTCCAGGCGATATACCAGGAGGAACTCAAGGAGATCAGCGGCTGGTGGAAAGACACCGGCCTGGGAGAGAAGCTCAGCTTCGCCAGGAACCGCCTCGTCGCGAGCTTCCTGTGGTCCATGGGCATAGCCTTCGAGCCGCAGTTCGCGTACTGCAGGCGCGTCCTCACCATAAGCATCGCCCTGATAACCGTTATCGACGATATATACGACGTCTATGGCACCCTCGACGAGCTGGAGATCTTCACCGACGCCGTCGAGAGGTGGG
+C. Limon gene block 2(B,C), bp=817
+CCGTCGAGAGGTGGGACATAAACTACGCCCTCAAGCACCTGCCGGGCTACATGAAGATGTGCTTCCTCGCGCTGTACAACTTCGTCAATGAGTTCGCCTACTATGTTCTCAAGCAGCAAGACTTCGATCTGCTCCTGAGCATAAAGAACGCCTGGCTCGGCCTGATACAGGCGTACCTCGTCGAGGCCAAGTGGTACCACAGCAAATACACCCCGAAGCTCGAGGAATATCTCGAGAACGGCCTCGTCAGCATAACCGGCCCGCTCATAATCACCATAAGCTACCTGTCCGGCACCAACCCGATAATCAAGAAAGAGCTCGAGTTCCTGGAAAGCAACCCGGACATAGTCCACTGGAGCTCCAAGATATTCAGGCTCCAGGACGACCTCGGCACCAGCAGCGACGAGATACAGAGGGGCGACGTCCCGAAGAGCATACAGTGCTACATGCACGAGACCGGCGCCAGCGAGGAGGTCGCCAGGCAGCACATAAAGGACATGATGAGGCAGATGTGGAAGAAGGTCAACGCCTACACCGCCGACAAGGACAGCCCGCTCACCGGCACCACCACCGAGTTCCTCCTCAACCTCGTCAGGATGAGCCACTTCATGTACCTCCACGGCGACGGCCACGGCGTCCAGAACCAGGAGACCATAGACGTCGGCTTCACCCTCCTCTTCCAGCCGATACCGCTCGAGGACAAGCACATGGCCTTCACCGCCAGCCCGGGCACCAAGGGCTACCCATACGACGTTCCGGACTACGCACACCATCACCATCACCATTGATTTTTTTTGTCGACTTTTTTGCGGCCGCT
+.14.16
+Performed mini-prep on the prepared cultures from the white colonies on blunt cloning plate for: 1B, 2B, 2C (all of the plasmids that had bands on the gel)
+Received all four primers today and resuspended each so that the concentration was 100uM
+We are going to perform PCR with the phusion enzyme to amplify the C. Sten g-blocks before we try Blunt Cloning
+For all four of the primers, we created a 10uM concentration by diluting 1ul of primer with 9ul of sterile diH2O
+Component
+μl reaction
+Molecular grade H2O
+Added first. 32.5μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+L. Synthase forward (10μM)
+.5μL
+C. Sten 1 - Reverse (10μM)
+.5μL
+C. Sten g-block 1
+.0μL
+Tom’s Phusion DNA polymerase
+Added last. 0.5μL
+Component
+μl reaction
+Molecular grade H2O
+Added first. 32.5μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+L. synthase reverse (10μM)
+.5μL
+Sten 2 - Forward (10μM)
+.5μL
+Template DNA
+.0μL
+Tom’s Phusion DNA polymerase
+Added last. 0.5μL
+Ran the PCR reaction in the with Thermocycler Program as follows, for both of the C.Sten g-blocks, FROM NOW ON WE NEED TO USE EPPENDORF TEST FOLDER MAKE SURE TO LOG IN:
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+s
+Annealing
+s
+Extension
+s
+Final Extension
+min
+Hold
+hold
+.15.16
+Sent in mini-prepped tubes containing Blunt cloning plasmid and C. Limon g-blocks  to quintarabio for sequencing results using the T3 and T7 primers that correspond with the blunt cloning kit primer binding sites, the concentrations for each of the g-blocks is listed below
+B-264.0ng/ml, 260/280-1.75
+B-338.0ng/ml, 260/280-1.78
+C-304.5ng/ml, 260/280-1.70
+Ran the gel from the PCR performed on C. Sten 7.14.16 to see if the g-block was successfully amplified, results are shown below following this key: ladder, C. Sten 1, C. Sten 2, we are expecting 1198 bp’s for C.Sten 1, and 897 bp’s for C.Sten 2
+It seems like the C. Sten 1 was unsuccessful, so we will instead perform a two step PCR corresponding to the table below, with adjusted temperatures and extension time, also we will use more of the Phusion enzyme, since it is not commercial grade
+C. Sten 2 seems to have bands at around 897 base pairs, which is the correct number, but there also seems to be some other bands, so we will run another gel on 7.16.16 with the C.Sten 1 Two-step PCR product and also, the 41ul of the rest of the C.Sten PCR product from 7.14.16, then we will cut it from the gel and purify it if there are bands at around 1198 base pairs (did not do this)
+C. Sten 1, 2-step PCR
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+s
+Extension
+.5 min
+Hold
+hold
+Component
+μl reaction
+Molecular grade H2O
+Added first. 32.5μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+L. synthase reverse (10μM)
+.5μL
+C. Sten 2 - Forward (10μM)
+.5μL
+Template DNA
+.0μL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+.16.16
+Performed PCR on C. Sten 1 again, since gel did not have correct band
+Ran a gel with the 41ul of the rest of PCR product from C.Sten 2 and ran PCR product from today, ladder, 6 wells filled with C.Sten 1, 41ul of C.Sten 2 in last well
+It was a failure so we are going to reorder the limonene synthase forward primer, because the melting temp. was so high (77.8°C)
+This is the new primer we ordered:
+ATG CGC GTT GCG GCA GTC GAC (GC=66.7%, melting temp=71.3°C, bp=21)
+We will perform the two-step PCR again with both gene blocks, once the new forward primer arrives
+.19.16
+Results from quintarabio for 1B, 2B, 2C were received today, results are as follows:
+B non conclusive, T3 and T7 sequences did not align
+B seemed to have worked, picture of aligned sequences is shown below
+C had some alignment, but a few couple of mismatched base pairs that proved to have non silent mutations when put into the Expasy program
+I aligned the second part of the g-block with a spliced sequence I created from the T3 sequence and the RC of the T7 sequence, this is the spliced sequence I used, the yellow highlighted area was the sequence chosen that splits the two gene blocks apart:
+Strataclone T3 sequence through PCR product,green is T3 primer binding site  yellow is discrepancy in the spliced gene and the starting sequence in the strataclone vector
+CAATTAACCCTCACTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCCACTGTGGAATTCGCCCTT
+Strataclone PCR product through T7 Primer binding site, green is T7 primer binding site, the sequence still has two EcoRI cut sites
+AAGGGCGAATTCCACATTGGTCGCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCACCGCGGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTAC
+GGCATACTGGTACCGGGCCCCCCCTCGAGTCGACGGTATCGATAAGCTTGATATCCCTGTGGAATTCGCCCTTCCGTCGAGAGGTGGGACATAAACTACGCCCTCAAGCACCTGCCGGGCTACATGAAGATGTGCTTCCTCGCGCTGTACAACTTCGTCAATGAGTTCGCCTACTATGTTCTCAAGCAGCAAGACTTCGATCTGCTCCTGAGCATAAAGAACGCCTGGCTCGGCCTGATACAGGCGTACCTCGTCGAGGCCAAGTGGTACCACAGCAAATACACCCCGAAGCTCGAGGAATATCTCGAGAACGGCCTCGTCAGCATAACCGGCCCGCTCATAATCACCATAAGCTACCTGTCCGGCACCAACCCGATAATCAAGAAAGAGCTCGAGTTCCTGGAAAGCAACCCGGACATAGTCCACTGGAGCTCCAAGATATTCAGGCTCCAGGACGACCTCGGCACCAGCAGCGACGAGATACAGAGGGGCGACGTCCCGAAGAGCATACAGTGCTACATGCACGAGACCGGCGCCAGCGAGGAGGTCGCCAGGCAGCACATAAAGGACATGATGAGGCAGATGTGGAAGAAGGTCAACGCCTACACCGCCGACAAGGACAGCCCGCTCACCGGCACCACCACCGAGTTCCTCCTCAACCTCGTCAGGATGAGCCACTTCATGTACCTCCACGGCGACGGCCACGGCGTCCAGAACCAGGAGACCATAGACGTCGGCTTCACCCTCCTCTTCCAGCCGATACCGCTCGAGGACAAGCACATGGCCTTCACCGCCAGCCCGGGCACCAAGGGCTACCCATACGACGTTCCGGACTACGCACACCATCACCATCACCATTGATTTTTTTTGTCGACTTTTTTGCGGCCGCTAAGGGCGAATTCCACATTGGTCGCTGCAGCCCGGGGGATCCACTGTCTAGAGCGGCCGCACGCGAGTACAAGCC
+This is a picture of the alignment of the actual gene block sequence and this spliced sequence listed above, the top is the spliced sequence, the bottom is the g-block:
+.20.16
+Casey & Alec miniprep cultures from 7/19 streak plate. Cells from strataclone kit w/ limon inserts, these samples were sent for sequencing today
+gBlock 1 (limon)
+samples A & B
+gBlock 2 (limon)
+samples A & B
+Fluorimetry to gather concentrations for sequencing
+A,Forgot to read error…-193.1 ng/uL
+B, Error: -7, 226 ng/uL
+B, Error: -10, 225 ng/uL
+A, Error: -2, 178.2 ng/uL
+.21.16
+-Sequencing results came in for miniprep done on 7.20 and I am thinking that the first gene block was inserted in a reverse orientation into the plasmid, below is a picture of the 1B spliced seq aligned with the C. Limon 1st part of the gene block:
+Now here is a picture of the g-block aligned with the reverse complement of the spliced 1B seq from 7/20:
+Same exact thing happened to the sequencing results from 7/15 for 1B, below is the C.Limon first part of the g-block aligned with the RC of the 1A spliced seq:
+.21.16
+PCR with sten 1 & 2
+This time, using the new forward primer.
+Casey, Rusu, & Courtney prepared the reaction starting at 2:00 PM.
+Casey - I came back to the lab later to run a gel and I realized we made a few mistakes..
+Did not dilute the primers..
+Did not add water to sten 2.. We only had 20 uL in the tube.. (this one is pretty bad you guys)
+Casey - 7:00 PM I’m re-doing the PCR.
+Component
+μl reaction
+Molecular grade H2O
+Added first. 32.5μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+L. Synthase forward (10μM) (NEW)
+.5μL
+C. Sten 1 - Reverse (10μM)
+.5μL
+C. Sten g-block 1
+.0μL
+Tom’s Phusion DNA polymerase
+Added last. 0.5μL
+Component
+μl reaction
+Molecular grade H2O
+Added first. 32.5μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+L. synthase reverse (10μM)
+.5μL
+Sten 2 - Forward (10μM)
+.5μL
+Template DNA
+.0μL
+Tom’s Phusion DNA polymerase
+Added last. 0.5μL
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+s
+Annealing
+s
+Extension
+min
+Hold
+hold
+I’m thinking we should nanodrop to check for amplification instead of running a gel as we can save more of our sample if the result is good. Also, the gel won’t tell us a concentration, and we already know the gene block is in the reaction mix. We need to check the concentration of DNA.
+After confirming that the gene blocks have been amplified, we should try the PCR assembly protocol or infusion cloning. We need to put the gene blocks together.
+After that, we can run a gel.
+bands around 1000bp = we suck
+band around 2000 = we’re awesome
+.22.16
+Nanodrop (both gave error warnings)
+gBlock 1
+ng/uL
+ng/uL
+gBlock 2
+ng/uL
+Running gel
+Poured last night
+volts
+Set 45 min
+Well 1 = C.sten 1 PCR product
+Well 2 = C.sten 2 PCR product
+.24.16
+Re-did the PCR on C.Sten 1 and 2 using this mixture protocol:
+I had to dilute all four of the primers, 1:10 and I also dilute the 25mM dntps to 10mM 2:5
+Component
+μl reaction
+Molecular grade H2O
+Added first. 32.5μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+L. synthase reverse/forward(10μM)
+.5μL
+C. Sten 2 - Forward/reverse (10μM)
+.5μL
+Template DNA
+.0μL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+s
+Extension
+-72 (gradient)
+.5 min
+Hold
+hold
+.25.16
+Ran a gel with the PCR products from 7.24, pic is shown below
+A and 2B off of Madeline’s master plate, ladder c.sten 1 and c.sten 2
+Confirmed with Sharon that the orientation of the gene block in the strataclone vector does not matter, so in this case, we can move forward with experimentation with the first gene block (miniprep, phusion PCR)
+.29.16
+-Redid the PCR with a 66-70°C gradient, and started a culture with 1A and 2B from madeline’s master plate
+-Diluted the 4 C. sten primers to 10mM and dNTPs to 10mM
+-Fixed gradient to do PCR with C. sten 1 and 2 TM + 3 and -3 (4 total)
+C. Sten 1
+Component
+μl reaction
+dH2O
+Added first. 28μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+L. Synthase forward (10μM)
+.5μL
+C. Sten 1 - Reverse (10μM)
+.5μL
+C. Sten g-block 1
+.0μL
+Tom’s Phusion DNA polymerase (D)
+Added last. 5μL
+C. Sten 2
+Component
+μl reaction
+dH2O
+Added first. 28μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+C. Sten 2 forward (10μM)
+.5μL
+LS p2 (10μM)
+.5μL
+C. Sten g-block 2
+.0μL
+Tom’s Phusion DNA polymerase (D)
+Added last. 5μL
+Thermocycler setup:
+Cycle step
+Phusion
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+s
+Denaturation
+s
+Annealing
+TM+/- 3
+s
+Extension
+Hold
+min
+∞
+TM for C. Sten 1
+Limonene Synthase forward primer - 77.8°C
+C. Sten 1 Reverse- 70.6°C
+TM for C. Sten 2
+C. Sten 2 Forward- 72.1°C
+LS p2- 70.2°C
+C. Sten 1 -/+ 3°C
+LSF- 74.8/80.8°C
+C.Sten 1 R- 67.6/73.6°C
+C. Sten 2 -/+3°C
+C. Sten 2 F- 69.1/75.1°C°C
+LS p2- 67.2/73.2
+Placement in Thermocycler column #:
+CS2 (-3) = 2        CS2 (+3) = 10
+CS1 (-3) = 3        CS1 (+3) = 11
+.8.16
+Running gel with PCR products of 7.29.16
+Looks good
+.9.16
+Performed the gel purification protocol from the lab, including the following changes:
+Only did 1 membrane wash
+Did not pre heat the elution buffer
+Did the final elution with 15uL of the 10mM tris-HCL ph 8.8
+Both parts of the gene block will be nanodropped tomorrow to see how high the concentration of DNA is
+.10.16
+PCR with minipreped stataclone vector + insert from culture started on 7.29.16
+We have 4 samples, 1A, 1B, 2B, 2C
+Two different annealing temperatures for each sample. 68 & 72
+So we will have 8 PCR reactions.
+For C. Limon 1
+Component
+μl reaction
+Molecular grade H2O
+Added first. 28 μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+L. synthase forward (10μM)
+.5μL
+C. Limon 1 or 2 middle primer (10μM)
+.5μL
+Template DNA
+.0μL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+So we’re going to need (4)(2.5μL) of each primer.
+In the end we want (10μL)(10μM) so..
+ dilute(10μL)(10μM) = 10-4μmol = 10-4μmol(1L/25μmol) = 4*10-6L = 4μL stock
+μL stock + 6μL H2O = 10μL(10μM) primers
+& 8μL of dNTP’s stock 25 mM
+We want (8μL)(10mM)
+Dilute (8μL)(10mM) = 8*10-5mmol =  8*10-5mmol (1L/25mmol) = 3.2*10-6L = 3.2μL
+.2μL + 4.8μL H2O = 8μL(10mM) dNTP’s
+For C. Limon 2
+Component
+μl reaction
+Molecular grade H2O
+Added first. 32.5μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+LS p2(10μM)
+.5μL
+C. Limon 2 Forward (10μM)
+.5μL
+Template DNA
+.0μL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+So we’re going to need (4)(2.5μL) of each primer.
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+s
+Extension
+-72 (gradient)
+.5 min
+Hold
+hold
+.10.16
+-Ran a gel with the completed C.Limon PCR products listed above from 8.9.16, results are shown below: ladder, next three were sharon’s stuff, 1A-68, 1B-68, 2B-68, 2C-68, 1A-72, 1B-72, 2B-72, 2C-72
+-Nanodropped C. Sten 1 & 2 gel purification products results are shown below:
+C. Sten 1 green tube- 9.9 ng/ul, 260/280- 2.07
+C. Sten 1 blue tube- 16.2 ng/ul, 260/280-1.92
+C. Sten 2 orange tube- 14.1 ng/ul, 260/280-1.84
+C. Sten 2 yellow tube- 17.4 ng/ul, 260/280-1.72
+.12.2016
+Fluorimetry on C. limon gel purification
+calibration : 99.76
+	Concentration(ng/uL)		Error
+A-68: 18.9k				-1.172
+A-72: 76.58				6.4
+B-68: 53.96				-2.9
+B-72: 33.34				-2.472
+B-68: 27.93				-5.44
+B-72: 69.96				-10.76
+C-68: 76.63				?
+C-72 : 13.27				-11.73
+.13.16
+-We tried infusion cloning with C.sten 1 and 2 g-blocks, these were the ones that were not in the strataclone vector, so after PCR amplification and running a gel to confirm amplification, we attempted to just directly clone both g-blocks into the pLC71 vector
+We used a 1:1:1 molar ratio for 1st g-block:2nd g-block:pLC71 and the values for each are shown below, keep in mind we had two PCR products for each g-block, so they are separated by eppendorf tube color, in this case we only used C.sten 1 blue and C.sten 2 yellow
+C.Sten 1 blue: 1.36 uL
+C. Sten 2 yellow: 1.02uL
+pLC71:0.88uL, dilution- 2uL pLC71 + 2uL sterile H2O, this way we could use 1.8uL instead of 0.88 which is hard to achieve with a pipette
+.8uL of water
+We did a negative control that contained everything listed above, except for the infusion mix
+-After following the Infusion protocol, we followed the Interlab transformation protocol, except we added 2 uL of the plasmid instead of 1uL, also when we plated after the outgrowth period, we use 50uL on one plate, and the rest on another plate, ~200uL
+.2.16
+Nanodropping: C. Limon 1B & 2B in the strataclone vector
+B: 361.4 ng/μL	260/280: 1.84
+B: 368.9 ng/μL	260/280: 1.84
+PCR:
+M1V1 = M2V2
+V1B = (2μL)(361.4 ng/μL) / (10ng/μL) = 72.28 μL
+V1B = (2μL)(361.4ng/μL) / (10ng/μL) = 73.78 μL
+So, to dilute the plasmids to 10 ng/μL..
+B: 2μL stock + 70.3μL dH2O
+B: 2μL stock + 71.8μL dH2O
+Primers:
+B: Limonene Forward + C.limon1R
+B: C.limon2F + LSp2
+We have 100μM primers, we want 10μM.
+M1V1 = M2V2
+V = (2μL)(100μM) / (10μM) = 20μL
+So to dilute the primers…
+μL stock + 18μL dH2O
+Component
+μl reaction
+MMix (5 rxns) - 41uL
+Molecular grade H2O
+Added first. 27.5 μL
+.5µL
+x GC Buffer
+μL
+µL
+mM dNTPs
+.5μL
+.5µL
+Primer 1(10μM)
+μL
+Primer 2 (10μM)
+μL
+Template DNA 10ng/uL
+μL
+µL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+Anneal
+s
+s
+Extension
+min
+Final Extension
+Hold
+hold
+.3.16
+PCR failed. New idea; add DSMO (5% volume). Also try raising the annealing temperature.
+DMSO:
+We have 100% DMSO from NEB
+(0.05)(50µL) = 2.5µL DMSO
+With DMSO:
+Component
+μl reaction
+MMix (5 rxns) - 40uL
+Molecular grade H2O
+Added first. 27μL
+µL
+x GC Buffer
+μL
+µL
+mM dNTPs
+.5μL
+.5µL
+Primer 1(10μM)
+μL
+Primer 2 (10μM)
+μL
+% DMSO
+.5µL
+.5µL
+Template DNA 10ng/uL
+μL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+Anneal
+s
+s
+Extension
+min
+Final Extension
+Hold
+hold
+Without:
+Component
+μl reaction
+MMix (5 rxns) - 40uL
+Molecular grade H2O
+Added first. 27.5 μL
+.5µL
+x GC Buffer
+μL
+µL
+mM dNTPs
+.5μL
+.5µL
+Primer 1(10μM)
+μL
+Primer 2 (10μM)
+μL
+Template DNA 10ng/uL
+μL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+Anneal
+s
+s
+Extension
+min
+Final Extension
+Hold
+hold
+Brett Burkart, an employee of the Santangelo lab, gave Casey this protocol for purifying PCR products.
+PB buffer
+Add 5x the volume of the combined PCR reactions.
+Combined PCR reactions
+PB Buffer
+µL
+µL
+M NaOAc pH 5.2
+Add 1/100x the volume of the PCR reaction + PB buffer
+Working Volume
+M NaOAc pH 5.2
+µL
+µL
+Spin through column (may take two runs).
+Discard flow through.
+Load column with 750µL ethanol, spin.
+Discard ethanol, spin 2 minutes to dry.
+Label 1.7mL eppe.
+Load 25µL 10mM tris HCl pH 8.5
+Spin 2 mins. collect in labeled eppe.
+Load 25µL 10mM tris HCl pH 8.5
+Spin 2 mins. collect in same labeled eppe.
+.20.16
+Dr. Peebles discovered the there was no overlap between our insert and vector. The infusion cloning could not have worked.
+New primers
+Forward:
+GGC CGC AAA AAA GTC GAA TGC GCG TTG CGG CAG TCG
+melt temp: 77.7 ºC
+homologous region:
+A TGC GCG TTG CGG CAG TCG
+melt temp: 70.6 ºC
+Reverse:
+CAA AAT GCG CGT TGC GGC AGA GCG GCC GCA AAA AAG TCG AC
+melt temp: 78.4
+homologous region:
+AGCGGCCGCAAAAAAGTCGAC
+melt temp: 68.3 ºC
+.22.16
+Picked up new primers & resuspended.
+.26.16
+PCR with new primers, from strataclone vector.
+Component
+μl reaction
+MMix (5 rxns) - 41uL
+Molecular grade H2O
+Added first. 27.5 μL
+.5µL
+x GC Buffer
+μL
+µL
+mM dNTPs
+.5μL
+.5µL
+Primer 1(10μM)
+μL
+Primer 2 (10μM)
+μL
+Template DNA 10ng/uL
+μL
+µL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+Anneal
+s
+s
+Extension
+min
+Final Extension
+Hold
+hold
+.25.17
+Did a gDNA prep with non-confirmed strains:
+pHF10: 1L, 4N, 2M, 3L, 2O, 1C, 4M, 4K, 1M, 2L
+pLC71: 4E, 2E, 2A, 9E, 1C, 4P, 4D
+Positive control: pHF10 3S
+Negative control: pLC71
+.26.17
+Performed PCR:
+Made a master mix with the following reagents
+.8 ul forward and reverse primers
+ul dNTP
+ul phusion
+ul GC buffer
+.56 ul water
+ul gDNA from extraction
+Ran a gel with the gDNA prep, but the gel was upside down so samples ran out
+.27.17
+Ran the gel again correctly shown below, 120V for 50 minutes:
+pHF10: 1L-1, 4N-2, 2M-3, 3L-4, 2O-5, 1C-6, 4M-7, 4K-8, 1M-9, 2L-10
+pLC71: 4A-11, 2E-12, 2A-13, 9E-14, 1C-15, 4P-16, 4D-17
+pHF10 positive control-18
+pLC71 negative control-19
+Confirmed pHF10: 1C, 2L, 4K, 1L, 4N, 3L, 2O</p>
+<div class="column full_size" >
+<p>8.8.16
+Running gel with PCR products of 7.29.16
+Looks good
+.9.16
+Performed the gel purification protocol from the lab, including the following changes:
+Only did 1 membrane wash
+Did not pre heat the elution buffer
+Did the final elution with 15uL of the 10mM tris-HCL ph 8.8
+Both parts of the gene block will be nanodropped tomorrow to see how high the concentration of DNA is
+.10.16
+PCR with minipreped stataclone vector + insert from culture started on 7.29.16
+We have 4 samples, 1A, 1B, 2B, 2C
+Two different annealing temperatures for each sample. 68 & 72
+So we will have 8 PCR reactions.
+For C. Limon 1
+Component
+μl reaction
+Molecular grade H2O
+Added first. 28 μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+L. synthase forward (10μM)
+.5μL
+C. Limon 1 or 2 middle primer (10μM)
+.5μL
+Template DNA
+.0μL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+So we’re going to need (4)(2.5μL) of each primer.
+In the end we want (10μL)(10μM) so..
+ dilute(10μL)(10μM) = 10-4μmol = 10-4μmol(1L/25μmol) = 4*10-6L = 4μL stock
+μL stock + 6μL H2O = 10μL(10μM) primers
+& 8μL of dNTP’s stock 25 mM
+We want (8μL)(10mM)
+Dilute (8μL)(10mM) = 8*10-5mmol =  8*10-5mmol (1L/25mmol) = 3.2*10-6L = 3.2μL
+.2μL + 4.8μL H2O = 8μL(10mM) dNTP’s
+For C. Limon 2
+Component
+μl reaction
+Molecular grade H2O
+Added first. 32.5μL
+x GC Buffer
+μL
+mM dNTPs
+.0μL
+LS p2(10μM)
+.5μL
+C. Limon 2 Forward (10μM)
+.5μL
+Template DNA
+.0μL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+So we’re going to need (4)(2.5μL) of each primer.
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+s
+Extension
+-72 (gradient)
+.5 min
+Hold
+hold
+.10.16
+-Ran a gel with the completed C.Limon PCR products listed above from 8.9.16, results are shown below: ladder, next three were sharon’s stuff, 1A-68, 1B-68, 2B-68, 2C-68, 1A-72, 1B-72, 2B-72, 2C-72
+-Nanodropped C. Sten 1 & 2 gel purification products results are shown below:
+C. Sten 1 green tube- 9.9 ng/ul, 260/280- 2.07
+C. Sten 1 blue tube- 16.2 ng/ul, 260/280-1.92
+C. Sten 2 orange tube- 14.1 ng/ul, 260/280-1.84
+C. Sten 2 yellow tube- 17.4 ng/ul, 260/280-1.72
+.12.2016
+Fluorimetry on C. limon gel purification
+calibration : 99.76
+	Concentration(ng/uL)		Error
+A-68: 18.9k				-1.172
+A-72: 76.58				6.4
+B-68: 53.96				-2.9
+B-72: 33.34				-2.472
+B-68: 27.93				-5.44
+B-72: 69.96				-10.76
+C-68: 76.63				?
+C-72 : 13.27				-11.73
+.13.16
+-We tried infusion cloning with C.sten 1 and 2 g-blocks, these were the ones that were not in the strataclone vector, so after PCR amplification and running a gel to confirm amplification, we attempted to just directly clone both g-blocks into the pLC71 vector
+We used a 1:1:1 molar ratio for 1st g-block:2nd g-block:pLC71 and the values for each are shown below, keep in mind we had two PCR products for each g-block, so they are separated by eppendorf tube color, in this case we only used C.sten 1 blue and C.sten 2 yellow
+C.Sten 1 blue: 1.36 uL
+C. Sten 2 yellow: 1.02uL
+pLC71:0.88uL, dilution- 2uL pLC71 + 2uL sterile H2O, this way we could use 1.8uL instead of 0.88 which is hard to achieve with a pipette
+.8uL of water
+We did a negative control that contained everything listed above, except for the infusion mix
+-After following the Infusion protocol, we followed the Interlab transformation protocol, except we added 2 uL of the plasmid instead of 1uL, also when we plated after the outgrowth period, we use 50uL on one plate, and the rest on another plate, ~200uL
+</p>
+<div class="column full_size" >
+<p>9.2.16
+Nanodropping: C. Limon 1B & 2B in the strataclone vector
+B: 361.4 ng/μL	260/280: 1.84
+B: 368.9 ng/μL	260/280: 1.84
+PCR:
+M1V1 = M2V2
+V1B = (2μL)(361.4 ng/μL) / (10ng/μL) = 72.28 μL
+V1B = (2μL)(361.4ng/μL) / (10ng/μL) = 73.78 μL
+So, to dilute the plasmids to 10 ng/μL..
+B: 2μL stock + 70.3μL dH2O
+B: 2μL stock + 71.8μL dH2O
+Primers:
+B: Limonene Forward + C.limon1R
+B: C.limon2F + LSp2
+We have 100μM primers, we want 10μM.
+M1V1 = M2V2
+V = (2μL)(100μM) / (10μM) = 20μL
+So to dilute the primers…
+μL stock + 18μL dH2O
+Component
+μl reaction
+MMix (5 rxns) - 41uL
+Molecular grade H2O
+Added first. 27.5 μL
+.5µL
+x GC Buffer
+μL
+µL
+mM dNTPs
+.5μL
+.5µL
+Primer 1(10μM)
+μL
+Primer 2 (10μM)
+μL
+Template DNA 10ng/uL
+μL
+µL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+Anneal
+s
+s
+Extension
+min
+Final Extension
+Hold
+hold
+.3.16
+PCR failed. New idea; add DSMO (5% volume). Also try raising the annealing temperature.
+DMSO:
+We have 100% DMSO from NEB
+(0.05)(50µL) = 2.5µL DMSO
+With DMSO:
+Component
+μl reaction
+MMix (5 rxns) - 40uL
+Molecular grade H2O
+Added first. 27μL
+µL
+x GC Buffer
+μL
+µL
+mM dNTPs
+.5μL
+.5µL
+Primer 1(10μM)
+μL
+Primer 2 (10μM)
+μL
+% DMSO
+.5µL
+.5µL
+Template DNA 10ng/uL
+μL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+Anneal
+s
+s
+Extension
+min
+Final Extension
+Hold
+hold
+Without:
+Component
+μl reaction
+MMix (5 rxns) - 40uL
+Molecular grade H2O
+Added first. 27.5 μL
+.5µL
+x GC Buffer
+μL
+µL
+mM dNTPs
+.5μL
+.5µL
+Primer 1(10μM)
+μL
+Primer 2 (10μM)
+μL
+Template DNA 10ng/uL
+μL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+Anneal
+s
+s
+Extension
+min
+Final Extension
+Hold
+hold
+Brett Burkart, an employee of the Santangelo lab, gave Casey this protocol for purifying PCR products.
+PB buffer
+Add 5x the volume of the combined PCR reactions.
+Combined PCR reactions
+PB Buffer
+µL
+µL
+M NaOAc pH 5.2
+Add 1/100x the volume of the PCR reaction + PB buffer
+Working Volume
+M NaOAc pH 5.2
+µL
+µL
+Spin through column (may take two runs).
+Discard flow through.
+Load column with 750µL ethanol, spin.
+Discard ethanol, spin 2 minutes to dry.
+Label 1.7mL eppe.
+Load 25µL 10mM tris HCl pH 8.5
+Spin 2 mins. collect in labeled eppe.
+Load 25µL 10mM tris HCl pH 8.5
+Spin 2 mins. collect in same labeled eppe.
+.20.16
+Dr. Peebles discovered the there was no overlap between our insert and vector. The infusion cloning could not have worked.
+New primers
+Forward:
+GGC CGC AAA AAA GTC GAA TGC GCG TTG CGG CAG TCG
+melt temp: 77.7 ºC
+homologous region:
+A TGC GCG TTG CGG CAG TCG
+melt temp: 70.6 ºC
+Reverse:
+CAA AAT GCG CGT TGC GGC AGA GCG GCC GCA AAA AAG TCG AC
+melt temp: 78.4
+homologous region:
+AGCGGCCGCAAAAAAGTCGAC
+melt temp: 68.3 ºC
+.22.16
+Picked up new primers & resuspended.
+.26.16
+PCR with new primers, from strataclone vector.
+Component
+μl reaction
+MMix (5 rxns) - 41uL
+Molecular grade H2O
+Added first. 27.5 μL
+.5µL
+x GC Buffer
+μL
+µL
+mM dNTPs
+.5μL
+.5µL
+Primer 1(10μM)
+μL
+Primer 2 (10μM)
+μL
+Template DNA 10ng/uL
+μL
+µL
+Tom’s Phusion DNA polymerase
+Added last 5uL
+Cycle Step
+-step protocol
+Cycles
+Temp (oC)
+Time
+Initial denaturation
+min
+Denaturation
+Anneal
+s
+s
+Extension
+min
+Final Extension
+Hold
+hold
+</p>
 <h2>Experiments and daily lab notebook</h2>