Impact UPMC

Experiments

Part II- SKP integration into bacterial chromosome

Introduction :

Our purpose was to produce antibodies through our transportable factory "The BioMaker Factory". As many eukaryotic proteins it depends a lot of various post-traductional modification and a precise tridimensional architecture. In this way, it’s appears important for us to coexpress our recombinant protein with chaperones. However, WHO legislations demand a total safety of sanitary product exempt from any dangerous substance. So il was a necessity for us to avoid usage of antibiotics during cell growth. The direct insertion of chaperone gene within the bacterial genome appeared to be the best way to ensure a stable expression of additional chaperone proteins into the genome of our designed bacteria allowing a proper folding of eukaryotic therapeutical proteins.

Method:

To do so, we used pGRG25 integration vector obtained from Addgene in transformed DH5α E. coli. This vector was designed by McKenzie et al to insert DNA sequence in bacterial chromosome without inducing drug resistance of the host. This system uses Tn7 to insert transgenes at a defined neutral site in the chromosome (attTn7). The site is highly conserved and is known to work as a Tn7 attachment site in E. coli and its relatives. The attTn7 sequence is conserved in most (all) bacteria.

Construction of cytosolic Skp gene :

We had synthesized a cytosolic form of Skp under the control of T7 promoter and ended by a T7 terminator by IDT.

We amplified by Polymerisation Chain Reaction the Skp CDS preceded by its RBS and ended by the T7 promoter with the following primers, introducing XbaI restriction site and SpeI NotI restrictions sites.
Primer forward : 5’GCGGCCGCTACTAGTATTATTTAACCTG3’ Primer Reverse : 5’CTTCTAGAGCCATGGCTGACAAAA3’
TM :67,3°C
We used the Biobrick Assembly kit to place Skp under the control of the promoter from the iGEM distribution kit 2017 BBa_J2310 we used this new construct to transformed E. coli competent DH5α.

Cloning of Skp in pGRG25 :

Culture of these strain was made at 30°C. Indeed, the plasmid backbone is the easily curable temperature sensitive mutant of pSC101, carrying the pSC101 temperature sensitive origin, which must be grown at 30-32°C to allow replication. So in order to extract plasmids, we inoculate these bacterial cells overnight in culture with ampicillin. We inserted the Skp sequence into the NotI restriction site located on the MCS of pGRG25 and then we transformed E. coli competent DH5α with the cloned vector.

Integration of the cytoplasmic form of Skp in E. coli DH5α genome

Cultures of the transformed cloned cells was made overnight without antibiotics at 32°C (this step allows for some loss of plasmid) and then at 42°C to block replication of the plasmid. Colonies were streaked once on LB at 42°C to ensure the complete loss of the plasmid and DNA integration into the genome.
After this step of integration and before characterization of the effect of SKP in protein synthesis we made verifications:
A simple checking was to pick the next day 3 colonies to put them in culture in LB+/- ampicillin.

Verification of the genomic insertion of cytosolic Skp

We check out the proper insertion of our Skp by performing a PCR on colonies allowing the specific amplification of cytosolic Skp with the following primers:
Primer forward : 5’GCGGCCGCTACTAGTATTATTTAACCTG3’ Primer Reverse : 5’CTTCTAGAGCCATGGCTGACAAAA3’
TM :67,3°C

Transposition was verified by the absence by PCR amplifying sequences which flank the attTn7 site with the following primers.
Primer Foward 5'GATGCTGGTGGCGAAGCTGT3’ and 5'GATGACGGTTTGTCACATGGA3’

Then, we purified DNA from PCR and we visualized PCR product on an agarose gel electrophoresis (1.5%).

Characterization of Skp insertion

In order to assess the effect related to the SKP chromosomique intégration, we transformed our engineered E. coli with our composite part BBa_I13500-BBa_I13507 created for the promoter caracterisation under the BBa_J231107 promoter and then we quantified the production of GFP and RFP.

Results Verification of the genomic insertion of cytosolic Skp

After amplification by polymerisation chain reaction of RBS-SKP-Terminateur sequence, which represent a fragment of 622pB we realized a comparison between non integrated DH5α cells and bacterial cells with DNA insertion (at 42°C). Here on these electrophoresis gel we can see that there is a band with a very high level of intensity and some SMIRS. We made a mistake between preparation of PCR and used primers 10 times more concentrated but this observation confirm the fact that we can improve the level of SKP production directly into the genome.

Characterization of the SKP insertion:

Promoter strength was assessed through the quantification of specific fluorescence from GFP (A) and RFP (B) normalized with OD600 to obtain relative fluorescent units (RFU). After transformation we compared the level of GFP and RFP expression between DH5α with and without SKP integration. Firstly, we can find with the same condition of transformation a same range of fluorescence for both reporters compared to the characterisation of Anderson’s promoters. Here we can see that the level of GFP expression (around 20000U) is not significantly change when we introduce SKP into the genome, even if there is a very weak increase in the emission level of GFP and RFP. Our supposition is that GFP is a protein which is relatively simple, which don’t need chaperon proteins or an high level of post traductional modifications, and we didn’t had the time to realize other tests with more complex proteins

Part III - Determination of the best purification system

Introduction

The goal is to test and compare the Gluthation purification system and the hisTrap one to systems to see which one would be the most effective for our box. To do so, we have purified GST-10XHIS proteins with both of the purification system. We have determined the GST enzymatic activity before and after the purifications to obtain the purification yields. Finally, we have done SDS-PAGE chromatographies to semi-quantify the proteins and compare the results with those obtained with the enzymatic activity.

Results

Figure.11: Growth curve of the DH5α containing the PET 21 GST-10HIS
All the points data come from a mean done by data collected from 5 cultures. Cultures were incubated in LB at37°C. The DO(600nm) was calculated every hour.

We cultured DH5α containing plasmid pet21 GST-10XHIS. We measured the OD every hour in order to follow the turbidity and thus determine the time corresponding to the exponential phase of growth(fig.11).

Analysis of GST enzymatic activity:

We calculated the GST activity of the sample taken before and after the purification. We took 5µL of the aliquotes to do the reaction. We then calculated the total reaction for the all volume before and after lysis that can be found in table.1. The table.2 presents the the activities and purification yields obtained for both of the purification.
For the HisTrap column, we observe a purification yield equal to 72.1 %.
For the Gluthation Agarose Resin we observe a purification yield equal to 32%.

Fraction	Enzymatic activity From 5 µL (Δabs/min)	Total enzymatic activity (Δabs/min)	Purification Yield
F1 HisTrap column	0.13	208	72.1%
F2 HisTrap column	0.15	150	72.1%
F1 Gluthation Agarose Resin	0.75	120	32%
F2 Gluthation Agarose Resin	0.77	38.5	32%

Table.2 GST Enzymatic activity obtained and purification yield

Analysis of SDS-PAGE gel:

After bacterial lysis, we prepared aliquots from the solutions before and after purification and we performed SDS-PAGE for both types of purification. This is done in order to check the presence of GST-10XHIS and to compare these results with those obtained with the enzymatic analysis.

12% polyacrylamide gel. 10 µL deposited with Laemli 1X for each well. M: Kb Ladder. 1: eluted and purified proteins using a Gluthation-Agarose column. 2: expressed proteins before purification.

Figure.13: SDS-PAGE analyse of purification of GST-10his proteins using a HisTrap column

Before purification, mutliple bands can be seen corresponding to bacterial proteins. However, an intense band at about 27 kDa, which correspond to the GST-10His is observed and suggest a good expression of the protein(fig.12.2). After purification with Gluthation Agarose Resin, we can only see one band corresponding to the GST-10His but smaller than the one seen before purification(fig12.1).

SDS-PAGE of HisTrap column purification : Similarly to what was observed in the previous SDSPAGE, multiple bands and one more intense can be seen at about 27kDa corresponding to the GST-10His, before purification(fig13.2). After purification, only one the GST-10His band is observed at 27kDa. The band looks as intense as the one before purification(fig13.1).

Comparing the results with the SDS-PAGE and the GST enzymatic activity, we can say that the purification yields are consistent with the intensity of the bands observed with the SDS-PAGE. Indeed, with the Gluthation-Agarose column, we calculated a purification yield of 32% which is consistent with the diminution of the band size after purification. Likewise, the purification yield of 73% observed with the HisTrap column is consistent with the size of the band. However, the size of the band after HisTrap purification seems to be the as the one before purifcation so the purification yield should be closer to 100%. We have probably lost GST enzymatic activity during the experiments.

To conclude, the HisTrap column seems to be more efficient at purifing the GST-10His protein than the GST-Trap one. Yet, we should not forget that the HisTrap purification System require buffer containing imidazole. Imidazole is irritating and can cause allergies, so we will have to be even more careful when choosing our following Sephadex exclusion chromaztography to exclude small undesired composants. We should maybe try other types of column like the one capable of binding the SUMO protein for example. For the box modelisation, we still decided to use the data obtained with the HisTrap column.

Team:UPMC PARIS/Experiments