Team:CSU Fort Collins/NoteBook/Sep
9.2.16 Nanodropping: C. Limon 1B & 2B in the strataclone vector 1B: 361.4 ng/μL 260/280: 1.84 2B: 368.9 ng/μL 260/280: 1.84 PCR: M1V1 = M2V2 V1B = (2μL)(361.4 ng/μL) / (10ng/μL) = 72.28 μL V1B = (2μL)(361.4ng/μL) / (10ng/μL) = 73.78 μL So, to dilute the plasmids to 10 ng/μL.. 1B: 2μL stock + 70.3μL dH2O 1B: 2μL stock + 71.8μL dH2O Primers: 1B: Limonene Forward + C.limon1R 2B: C.limon2F + LSp2 We have 100μM primers, we want 10μM. M1V1 = M2V2 V = (2μL)(100μM) / (10μM) = 20μL So to dilute the primers… 2μL stock + 18μL dH2O Component 50μl reaction MMix (5 rxns) - 41uL Molecular grade H2O Added first. 27.5 μL 137.5µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL Template DNA 10ng/uL 3μL 15µL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 60 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold 9.3.16 PCR failed. New idea; add DSMO (5% volume). Also try raising the annealing temperature. DMSO: We have 100% DMSO from NEB (0.05)(50µL) = 2.5µL DMSO With DMSO: Component 50μl reaction MMix (5 rxns) - 40uL Molecular grade H2O Added first. 27μL 135µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL 100% DMSO 2.5µL 12.5µL Template DNA 10ng/uL 1μL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 65 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold Without: Component 50μl reaction MMix (5 rxns) - 40uL Molecular grade H2O Added first. 27.5 μL 147.5µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL Template DNA 10ng/uL 3μL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 65 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold Brett Burkart, an employee of the Santangelo lab, gave Casey this protocol for purifying PCR products. PB buffer Add 5x the volume of the combined PCR reactions. Combined PCR reactions PB Buffer 177µL 885µL 3M NaOAc pH 5.2 Add 1/100x the volume of the PCR reaction + PB buffer Working Volume 3M NaOAc pH 5.2 1062µL 10µL Spin through column (may take two runs). Discard flow through. Load column with 750µL ethanol, spin. Discard ethanol, spin 2 minutes to dry. Label 1.7mL eppe. Load 25µL 10mM tris HCl pH 8.5 Spin 2 mins. collect in labeled eppe. Load 25µL 10mM tris HCl pH 8.5 Spin 2 mins. collect in same labeled eppe. 9.20.16 Dr. Peebles discovered the there was no overlap between our insert and vector. The infusion cloning could not have worked. New primers Forward: GGC CGC AAA AAA GTC GAA TGC GCG TTG CGG CAG TCG melt temp: 77.7 ºC homologous region: A TGC GCG TTG CGG CAG TCG melt temp: 70.6 ºC Reverse: CAA AAT GCG CGT TGC GGC AGA GCG GCC GCA AAA AAG TCG AC melt temp: 78.4 homologous region: AGCGGCCGCAAAAAAGTCGAC melt temp: 68.3 ºC 9.22.16 Picked up new primers & resuspended. 9.26.16 PCR with new primers, from strataclone vector. Component 50μl reaction MMix (5 rxns) - 41uL Molecular grade H2O Added first. 27.5 μL 137.5µL 5x GC Buffer 10μL 50µL 25 mM dNTPs 0.5μL 2.5µL Primer 1(10μM) 2μL Primer 2 (10μM) 2μL Template DNA 10ng/uL 3μL 15µL Tom’s Phusion DNA polymerase Added last 5uL Cycle Step 3-step protocol Cycles Temp (oC) Time Initial denaturation 98 2 min 1 Denaturation Anneal 98 60 10s 10s Extension 72 2 min 40 Final Extension 72 1 Hold 4 hold
