Line 428: | Line 428: | ||
<img src="https://static.igem.org/mediawiki/2017/d/dd/PcsiR1.png" class="bigphoto" width="70%"> | <img src="https://static.igem.org/mediawiki/2017/d/dd/PcsiR1.png" class="bigphoto" width="70%"> | ||
− | <p class="content">We had a difficult time finding the sequence of this promoter, and we don’t want the future team to fall into the same problem in the future. So, here is the sequence of the promoter. | + | <p class="content">We had a difficult time finding the sequence of this promoter, and we don’t want the future team to fall into the same problem in the future. So, here is the sequence of the promoter. Length 109 bp |
− | Length 109 bp | + | CAGTTTCCAAGCAAGATCCGGGCGAAAAAATAAAATCGATGTCAAAAATCAACTAG<br>TTTGTCAAAAATCGACCAGGACAGGGTTGGGAATTTTTCCTAGGATGGGACTG</br> |
− | + | ||
</p> | </p> | ||
Revision as of 00:45, 30 October 2017