Difference between revisions of "Team:NJU-China/Basic Part"

Line 1: Line 1:
−
{{NJU-China}}
+
<html lang="en">
−
<html>
+
<head>
 +
    <meta charset="UTF-8">
 +
    <title>PROJECT</title>
 +
   
 +
        <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:Bootstrap?action=raw&ctype=text/css">
 +
        <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:vicstyle?action=raw&ctype=text/css">
 +
    <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:jumpto?action=raw&ctype=text/css">
 +
    <script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-2-1-4?  action=raw&ctype=text/javascript"></script>
 +
    <script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-scripts?action=raw&ctype=text/javascript"></script>
 +
    <script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-jumpto?action=raw&ctype=text/javascript"></script>
  
 +
<style>
 +
#sideMenu,
 +
#top_title{
 +
    display: none;
 +
    box-sizing: content-box;
 +
}
 +
#content{
 +
    width: 100%;
 +
    margin: 0px;
 +
    padding:0;
 +
}
 +
#top_menu_14{
 +
    height: 15px;
 +
}
 +
#top_menu_under{
 +
    height: 0px;
 +
}
 +
#toplink a{
 +
display:none;
 +
}
 +
#top_menu_inside{
 +
padding-top:0;
 +
font-size:3px;
 +
}
 +
#HQ_page p {
 +
    font-family: proxima-nova,"Arial",Helvetica,sans-serif;
 +
    font-size: 19px;
 +
    text-align: justify;
 +
}
 +
i{
 +
font-size:13px;
 +
}
 +
#globalWrapper{
 +
padding-bottom:0;
 +
font-size:19px;
 +
}
 +
a:visited{
 +
color:white;
 +
}
 +
.set_1_btn {
 +
    color: white;
 +
    cursor: pointer;
 +
    display: block;
 +
    font-size: 24px;
 +
    font-weight: 400;
 +
    line-height: 65px;
 +
    margin-right: 2em;
 +
    text-align: center;
 +
    max-width: 250px;
 +
    position: relative;
 +
    text-decoration: none;
 +
    text-transform: uppercase;
 +
    vertical-align: middle;
 +
    width: 100%;
 +
}
 +
.set_1_btn:hover {
 +
    text-decoration: none;
 +
    color: #72261E;
 +
}
 +
.Vbtn-1 {
 +
    background:transparent;
 +
    text-align: center;
 +
    float:left;
 +
}
 +
.Vbtn-1 svg {
 +
    height: 65px;
 +
    left: 0;
 +
    position: absolute;
 +
    top: 0;
 +
    width: 100%;
 +
}
 +
.Vbtn-1 rect {
 +
    fill: none;
 +
    stroke: white;
 +
    stroke-width: 3;
 +
    stroke-dasharray: 422, 0;
 +
    transition: all 600ms linear 0s;
 +
}
 +
.Vbtn-1:hover {
 +
    background: none;
 +
    font-weight: 900;
 +
    letter-spacing: 1px;
 +
    transition: all 150ms linear 0s;
 +
}
 +
.Vbtn-1:hover rect {
 +
    stroke-width: 5;
 +
    stroke-dasharray: 25, 300;
 +
    stroke-dashoffset: 385;
 +
    -webkit-transition: all 1.35s cubic-bezier(0.19, 1, 0.22, 1);
 +
    transition: all 1.35s cubic-bezier(0.19, 1, 0.22, 1);
 +
}
  
 +
</style>
 +
</head>
 +
<body>
 +
    <div id="wrapper">
 +
        <div class="overlay"></div>
 +
   
 +
        <!-- Sidebar -->
 +
        <nav class="navbar navbar-inverse navbar-fixed-top" id="sidebar-wrapper" role="navigation">
 +
            <ul class="nav sidebar-nav">
 +
                <li class="sidebar-brand">
 +
                    <a href="https://2017.igem.org/Team:NJU-China">
 +
                      NJU-CHINA
 +
                    </a>
 +
                </li>
 +
                <li>
 +
                    <a href="https://2017.igem.org/Team:NJU-China"><i class="fa fa-fw fa-home"></i> Home</a>
 +
                </li>
 +
                <li class="dropdown">
 +
                    <a href="https://2017.igem.org/Team:NJU-China/Project" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Project <span class="caret"></span></a>
 +
                    <ul class="dropdown-menu" role="menu">
 +
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/Project">Project</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Project#Background">Description</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/InterLab">InterLab</a></li>
 +
                    </ul>
 +
                </li>
 +
                <li class="dropdown">
 +
                    <a href="https://2017.igem.org/Team:NJU-China/Results/Conclusions" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Results <span class="caret"></span></a>
 +
                    <ul class="dropdown-menu" role="menu">
 +
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/Results/Conclusions">Results</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Results/Conclusions">Conclusions</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Demonstrate">Demonstrate</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Safety">Safety</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Improve">Improve</a></li>
 +
                    </ul>
 +
                </li>
 +
                <li class="dropdown">
 +
                    <a href="https://2017.igem.org/Team:NJU-China/Parts" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Parts <span class="caret"></span></a>
 +
                    <ul class="dropdown-menu" role="menu">
 +
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/Parts">Parts</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Basic_Part">Basic Part</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Composite_Part">Composite Parts</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Part_Collection">Part Collection</a></li>
 +
                    </ul>
 +
                </li>
 +
                <li class="dropdown">
 +
                  <a href="https://2017.igem.org/Team:NJU-China/Notebook" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Notebook <span class="caret"></span></a>
 +
                  <ul class="dropdown-menu" role="menu">
 +
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/Notebook">Notebook</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Experiments">Experiments</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Protocol">Protocol</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Calendar">Calendar</a></li>
 +
                  </ul>
 +
                </li>
 +
                <li class="dropdown">
 +
                  <a href="https://2017.igem.org/Team:NJU-China/HP" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Human Practice <span class="caret"></span></a>
 +
                  <ul class="dropdown-menu" role="menu">
 +
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/HP">Human Practice</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/HP/Silver">Silver HP</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/HP/Gold_Integrated">Intergrated and Gold</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Part_Collection">Public Engagement</a></li>
 +
                  </ul>
 +
                </li>
 +
                <li class="dropdown">
 +
                  <a href="https://2017.igem.org/Team:NJU-China/Team" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Team <span class="caret"></span></a>
 +
                  <ul class="dropdown-menu" role="menu">
 +
                    <li class="dropdown-header"><a href="https://2017.igem.org/Team:NJU-China/Team">Team</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Attributions">Attributions</a></li>
 +
                    <li><a href="https://2017.igem.org/Team:NJU-China/Collaborations">Collaborations</a></li>
 +
                  </ul>
 +
                </li>                               
 +
            </ul>
 +
        </nav>
 +
        <!-- /#sidebar-wrapper -->
 +
<nav id="cd-vertical-nav">
 +
            <ul>
 +
                <li>
 +
                    <a href="#BCL2" data-number="1">
 +
                        <span class="cd-dot"></span>
 +
                        <span class="cd-label">BCL2</span>
 +
                    </a>
 +
                </li>
 +
                <li>
 +
                    <a href="#tPEP" data-number="2">
 +
                        <span class="cd-dot"></span>
 +
                        <span class="cd-label">tPEP</span>
 +
                    </a>
 +
                </li>
 +
            </ul>
 +
        </nav>       
 +
        <!-- Page Content -->
 +
       
 +
<div id="page-content-wrapper">
 +
          <button type="button" class="hamburger is-closed animated fadeInLeft" data-toggle="offcanvas">
 +
            <span class="hamb-top"></span>
 +
            <span class="hamb-middle"></span>
 +
            <span class="hamb-bottom"></span>
 +
          </button>
 +
        <div class="partstop">
 +
           
 +
        </div>
 +
        <div class="page_container">
 +
        <div id="BCL2" class="first" style="padding: 50px 0;">
 +
        <div id="page_edge1">
 +
        </div>
 +
            <h2>BCL2- siRNAs design</h2>
 +
            <div class="container">
 +
                <div class="row">
 +
                    <div class="col-sm-12 col-md-12">
 +
                        BCL2-si RNA – 1 sequence: CCGGGAGAACAGGGTATGATA
 +
                        <br />
 +
BCL2-si RNA – 2 sequence: TACGAGTGGGATGCTGGAGAT
 +
<br />
 +
BCL2-si RNA – 3 sequence: GTGGATGACTGAGTACCTGAA
 +
<br />
 +
BCL2-si RNA – 4 sequence: CTGCATCACTCTGGGTGCATA
 +
                    </div> 
 +
                </div>
 +
                <div class="row">
 +
                    These four parts are artificially designed RNA strands that function as the silencing tool for BCL2 gene’s expression through base-pairing with corresponding mRNAs. BCL2 protein is anti-apoptotic, mainly located in the cytoplasm side of the nuclear membrane, the endoplasmic reticulum and the outer membrane of mitochondria. By muting BCL2 gene’s expression, we can induce more cells’ apoptosis theoretically. We design four sequences and have a DNA synthesis company produce plasmids with codes inserted for each of them.                   
 +
                </div>                                                           
 +
            </div>
 +
        </div>
 +
        <div id="tPEP" class="second" style="padding: 50px 0;">
 +
            <div id="page_edge2">
 +
            </div>       
 +
            <h2>tPEP - lamp 2b fusion protein’s coding DNA fragment</h2>
 +
            <div class="container">
 +
                <div class="row">
 +
                    tPEP is a peptide (CKGGRAKDC ) targeted to adipose tissue as the ligand of adipocytes’ prohibitin, whilst lamp 2b is a integrin for exosomes. This part is artificially designed to create a fusion protein, tPep at the outward end of lamp 2b. With the assistance of such proteins, exosomes are capable of carrying siRNAs precisely towards adipose tissues. When the tPep binds the prohibitin of the adipocyte and an exosome’ membrane merge into the adipocyte’s, it’s time for siRNAs to act.
 +
                    <img src="https://static.igem.org/mediawiki/2017/c/cc/NJU_China_iGEM_2017_parts_fig1.png" alt="" style="text-align: center;">                 
 +
                </div>
 +
                <div class="row">
 +
                    We package BCL2-siRNAs into exosomes by transfecting HEK293 cells with a plasmid expressing BCL2-siRNA and then collect siRNA-encapsulated exosomes. When we inject the modified exosomes into the bloodstream, exosomes will specifically identify adipocytes and fuse with them under the direction of the tPep. Once siRNAs make their entrance into adipocytes, they cause the degradation of BCL2 mRNA via base-paring. Subsequently, adipocytes’ apoptosis increase.
 +
                    <br />
 +
                    To ensure the interference efficacy of BCL2 siRNA, four siRNA sequences targeting different sites of BCL2 mRNA were designed. After we transfected them into the mouse adipocytes, we could detect efficient knock-down of BCL2. Among these four sequences, BCL2-siRNA-2 exhibits the most powerful efficacy.
 +
                </div>
 +
                <div class="row" style="text-align: center;">
 +
                    <img src="https://static.igem.org/mediawiki/2017/1/11/NJU_China_iGEM_2017_parts_fig2.png" alt="" style="width: 70%; margin-left:150px;">
 +
                    <img src="https://static.igem.org/mediawiki/2017/a/a8/NJU_China_iGEM_2017_parts_fig3.png" alt="">
 +
                </div>
 +
                <div class="row">
 +
                    To prove the targeting property of tPep exosomes, we co-incubated them respectively with 3T3L1 cells (mouse adipose tissues) and C2C12 (mouse myoblasts). Also we set parallel experiments using exosomes without tPep-lamp 2b fusion protein. It was thrilling to see only tPep exosomes accumulated in the 3T3L1 cells while the other groups’ results were contrary. This fully illustrates tPep exosomes can target precisely to the adipose tissues.
 +
                </div>                   
 +
                </div>
 +
                <div class="row"  style="text-align: center;">
 +
                    <img src="https://static.igem.org/mediawiki/2017/e/e4/NJU_China_iGEM_2017_parts_fig4.png" alt="" style="width: 80%;">
 +
                </div>
 +
          </div>
 +
    </div>
 +
    </div>
 +
    <div id="InterLab" class="foot" style="padding: 10px 0;background-color: black;color: white;"> 
 +
            <div class="container">
 +
                <div class="row">
 +
                    <div class="col-sm-4 col-md-4">
 +
                        <h2 style="float: left;font-size: 35px;padding: 0 0 13px 100px;font-family: 'Microsoft YaHei';letter-spacing: 1.5px;">NJU-CHINA</h2>
 +
                    </div>
 +
                    <div class="col-sm-8 col-md-8">
 +
                        <a href="https://2017.igem.org/Team:NJU-China/InterLab" class="set_1_btn Vbtn-1" style="float: right;;margin: 10px 200px 0;"> <svg>
 +
                        <rect x="0" y="0" fill="none" width="100%" height="100%"></rect>
 +
                        </svg> READ MORE </a>
 +
                    </div>
 +
                </div>
 +
            </div>       
 +
    </div>
 +
</div>
 +
<!--page-->
 +
</div>
 +
<!-- /#wrapper -->
 +
   
 +
    <script src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-1110-min?action=raw&ctype=text/javascript" type="text/javascript"></script>
 +
    <script src="https://2017.igem.org/Team:NJU-China/Javascript:bootstrap-min-js?action=raw&ctype=text/javascript" type="text/javascript"></script>
 +
    <script type="text/javascript">
 +
        $(document).ready(function () {
 +
          var trigger = $('.hamburger'),
 +
              overlay = $('.overlay'),
 +
            isClosed = false;
  
−
<div class="column full_width">
+
            trigger.click(function () {
−
 
+
              hamburger_cross();     
−
 
+
            });
−
<h1>Basic Parts</h1>
+
−
 
+
−
<p>
+
−
A <b>basic part</b> is a functional unit of DNA that cannot be subdivided into smaller component parts. <a href="http://parts.igem.org/wiki/index.php/Part:BBa_R0051">BBa_R0051</a> is an example of a basic part, a promoter regulated by lambda cl.
+
−
</p>
+
−
 
+
−
<p>Most genetically-encoded functions have not yet been converted to BioBrick parts. Thus, there are <b>many</b> opportunities to find new, cool, and important genetically encoded functions, and refine and convert the DNA encoding these functions into BioBrick standard biological parts. </p>
+
−
<br>
+
−
<h3>Best Basic Part Special Prize</h3>
+
−
 
+
−
<p>Most genetically-encoded functions have not yet been converted to BioBrick parts. Thus, there are *many* opportunities to find new, cool, and important genetically encoded functions, and refine and convert the DNA encoding these functions into BioBrick standard biological parts. To be eligible for this award, this part must adhere to <a href="http://parts.igem.org/DNA_Submission">Registry sample submission guidelines</a> and have been sent to the Registry of Standard Biological Parts. If you have a part you wish to nominate your team for this <a href="https://2017.igem.org/Judging/Awards">special prize</a>, make sure you add your part number to your <a href="https://2017.igem.org/Judging/Judging_Form">judging form</a> and delete the box at the top of this page.
+
−
 
+
−
<br><br>
+
−
<b>Please note:</b> Judges will only look at the first part number you list, so please only enter ONE (1) part number in the judging form for this prize. </p>
+
−
<br>
+
−
 
+
−
 
+
−
 
+
−
<div class="highlight">
+
−
<h4>Note</h4>
+
−
<p>This page should list all the basic parts your team has made during your project. You must add all characterization information for your parts on the Registry. You should not put characterization information on this page. Remember judges will only look at the first part in the list for the Best Basic Part award, so put your best part first!</p>
+
−
 
+
−
 
+
−
</div>
+
  
 +
            function hamburger_cross() {
  
 +
              if (isClosed == true) {         
 +
                overlay.hide();
 +
                trigger.removeClass('is-open');
 +
                trigger.addClass('is-closed');
 +
                isClosed = false;
 +
              } else { 
 +
                overlay.show();
 +
                trigger.removeClass('is-closed');
 +
                trigger.addClass('is-open');
 +
                isClosed = true;
 +
              }
 +
          }
 +
         
 +
          $('[data-toggle="offcanvas"]').click(function () {
 +
                $('#wrapper').toggleClass('toggled');
 +
          }); 
 +
        });
 +
    </script>
 +
</body>
 
</html>
 
</html>

Revision as of 15:38, 22 October 2017

PROJECT

BCL2- siRNAs design

BCL2-si RNA – 1 sequence: CCGGGAGAACAGGGTATGATA
BCL2-si RNA – 2 sequence: TACGAGTGGGATGCTGGAGAT
BCL2-si RNA – 3 sequence: GTGGATGACTGAGTACCTGAA
BCL2-si RNA – 4 sequence: CTGCATCACTCTGGGTGCATA
These four parts are artificially designed RNA strands that function as the silencing tool for BCL2 gene’s expression through base-pairing with corresponding mRNAs. BCL2 protein is anti-apoptotic, mainly located in the cytoplasm side of the nuclear membrane, the endoplasmic reticulum and the outer membrane of mitochondria. By muting BCL2 gene’s expression, we can induce more cells’ apoptosis theoretically. We design four sequences and have a DNA synthesis company produce plasmids with codes inserted for each of them.

tPEP - lamp 2b fusion protein’s coding DNA fragment

tPEP is a peptide (CKGGRAKDC ) targeted to adipose tissue as the ligand of adipocytes’ prohibitin, whilst lamp 2b is a integrin for exosomes. This part is artificially designed to create a fusion protein, tPep at the outward end of lamp 2b. With the assistance of such proteins, exosomes are capable of carrying siRNAs precisely towards adipose tissues. When the tPep binds the prohibitin of the adipocyte and an exosome’ membrane merge into the adipocyte’s, it’s time for siRNAs to act.
We package BCL2-siRNAs into exosomes by transfecting HEK293 cells with a plasmid expressing BCL2-siRNA and then collect siRNA-encapsulated exosomes. When we inject the modified exosomes into the bloodstream, exosomes will specifically identify adipocytes and fuse with them under the direction of the tPep. Once siRNAs make their entrance into adipocytes, they cause the degradation of BCL2 mRNA via base-paring. Subsequently, adipocytes’ apoptosis increase.
To ensure the interference efficacy of BCL2 siRNA, four siRNA sequences targeting different sites of BCL2 mRNA were designed. After we transfected them into the mouse adipocytes, we could detect efficient knock-down of BCL2. Among these four sequences, BCL2-siRNA-2 exhibits the most powerful efficacy.
To prove the targeting property of tPep exosomes, we co-incubated them respectively with 3T3L1 cells (mouse adipose tissues) and C2C12 (mouse myoblasts). Also we set parallel experiments using exosomes without tPep-lamp 2b fusion protein. It was thrilling to see only tPep exosomes accumulated in the 3T3L1 cells while the other groups’ results were contrary. This fully illustrates tPep exosomes can target precisely to the adipose tissues.

NJU-CHINA

READ MORE