Difference between revisions of "Team:Oxford/Software"
| Line 11: | Line 11: | ||
} | } | ||
</style> | </style> | ||
| − | + | <head> | |
| − | < | + | <meta charset = "utf-8"> |
| − | < | + | <title>jQuery UI Autocomplete functionality</title> |
| − | + | <link href = "https://code.jquery.com/ui/1.10.4/themes/ui-lightness/jquery-ui.css" rel = "stylesheet"> | |
| − | + | <script src = "https://code.jquery.com/jquery-1.10.2.js"></script> | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | < | + | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | <script src = "https://code.jquery.com/jquery-1.10.2.js"></script> | + | |
<script src = "https://code.jquery.com/ui/1.10.4/jquery-ui.js"></script> | <script src = "https://code.jquery.com/ui/1.10.4/jquery-ui.js"></script> | ||
| − | <script> | + | <script> |
$( function() { | $( function() { | ||
var suggestions = [ | var suggestions = [ | ||
| Line 174: | Line 105: | ||
} ); | } ); | ||
</script> | </script> | ||
| + | </head> | ||
| + | <body> | ||
| + | <div class="container"> | ||
| + | <div style="margin-top: 100px"></div> | ||
| + | <h1 class="text-center">Software Tool</h1> | ||
| + | <p>Enter the disease name, parasite or specific protease to find the cleavage sequence of protease specific to the disease of interest and how our system may be applicable.</p> | ||
| + | <input type="text" id="myInput" placeholder="Search"> | ||
| + | <table id="id_tbl" class="table table-hover"> | ||
| + | <thead> | ||
| + | <tr class="item0" style="display:none"> | ||
| + | <th width="8%" align="left">Disease</th> | ||
| + | <th width="8%" align="left">Parasite</th> | ||
| + | <th width="8%" align="left">Specific Protease</th> | ||
| + | <th width="16%" align="left">DNA Sequence of Cleavage Site</th> | ||
| + | <th width="20%" align="left">Protease Cleavage Sequence</th> | ||
| + | <th width="8%" align="left">Medium of Test</th> | ||
| + | <th width="8%" align="left">Final Output</th> | ||
| + | <th width="8%" align="left">Positive Result</th> | ||
| + | </tr> | ||
| + | </thead> | ||
| + | <tbody> | ||
| + | <tr class="item1" style="display:none"> | ||
| + | <td><span>Congenital Chagas Disease</span></td> | ||
| + | <td><span><i>Trypanosoma Cruzi</i></span></td> | ||
| + | <td><span>Cruzipain</span></td> | ||
| + | <td><span>AAAAAAGTTAAAGCTAAAAAA</span></td> | ||
| + | <td><span>K/K/L/KR-A/KS/K/RQ</span></td> | ||
| + | <td><span>Blood</span></td> | ||
| + | <td><span>Hirudin</span></td> | ||
| + | <td><span>No blood clotting</span></td> | ||
| + | </tr> | ||
| + | <tr class="item2" style="display:none"> | ||
| + | <td><span>Sepsis</span></td> | ||
| + | <td><span><i>Pseudomonas aeruginosa</i></span></td> | ||
| + | <td><span>LasA</span></td> | ||
| + | <td><span></span></td> | ||
| + | <td><span>After Gly-Gly (e.g. PGVGG - elastin) or between Lys-Ile (e.g. NKKIEKFQ(S-P) - beta=casein)</span></td> | ||
| + | <td><span>Blood</span></td> | ||
| + | <td><span>Hirudin</span></td> | ||
| + | <td><span>No blood clotting</span></td> | ||
| + | </tr> | ||
| + | <tr class="item3" style="display:none"> | ||
| + | <td><span>African Sleeping sickness</span></td> | ||
| + | <td><span><i>Trypanosoma brucei</i></span></td> | ||
| + | <td><span>Rhodesain/Brucepain</span></td> | ||
| + | <td><span>TCCGCGCCGAAATCCCTGATTGGC/ TCCGCGCCGCGTTCCCTGATTGGC</span></td> | ||
| + | <td><span>S/A/P/R-K/S/L/I/G</span></td> | ||
| + | <td><span>Blood</span></td> | ||
| + | <td><span>Hirudin</span></td> | ||
| + | <td><span>No blood clotting</span></td> | ||
| + | </tr> | ||
| + | <tr class="item4" style="display:none"> | ||
| + | <td><span>Schistosomiasis</span></td> | ||
| + | <td><span><i>Schistosoma mansoni</i></span></td> | ||
| + | <td><span>Cercarial elastase</span></td> | ||
| + | <td><span>AGCTGGCCGCTG</span></td> | ||
| + | <td><span>SWPL</span></td> | ||
| + | <td><span>Blood</span></td> | ||
| + | <td><span>Hirudin</span></td> | ||
| + | <td><span>No blood clotting</span></td> | ||
| + | </tr> | ||
| + | <tr class="item5" style="display:none"> | ||
| + | <td><span>Congenital toxoplasmosis</span></td> | ||
| + | <td><span><i>Toxoplasma gondii</i></span></td> | ||
| + | <td><span>Cathepsin L</span></td> | ||
| + | <td><span></span></td> | ||
| + | <td><span>KQKLR</span></td> | ||
| + | <td><span>Amniotic fluid</span></td> | ||
| + | <td><span></span></td> | ||
| + | <td><span></span></td> | ||
| + | </tr> | ||
| + | </tbody> | ||
| + | </table> | ||
</div> | </div> | ||
</body> | </body> | ||
</html> | </html> | ||
Revision as of 06:16, 31 October 2017
Software Tool
Enter the disease name, parasite or specific protease to find the cleavage sequence of protease specific to the disease of interest and how our system may be applicable.
