Line 429: | Line 429: | ||
<p class="content">We had a difficult time finding the sequence of this promoter, and we don’t want the future team to fall into the same problem in the future. So, here is the sequence of the promoter. Length 109 bp | <p class="content">We had a difficult time finding the sequence of this promoter, and we don’t want the future team to fall into the same problem in the future. So, here is the sequence of the promoter. Length 109 bp | ||
− | CAGTTTCCAAGCAAGATCCGGGCGAAAAAATAAAATCGATGTCAAAAATCAACTAG<br>TTTGTCAAAAATCGACCAGGACAGGGTTGGGAATTTTTCCTAGGATGGGACTG</br> | + | <font style="color: lightgreen">CAGTTTCCAAGCAAGATCCGGGCGAAAAAATAAAATCGATGTCAAAAATCAACTAG<br>TTTGTCAAAAATCGACCAGGACAGGGTTGGGAATTTTTCCTAGGATGGGACTG</br></font> |
</p> | </p> | ||
Revision as of 00:46, 30 October 2017