Experiments

Overview

Like most iGEM teams we picked a project maybe a little too ambitious to be executed in just 4 months’ worth of lab work. Given enough time we could have built DIVERT step by step: first finding a setting for efficient reverse transcription and reintegration prior to combining the optimized components and trying to translate the results to other host organisms in the end. Anyhow, we had to resort to a different strategy to get the most out of the time and resources we had to our hands by following both a scientific/systematic as well as a “hope for a lucky shot” approach. On the systematic side of things we wanted to lay a foundation for potential future work by trying to find decent priming conditions for reverse transcription with MMLV RT in E. coli (LINK). In terms of reintegration we are confident that the well-established Flp/FRT-mediated recombination system would do the job. However, as mentioned in the theory section (LINK), FRT sites are palindromic and form stable hairpins possibly impairing transcription (and reverse transcription). To assess the severity of this potential problem we conducted terminator strength measurements with an FRT site in sense and antisense orientation (LINK).

Besides this more systematic approach we still wanted to take our chances by building a DIVERT cassette as well as a helper construct (carrying the RT, Flp and the primer cassettes) according to the best of our knowledge and see whether it worked. We attempted to do this for both S. cerevisiae and E. coli. (LINK)

As described in the theory section (LINK), our proof of concept assay involves an intron oriented in antisense direction in perspective to the GOI and in sense direction in perspective to the retroelement that is only spliced out of the retroelement mRNA ultimately yielding selectable colonies. Since there is no splicing in prokaryotes we had to find and adopt a self-splicing ribozyme to implement this assay in E. coli. (LINK)

The proof of concept assay requires the DIVERT cassette to be bidirectional (as an additional advantage this also prevents the RT from bumping into ribosomes in E. coli) resulting in a somewhat more intricate genetic construct (LINK bzw. Verweis auf Figure) that would have been troublesome to create via classic cloning techniques and better suited for gene synthesis. As most regulatory sequences (promoters and terminators) available for S. cerevisiae are rather long (~200 to 750 bp) we turned to relatively recently published short synthetic regulatory elements^1–3 to keep the synthesized construct short. The synthetic galactose-inducible minimal promoter we used (sequence retrieved from ³) was characterized (LINK) and sent to iGEM to expand the range of inducible yeast promoters available in the registry.

Details on the experiments conducted in the course of the generation of our CRISPR/Cas9 plug and play plasmids can be found here. (LINK)

Our shot at D.I.v.e.r.t.

As argued in the theory section (LINK) there are several options available for accomplishing the main processes necessary for completing the DIVERT cycle (i.e. reverse transcription and recombination). Lacking the time to systematically optimize the different components we still wanted to try our luck by designing the system in a way that deemed most promising in the light of the information we had gathered during the planning phase. The experimental as well as genetic construct designs for yeast and E. coli are described below. For both hosts we chose to use RNA oligonucleotides transcribed in trans to prime reverse transcription and the Flp/FRT recombinase system for reintegration.

E. Coli
The plan

For our DIVERT approach we planned on integrating 2 constructs into the E. coli chromosome: the DIVERT cassette and a helper construct carrying the components required for reverse transcription and reintegration. Both integration cassettes were flanked with terminators to insulate them from nearby genomic transcription. As integration loci we picked IS6 from Bassalo et al.⁴ for the DIVERT cassette and lacZ for the helper construct. Homologies measured 200 bp per arm outside of which we placed BsmBI recognition sites for scarless release of the fragment to be integrated from the Golden Gate backbone it was constructed in.

tRNA Priming

test

FRT Terminaton strength

For measurement of the FRT-sequences' terminator strength we went with an adapted version of the protocol developed by Cassie Huang in Tom Knight's lab. From their experiments we took their plasmid for calibration, BBa_I13515. This plasmid contains a promoter, followed by two consecutive genes for GFP and RFP expression and finally a terminator. If a terminator is inserted in between GFP and RFP, the amount of expressed RFP is decreased relative to the amount of expressed GFP. This can be measured via fluorescence and the terminator strength can be calculated with the following formula (1) from Jason Kelly in Drew Endy's lab:

In formula (1) RFP_term and GFP_term represent the number of fluorescence units from RFP and GFP respectively with the tested terminator in-between and RFP_control and GFP_control were taken from cultures containing the original plasmid BBa_I13514.

To test the terminator strength of our FRT-sequence, we created four different plasmids from BBa_I13415 as template (click to see the plasmid maps):

• FRT: With the FRT-sequence in between GFP and RFP
• TRF: With the inverted FRT-sequence in-between
• RNDM With a random sequence the same size as the FRT-sequence¹
• B1001 With the terminator BBa_B1001 in-between, as positive control of termination

X

The plasmids were created as follows. First, a BsmBI-recognition site inside the CmR gene was removed via site-directed mutagenesis. From that template, primers were designed to anneal alongside the space between the genes for GFP and RFP. Annexed to those primers were the respective halves of the target inserts, as well as BsmBI-fusion sites. These primers were used for PCR; the linear PCR-products were then digested with BsmBI and ligated with T4-ligase, resulting in circular plasmids containing our inserts at the desired position.

To test the terminator strength, aforementioned plasmids were transformed in E. coli DH10B and selected on agar plates containing chloramphenicol. From those plates, colonies were used to inoculate the pre-cultures for our determination - test tubes with 1 mL LB-medium and chloramphenicol, shaken overnight at 180 rpm and 37°C. For main-cultures we used test tubes containing 1 mL LB-medium with chloramphenicol, inoculated to an OD₆₀₀ of 0.1 from the pre-cultures. After 2h inoculation time, protein expression was induced with addition of arabinose to a concentration of 0.1% and after 10h inoculation time, cells were harvested for fluorescence measurement.

Each plasmid was cultured in triplets. Measurements were done using a Tecan i-control infinite 200 plate reader device. Culture broth was transferred to Nunclon 96 Flat Bottom Black well plates. Fluorescence measurements were done at 488 nm excitation wavelength and 530 nm emission wavelength for GFP-quantification as well as 531 nm excitation wavelength and 650 nm emission wavelength for RFP-quantification. Gain was set to 60. Results can be seen below:

Table 1: Results from the fluorescence measurements and calculation of the terminator efficiency

Figure 1: Terminator efficiencies of our tested sequences.

As a conclusion, we can see that some unknown factor is influencing our measurements, since the inserted random sequence shows a terminator efficiency of around 0.5. This may be due to issues with mRNA stability or some other factor, however, the exact reason would have to be investigated further. What still can be seen from our results is, that the FRT sequence shows clear termination activity -but only if read in one direction.

[1]:The random sequence was tested as an additional control for the calibration. This is the sequence: GGTCGCGAGTACCTGAACTAAGGCTCCGGACAGGACTATATACTAAGG

self-splicing ribozyme

and the antibiotic resistance gene

Design

Selection of a self-splicing ribozyme:
For the proof of concept for D.I.V.E.R.T. an antibiotic resistance with an intron on the lagging strand is required. While in yeast there are plenty of well-described introns to choose from, in E. coli information is more rare. However, scientists already discovered group I and group II introns working in prokaryotes as well. For example, the Tetrahymena group I intron, or self-splicing ribozyme, is proven to exhibit splicing activity in vivo in E. coli without the expression of additional supporting proteins¹. In contrast to other self-splicing ribozymes the Tetrahymena group I intron can easily be engineered to cut itself scarlessly. For the exact recognition of the splicing sites intron-exon pairing sequences are present in the wild type mRNA. The most important of these regions are called P1 and P10 (paired region 1 and 10)². P1 determines the 5’ end of the self-splicing ribozyme and contains P1ex, which has a considerable influence on the splicing activity. P10 pairs with an exon sequence close to the 3’ end and is therefore signalling the 3’ end of the intron. Although P1 and P10 mark opposite ends of the intron, they are both located in the same region and it is worth noticing that P1 and P10 can overlap.

Figure 1: Design of the precursor mRNA. Exon bases are written in lowercase, the Tetrahymena group I intron bases in capital letters. A part of the P1 region is complementary to the 5’ exon sequence determining the 5’ end of the intron, whereas the P10 region is determining the 3’ end.

Selection of an antibiotic resistance:
For the Tetrahymena group I intron Guo et al. proposed in their publication³ that the 5’ adjacent exon sequence of the mRNA should consist of CUCUCU. Concerning this and the requirement of the intron being on the lagging strand we were looking for an antibiotic resistance with AGAGAG (reverse complementary to CUCUCU). We finally chose an ampicillin resistance, a β-lactamase5, which exhibits AGAGAA approximately in the middle of the gene⁴. By introducing a silent mutation (A357G) the desired 5’ adjacent exon sequence could be obtained. Furthermore, a BsaI recognition site (T718, C719, T720) was silently mutated to comply with our Golden Gate-cloning standard.

Design of the self-splicing ribozyme:
When the Tetrahymena group I intron is inserted into a foreign gene, the adjustment of P1 and P10 are crucial for the preservation of the self-splicing ability: The P10 region was exchanged for bases complementary to the 3’ adjacent exon sequence of the new β-lactamase gene. Because P1ex and P10 are overlapping, P1 was altered as well. Additionally, as Guo et al. suggests³, a non-complementary base pair was introduced in the P1ex sequence to promote splicing activity.

Figure 2: Design of the precursor mRNA of the β-lactamase gene with the engineered Tetrahymena intron . Exon bases are written in lowercase, intron bases in capital letters. The β-lactamase sequence is reverse complementary due to the proof of concept setup. P1 as well as P10 were altered in the process of the design.

Experiments & Results

Proof of self-splicing:
To test the functionality of the engineered self-splicing Tetrahymena group I intron with the adjacent β-lactamase exon sequence, it was cloned into an expression vector and transformed into E. coli. The total mRNA was then purified and and a cDNA synthesis was performed using gene specific primer. For enhancing the amount of detectable DNA a PCR with was done afterwards. A gel electrophoresis was performed where both, spliced, and unspliced DNA was visible.

Figure 3: The sample was loaded on a agarose gel. After 40 min at 130 V two bands were visible. One 1248 bp long represents the unspliced mRNA, the second, 835 bp long, represents the spliced mRNA.

The 835 bp band was cut out and cleaned up. By performing a PCR the DNA was multiplied and subsequently sent for sequencing, which confirmed the self-splicing activity exactly as it was intended during the design.

Ampicillin resistance:
For the proof of concept a functional ampicillin resistance gene is required and, since the recombination is Flp/FRT mediated, a FRT sequence is introduced after the start and stop codon. Therefore, after Met 16 additional amino acids are expressed at the N-terminus of the ampicillin resistance gene. To test if the ampicillin resistance is still functional, this modified gene is cloned into an expression vector. After subsequent transformation into chemical competent E. Coli DH10b, cells are plated on LB low salt agar with 100 µg/mL ampicillin concentration. After an overnight incubation ampicillin resistant colonies were visible. For verification a colony was picked and its plasmid was purified and the instert sequenced.

[1]: Waring RB, Ray JA, Edwards SW, Scazzocchio C, Davies RW. The Tetrahymena rRNA intron self-splices in E. coli: in vivo evidence for the importance of key base-paired regions of RNA for RNA enzyme function. Cell. 1985 Feb;40(2):371-80.

[2]: Burke JM, Cech TR, Davies RW, Schweyen RJ, Shub DA, Szostak JW, Tabak HF. Structural conventions for group I introns. Nucleic Acids Res. 1987 Sep 25; 15(18): 7217–7221.

[3]: Guo F, Cech TR. In vivo selection of better self-splicing introns in Escherichia coli: the role of the P1 extension helix of the Tetrahymena intron. RNA. 2002 May;8(5):647-58.

[4]: Zhou W, Wang Y, Lin J. Functional cloning and characterization of antibiotic resistance genes from the chicken gut microbiome.Appl Environ Microbiol. 2012 Apr;78(8):3028-32. doi: 10.1128/AEM.06920-11. Epub 2012 Jan 27.

CRISPR assisted integration