How to use
If you want to use it, you should digest it with the enzyme PstI and XbaI to get the
fragments. Then you need to add the restriction sites on both sides of the sequence
by PCR. A pair of reference primers below is provided.
Forward: cgtaagcttatgaccgagacatctcaggtggcccctgccggcggcagggaaaataac
Reverse: tatggatccttacgaggagattctcttgttg
Most importantly, you need to clone the parts into the commonly used eukaryotic
expression vector pcDNA3.1+. As shown, you also need to digest the vector with HindIII
and BamHI endonuclease in advance.
Sequencing results of OR1A1
Proof of expression
Sensitivity Testing
Test the sensitivity and specificity of this basic odor biosensors with their cognate
odors β-citronellol by qPCR.
Cloning into lenti sgRNA(MS2)-puro backbone vector for CRISPRa（gRNA）
Referencing to some papers, we knew that there are three genes which can help the olfactory
receptors anchored in the membrane. So we aimed to activate these three key accessory
protein to enhance the express of odor receptors.
|
Part
|
Plasmid Construction
|
Transformation to Host Strain
|
| GNAL |
Lenti MS2 |
E.coli.DH5α
|
| RIC8B |
Lenti MS2 |
E.coli.DH5α
|
| RTP1 |
Lenti MS2 |
E.coli.DH5α
|
Virus infection experiment
First, we transfected HEK293 with lenti dCAS9-VP64-Blast, lenti MS2-P65-HSF1-Hygro and
lenti sgRNA to produce virus.
Then, we infected HEK293 with the virus of dCAS9-VP64-Blast and MS2-P65-HSF1-Hygro
to construct stable cell lines. Based on these cell lines, we infected different
sgRNAs of GNAL, RIC8B and RTP1 respectively.
This are the results of real-time PCR.
These three graphs show that our sgRNAs has successfully activated the three genes
that mentioned before.
As for the cAMP-activated reporter gene system, we choose Forskolin to induce expression
of the reporter gene, and expression of the reporter protein luciferase was confirmed
by treatment with 10 millimole（mM）forskolin.
After a 24 h incubation, cracked the cell and added the substrate reacting with luciferase,
then detected it by fluorescent microplate reader. Here is the data we got. Cells
expressing luciferase treated only with 0.1%DMSO was used as a negative control.
We can see that the luminescence data gets significantly improved, which proves that
the reporter gene we choose is available.
Here comes the most essential experiment. We infected the stable cell lines with
all virus to construct a super cell line, which has a high expression of the three
genes. Then we transfected OR1A1 and OR1D2 respectively in the super cell, and stimulated
with β-citronellol and bourgeonal, which can recognized by OR1A1 and OR1D2 respectively.
At last, we used Firefly Luciferase Assay Kit to test the cyclic AMP (cAMP) signal
pathway.
This is the luminescence result of OR1A1.
OR1A1 biosensor evaluation with its cognate odor molecule
Here comes the most essential experiment. We infected the stable cell lines with all
virus to construct a super cell line, which has a high expression of the three genes.
Then we transfected OR1A1 and OR1D2 respectively in the super cell, and stimulated
with β-citronellol and bourgeonal, which can recognized by OR1A1 and OR1D2 respectively.
At last, we used Firefly Luciferase Assay Kit to test the cyclic AMP (cAMP) signal
pathway.
This is the luminescence result of OR1A1.
Conclusion：By using the Luciferase Assay Kit,we can see that the luminescence
of super cell transfected with OR1A1 is significantly higher than that in the control
group——the normal 293FT and odorless stimulated control group, which confirming the
feasibility of the biosensor we built.
