Line 417: | Line 417: | ||
<p class="content">These two are the basic parts we use in our project.</p> | <p class="content">These two are the basic parts we use in our project.</p> | ||
+ | |||
+ | |||
+ | |||
+ | <!--Pcsir--> | ||
+ | <p class="content-1">PcsiR1</p> | ||
+ | <p class="content">We are NOT the founder of this promoter. It’s Rice University that come up with it. | ||
+ | PcsiR1 is a promoter for UirS and UirR. | ||
+ | It is a more effective promoter, compared to Plsir, according to the researches Rice University had done. All credits belong to Rice University. Learn more from the <a href=""><font style="color: lightblue">link</font></a> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2017/d/dd/PcsiR1.png" class="bigphoto" width="70%"> | ||
+ | |||
+ | <p class="content">We had a difficult time finding the sequence of this promoter, and we don’t want the future team to fall into the same problem in the future. So, here is the sequence of the promoter. | ||
+ | Length 109 bp | ||
+ | CAGTTTCCAAGCAAGATCCGGGCGAAAAAATAAAATCGATGTCAAAAATCAACTAGTTTGTCAAAAATCGACCAGGACAGGGTTGGGAATTTTTCCTAGGATGGGACTG | ||
+ | </p> | ||
+ | |||
+ | |||
</div> | </div> | ||
</section> | </section> |
Revision as of 00:44, 30 October 2017