Team:ColumbiaNYC/Basic Part

Basic Parts

Lorem ipsum dolor sit amet, consectetur adipisicing elit. Sint, explicabo dolores ipsam aliquam inventore corrupti.

{{ColumbiaNYC_navbar}}

Basic Parts

Lorem ipsum dolor sit amet, consectetur adipisicing elit. Sint, explicabo dolores ipsam aliquam inventore corrupti.

Adapted from Addgene pLKO.1 - TRC Cloning Vector

BBa_K2412000

iGEM BioBrick Link

This part encodes an shRNA that can successfully knock down expression of eGFP.
>BBa_K2412000 Part-only sequence (53 bp) gcaagctgaccctgaagttcatttcaagagaatgaacttcagggtcagcttgc

BBa_K2412002

iGEM BioBrick Link

This is an shRNA that knocks down EGFR in cancer cells.
>BBa_K2412002 Part-only sequence (63 bp) aagcaacatctccgaaagccaacaaggttcaagagaccttgttggctttcggagatgttgctt 

         









       </p>
     </div>

BBa_K2412000

       <a href="http://parts.igem.org/Part:BBa_K2412000">iGEM BioBrick Link</a>

This part encodes an shRNA that can successfully knock down expression of eGFP.

<thead> </thead> <tbody> </tbody> 
               >BBa_K2412000 Part-only sequence (53 bp) gcaagctgaccctgaagttcatttcaagagaatgaacttcagggtcagcttgc

BBa_K2412002

       <a href="http://parts.igem.org/Part:BBa_K2412002">iGEM BioBrick Link</a>

This is an shRNA that knocks down EGFR in cancer cells.

<thead> </thead> <tbody> </tbody> 
               >BBa_K2412002 Part-only sequence (63 bp) aagcaacatctccgaaagccaacaaggttcaagagaccttgttggctttcggagatgttgctt

   </div>

 </div>

</body>

</html>