Difference between revisions of "Team:ZJU-China/Part Collection"

Line 472: Line 472:
 
                       </li>
 
                       </li>
  
                       <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware">Hardware</a></li>
+
                       <li class="m_nav_item dropdown" >
 +
                          <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Hardware<b class="caret"></b></a>
 +
                          <ul class="dropdown-menu ">
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware">Overview</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware/Device">Device</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware/Improvements">Improvements</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware/MediumWave">Medium Wave</a></li>
 +
                          </ul>
 +
                      </li>
  
 
                       <li class="m_nav_item dropdown" >
 
                       <li class="m_nav_item dropdown" >

Revision as of 17:46, 30 October 2017

Part Collection

It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the Wild-type T7 promoter to get a collection of modified T7 promoters.

T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the site from -20 to -12. The sequences of these modified promoters are shown in the Table below.

Sequences of Modified Promoters

Part numberSequence(-20~+6)
BBa_K525998(wild type)gagtaatacgactcactatagggaaa
BBa_K2207024tagtaatacgactcactatagggaaa
BBa_K2207025aagtaatacgactcactatagggaaa
BBa_K2207026gaataatacgactcactatagggaaa
BBa_K2207027gattaatacgactcactatagggaaa
BBa_K2207028gattaataagactcactatagggaaa
BBa_K2207029gattaatatgactcactatagggaaa
BBa_K2207030tattaatacgactcactatagggaaa

Test

To test the function of mutant promoters, we chose the mRFPas our reporter. By assessing the relative fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure below.

Relative Strength of wildtype T7 promoter and mutant promoters

As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.