Difference between revisions of "Team:Utrecht/"

Line 286: Line 286:
 
<div class="sections" data-key="exp">
 
<div class="sections" data-key="exp">
 
<div class="section" data-url="secretion">
 
<div class="section" data-url="secretion">
−
<div class="thumb"></div>
+
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/a/a2/Utrecht17_extracellular.png"></div>
 
<div class="text">Cas9 & Cpf1 secretion<br/>and activity</div>
 
<div class="text">Cas9 & Cpf1 secretion<br/>and activity</div>
 
<div class="desc">Comparison of endonuclease activity for Cas9 and Cpf1 that has been produced in, and excreted by, HEK293 cells.</div>
 
<div class="desc">Comparison of endonuclease activity for Cas9 and Cpf1 that has been produced in, and excreted by, HEK293 cells.</div>
Line 296: Line 296:
 
</div>
 
</div>
 
<div class="section" data-url="outcasst">
 
<div class="section" data-url="outcasst">
−
<div class="thumb"></div>
+
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/6/64/Utrecht17_production.png"></div>
 
<div class="text">OUTCASST system production</div>
 
<div class="text">OUTCASST system production</div>
 
<div class="desc">Detailed explanation of the OUTCASST mechanism, experimental progress and technical prospects.</div>
 
<div class="desc">Detailed explanation of the OUTCASST mechanism, experimental progress and technical prospects.</div>
Line 307: Line 307:
 
<div class="section" data-url="interlab-study">
 
<div class="section" data-url="interlab-study">
 
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/6/63/Interlab1.png"></div>
 
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/6/63/Interlab1.png"></div>
−
<div class="text">Interlab study participation</div>
+
<div class="text">InterLab study participation</div>
−
<div class="desc">Results and details of our measurements for the iGEM 2017 Interlab Study.</div>
+
<div class="desc">Results and details of our measurements for the iGEM 2017 InterLab Study.</div>
 
</div>
 
</div>
 
</div>
 
</div>
Line 314: Line 314:
 
<div class="sections" data-key="hp">
 
<div class="sections" data-key="hp">
 
<div class="section" data-url="stakeholders">
 
<div class="section" data-url="stakeholders">
−
<div class="thumb"></div>
+
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/2/22/Utrecht17_stakeholder.png"></div>
 
<div class="text">Stakeholders & opinions</div>
 
<div class="text">Stakeholders & opinions</div>
 
<div class="desc">Interviews and dialogues with stakeholders, potential users, third parties and experts relating to pathogen detection or DNA-based diagnostics.</div>
 
<div class="desc">Interviews and dialogues with stakeholders, potential users, third parties and experts relating to pathogen detection or DNA-based diagnostics.</div>
Line 324: Line 324:
 
</div>
 
</div>
 
<div class="section" data-url="product-design">
 
<div class="section" data-url="product-design">
−
<div class="thumb"></div>
+
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/6/60/Utrecht17_design.png"></div>
 
<div class="text">Design & integration</div>
 
<div class="text">Design & integration</div>
 
<div class="desc">OUTCASST toolkit and product design with factors such as bio-safety and user-friendliness taken into account.</div>
 
<div class="desc">OUTCASST toolkit and product design with factors such as bio-safety and user-friendliness taken into account.</div>
Line 337: Line 337:
 
</div>
 
</div>
 
<div class="section" data-url="sponsors">
 
<div class="section" data-url="sponsors">
−
<div class="thumb"></div>
+
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/d/db/Utrecht17_Sponsor.png"></div>
 
<div class="text">Sponsors</div>
 
<div class="text">Sponsors</div>
 
<div class="desc">A listing of our sponsors, how they assisted us and our gratitude for their assistance.</div>
 
<div class="desc">A listing of our sponsors, how they assisted us and our gratitude for their assistance.</div>
Line 437: Line 437:
  
 
<script id="page-secretion" type="text/template">
 
<script id="page-secretion" type="text/template">
−
<div class="page-heading">Secretion</div>
+
<div class="page-heading">Secreting functional Cas9 and Cpf1</div>
−
ok
+
In order to realize OUTCASST it is crucial to verify the activity of the two DNA-sensing elements. In our system, these are Cas9 and Cpf1. This experiment is a novelty in itself. To put the gravity of this experiment into perspective, as of today, there is no evidence of catalytically active secreted Cas9 or Cpf1.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-2">Introduction</h2>
 +
In this experiment, we aim to secrete the two extracellular protein domains of the OUTCASST two-component fusion-protein system, Cas9 and Cpf1, and subsequently prove their functionality. This is a critical step in the process as the proteins should have the  ability to bind DNA when implemented as the extracellular domains of OUTCASST. We conducted this experiment by creating genes for secretable Cas9 and Cpf1, using the same signal tag that is also used for the eventual OUTCASST proteins. These genes were inserted into bacterial plasmids, which were multiplied and transfected to mammalian cells. The protein was collected, purified and tested for functionality. If these products prove to be fully functional, they can be implemented in the final design.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-3">Methods</h2>
 +
 
 +
SECTION 1: CREATING THE DNA CONSTRUCTS
 +
<br><br>
 +
The DNA sequences coding for Cas9 or Cpf1 were modified to contain an N-terminal signal sequence and a C-terminal His-tag. A kozak sequence was placed in front of the protein coding region. This was then placed in a backbone plasmid containing a CMV promotor.
 +
<br><br>
 +
<b>AsCpf1:</b>
 +
<ol>
 +
<li>PCR was performed using the following plasmid and primers, to create a fragment containing Cpf1 with a C-terminal Histag and overlap region for the final backbone plasmid.<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Plasmid: Lenti-AsCpf1-Blast (from Addgene, nr: 84750)<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Fw primer 5’-3’: TCATCGAGGAGGACAAGGCCC<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rv primer 5’-3’: GCCGCTTACTTGTACTTAATGATGATGATGATGATGGCCG CCGCCGTTGCGCAGCTCCTGGATGTAG<br>
 +
Protocol: Experimental\Protocols\Wiki ready\Cpf1 PCR protocol.pdf
 +
</li>
 +
<li>gBlock containing a kozak sequence, signal sequence and overlap regions with the backbone and Cpf1 was ordered from IDT. See snapgene file below for sequence</li>
 +
<li>In-Fusion Cloning was then performed using AgeI and BsrGI to linearize the backbone plasmid and the two previously created fragments.<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Plasmid: pCAGGS_eGFP
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Protocol: Experimental\Protocols\Wiki ready\InFusion protocol v2.pdf
 +
</li>
 +
</ol>
 +
 
 +
<br>
 +
 
 +
<b>Cas9:</b>
 +
<ol>
 +
<li>PCR was performed using the following plasmid and primers, to create a fragment containing Cas9 with a C-terminal Histag and overlap region for the final backbone plasmid.<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Plasmid: Lenti-Cas9-Blast (from Addgene, nr: 52962)<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Fw primer 5’-3’: ATTCAAGGTGCTGGGCAACAC<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rv primer 5’-3’: GCCGCTTACTTGTACTTAATGATGATGATGATGATGGCCG CCGCCGTCGCCTCCCAGCTGAGACA<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Protocol: Experimental\Protocols\Wiki ready\Cas9 PCR protocol.pdf
 +
</li>
 +
<li>PCR was performed to create a second fragment containing a kozak region, the signal sequence and the first part of Cas9 (without its methionine).<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Plasmid: Lenti-Cas9-Blast (from Addgene)<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Fw primer 5’-3’: CCCGGGATCCACCGGTGCCGCCACCATGGCGTGG ACCAGCCTGATTCTGAGCCTGCTGGCGCTGTGCAGCGGCGCGAGCAGCG ACAAGAAGTACAGCATCGGCCTG<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rv primer 5’-3’: CCCAGCACCTTGAATTTCTTGCTG<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Protocol: Experimental\Protocols\Wiki ready\PCR Cas9 gBlock.pdf
 +
</li>
 +
<li>In-Fusion Cloning was then performed using AgeI and BsrGI to linearize the backbone plasmid and the two previously created fragments.<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Plasmid: pCAGGS_eGFP<br>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Protocol: Experimental\Protocols\Wiki ready\InFusionprococol v2.pdf
 +
</li>
 +
</ol>
 +
 
 +
<br><br>
 +
 
 +
SECTION 2: TRANSFECTION INTO HEK293T CELLS<br>
 +
HEK293t cells were cultured according to cell culture protocol [Experimental\Protocols\Wiki ready\Cell culture protocol.pdf]. We transfected the cells with the midiprepped plasmids according to the Lipofectamine 2000 transfection protocol [Experimental\Protocols\Wiki ready\Lipofectamine 2000 transfection protocol.pdf].
 +
For protein purification under denaturing conditions, HEK cells in 6 wellplate wells were transfected. For protein purification under native conditions, HEK cells in 10 cm petridishes were cotransfected (9:1 plasmid of interest : plasmid containing GFP).
 +
 
 +
<br><br>
 +
SECTION 3: PROTEIN PURIFICATION UNDER DENATURING CONDITIONS<br>
 +
Secreted and His-tagged Cas9 and Cpf1, which will be referred to as sCas9 and sCpf1, respectively, were purified from the medium using Ni-bead purification, according to protocol [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\Purification of cells and medium secreted cpf1 and cas9.pdf]. Also, whole-cell lysates were made, following the same protocol, to check for possible accumulation of sCas9 or sCpf1 in HEK293t cells.
 +
 
 +
<br><br>
 +
SECTION 4: VERIFYING THE PRESENCE OF HIS-TAGGED PROTEINS IN THE MEDIUM<br>
 +
The presence of sCas9 and sCpf1 was verified using SDS-PAGE and Western Blots. Proteins were separated using SDS-PAGE using the following protocol [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\General Protocol_ SDS-PAGE & Western Blot.pdf].
 +
10% acrylamide running gels, and stacking gels were made according to the following protocol [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\Preparing SDS-PAGE gels.pdf]. Western Blots were carried out according to the same protocol as for the SDS-PAGE.
 +
The secreted proteins were incubated with mouse anti-His6x (using dilutions of 1:2000 and 1:5000) and rabbit anti-Cas9 or rabbit anti-Cpf1 (using dilutions of 1:2000). The secondary antibody wa      s a goat anti-mouse for the Histag and goat anti-rabbit for both Cas9 and Cpf1, with a horseradish peroxidase (HRP) conjugate to verify the presence of secreted proteins.
 +
 
 +
<br><br>
 +
SECTION 5: PROTEIN PURIFICATION UNDER NATIVE CONDITIONS<br>
 +
Proteins were purified using Ni-NTA superflow columns, according to the following protocol  [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\Ni-NTA superflow colums protocol]. No imidazole in the pre- and washing buffers was used. Additionally, 50 ul samples were taken of the pellet, supernatant, filtered supernatant, and the runthrough.
 +
Whole cell lysates were made using protocol [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\Purification of cells and medium secreted cpf1 and cas9.pdf] to check for possible accumulation of sCas9 or sCpf1 in Hek293t cells.
 +
 
 +
<br><br>
 +
SECTION 6: IN VITRO ENDONUCLEASE ACTIVITY ASSAY<br>
 +
After successful purification of sCas9-His6x and sCpf1-His6x and subsequent verification of the presence of the aforementioned proteins, an in vitro endonuclease activity assay was carried out. The in vitro endonuclease activity assay was used to assess whether or not our secreted and, in all likelihood, glycosylated sCas9-His6x and sCpf1-His6x would still exhibit sgRNA-binding- and endonuclease activity. The assay was executed according to the protocol [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\Nuclease activity assay.pdf].  Linearized plasmid 51-dPAM (823 bp) [Google Drive\iGEM 2017\Experimental\SnapGene\Secreted Cas  or Cpf\Endonuclease Activity Assay\1_8_2017\51_dPAM 800bp.dna] was used as the target for sCas9-His6x and His6x-Cpf1. Two sgRNAs were used that were tailored to be bound by either Cas9 or Cpf1: [iGEM 2017\Experimental\SnapGene\Secreted Cas  or Cpf\Endonuclease Activity Assay\SpCas9_gRNA1_Tet-luc.dna] and [iGEM 2017\Experimental\SnapGene\Secreted Cas  or Cpf\Endonuclease Activity Assay\AsCpf1_sgRNA.dna] , respectively. Both sgRNAs were complementary to roughly the same region of the aforementioned linearized plasmid, which would result in two cut fragments of ~260 bp and ~560 bp for both His6x-Cas9 and His6x-Cpf1. The efficacy of these sgRNAs, both in binding to the target region in the linearized plasmid, and binding to either Cas9 or Cpf1 were also assessed. As positive controls we used unmodified Cas9 and Cpf1 produced by Escherichia coli, coupled with their respective sgRNAs and the linearized target plasmid. The negative controls consisted of the linearized plasmid with either Cas9 or Cpf1 without sgRNA, and a third negative control with the linearized plasmid only. Subsequently, the samples were separated by DNA gel
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-4">Results</h2>
 +
 
 +
SECTION 1: CREATING THE DNA CONSTRUCTS<br>
 +
As mentioned at the methods, the plasmid sequences and features can be viewed at:<br>
 +
<br>
 +
<img width="600" src="https://static.igem.org/mediawiki/2017/8/8e/Uuextra_figure1.png">
 +
<br>
 +
<b>Snapgene file:</b> iGEM 2017\Experimental\SnapGene\Secreted Cas  or Cpf\  pCAGGS_sigseq_Cpf1_Histag.dna<br>
 +
<br>
 +
and<br>
 +
<br>
 +
<img width="600" src="https://static.igem.org/mediawiki/2017/3/3e/Uuextra_figure2.png"><br>
 +
<b>Snapgene file:</b> iGEM 2017\Experimental\SnapGene\Secreted Cas  or Cpf\  pCAGGS_sigseq_Cas9_Histag.dna<br>
 +
<br>
 +
<b>Table 1. Nanodrop results of midiprepped plasmids</b>
 +
<table width="450">
 +
<tr>
 +
<td><b>Plasmid</b></td>
 +
<td><b>Concentration (ng/ul)</b></td>
 +
</tr>
 +
<tr>
 +
<td>pCAGGs_sigseq_Cas9_Histag</td>
 +
<td>809,7</td>
 +
</tr>
 +
<tr>
 +
<td>pCAGGs_sigseq_Cpf1_Histag</td>
 +
<td>1322</td>
 +
</tr>
 +
<tr>
 +
<td>Lenti Cas9</td>
 +
<td>2593,9</td>
 +
</tr>
 +
<tr>
 +
<td>Lenti Cpf1</td>
 +
<td>1312,7</td>
 +
</tr>
 +
</table>
 +
<br><br>
 +
 
 +
SECTION 2: TRANSFECTION INTO HEK293T CELLS
 +
Lipofectamine 2000 has a high transfection efficiency and at the time no fluorescent microscope was available. Therefore we did not do a cotransfection of the plasmids with eGFP at the small batch (denaturing conditions). The transfection success was verified by the Western Blot results (See results of section 4?)
 +
 
 +
During transfection of the big batch (native conditions) we had a fluorescent microscope available and therefore the plasmids were cotransfected with eGFP (figure xa and xb).
 +
 
 +
<br>
 +
<img src="https://static.igem.org/mediawiki/2017/e/e1/Uutransfectionhekcells.png">
 +
<br>
 +
Figure x. Fluorescent microscope image of HEK293t cells cotransfected with eGFP and pCAGGs_sigseq_Cas9_Histag (a) and pCAGGs_sigseq_Cpf1_Histag (b) (plasmid ratio 1:9). In both cases, eGFP expression is clearly visible, indicating successful cotransfections.
 +
 
 +
<br><br>
 +
SECTION 3: PROTEIN PURIFICATION UNDER DENATURING CONDITIONS<br>
 +
<br>
 +
<img width="600" src="https://static.igem.org/mediawiki/2017/e/e7/Uuwestern.png">
 +
<br>
 +
figure x: Western blots of Cpf1 and Cas9, using anti-Cas9 and anti-Cpf1 antibodies. In both cases, the purified protein shows a band, suggesting the successful secretion of Cpf1 and Cas9.
 +
 
 +
<br><br>
 +
SECTION 4: ACTIVITY ASSAY<br>
 +
<br>
 +
<img src="https://static.igem.org/mediawiki/2017/5/54/Uuactivityassay1.png">
 +
<br>
 +
Figure x. DNA gel electroforesis of the linearized 800bp 51_dPAM plasmid, cut by either normal  Cas9 or  normal Cpf1. Lanes from left to right are 1. ladder , 2. Cas9 + 0,5 uM gRNA, 3. Cas9 + 1 uM gRNA, 4.Cas9 + 2 uM gRNA, 5. Cas9 // no gRNA, 6. Cpf1 + 1 uM gRNA, 7. Cpf1 + 5 uM gRNA, 8. Cpf1 + 10 uM gRNA, 9. Cpf1 // no gRNA, 10. only plasmid. Concentration of Cas9 and Cpf1 used in the assay were 0,05 and 0,15, respectively. Red in the image is an artefact due to the software. As can be seen in lanes 6-8, normal Cpf1 cleaves
 +
<br>
 +
<br>
 +
<img src="https://static.igem.org/mediawiki/2017/3/39/Nocleavagedetected.png">
 +
<br>
 +
Figure x:
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-5">Discussion</h2>
 +
&hellip;
 
</script>
 
</script>
  
 
<script id="page-mesa-replication" type="text/template">
 
<script id="page-mesa-replication" type="text/template">
−
<div class="page-heading">MESA replication</div>
+
<div class="page-heading">MESA construct replication</div>
−
abc
+
 
 +
The architecture we use for OUTCASST is inspired by the Modular Extracellular Sensor Architecture (MESA) (Daringer, N. M., Dudek, R. M., Schwarz, K. A., & Leonard, J. N., 2014: Modular extracellular sensor architecture for engineering mammalian cell-based devices. ACS synthetic biology, 3(12), 892-902, http://pubs.acs.org/doi/abs/10.1021/sb400128g) (Schwarz, K. A., Daringer, N. M., Dolberg, T. B., & Leonard, J. N. 2017: Rewiring human cellular input-output using modular extracellular sensors. Nature chemical biology, 13(2), 202-209, http://www.nature.com/nchembio/journal/v13/n2/abs/nchembio.2253.html?foxtrotcallback=true). Because of this, MESA first needed to be replicated to verify whether the final product could work as intended. A successful replication will serve as an indication that OUTCASST would work, as well as provide data we can use to compare and correct models of the system.
 +
<br>
 +
<br>
 +
The first few weeks, we tried to replicate the MESA construct using Luciferase-GFP fusion protein as the output signal and dsRED as a transfection control. After  a Skype Call with the MESA authors we decided to use YFP as the output signal and BFP as a transfection control to prevent signal overlap, equivalent to the ones they used.
 +
 
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-2">Introduction</h2>
 +
MESA is a protein structure with an extracellular domain, a transmembrane domain and an intracellular domain. It can be used as a sensor by having two different protein chains with, on the extracellular region, an element to cause dimerization and, on the intracellular region, a combination of a protease on one chain and a transcription factor on the other. The transcription factor can be cleaved off by the protease when the two chains dimerize, either through a ligand or randomly. Subsequently, the transcription factor travels to the nucleus where it induces transcription of a reporter (Figure 1).
 +
<br>
 +
<img src="https://static.igem.org/mediawiki/2017/6/69/Uumesa_figure1.png">
 +
<br>
 +
<b>Figure 1.</b> The MESA signalling pathway. The MESA cell signalling pathway consists of a target chain (TC), a protease chain (PC) and a ligand which can bind both the extracellular domains. The TC has a transcription factor on the intracellular part of the protein, while the PC has a protease which can cleave off the aforementioned transcription factor. The ligand, in this case VEGF, binds both chains, which allows the protease to be close enough to do this. The released transcription factor subsequently travels to the nucleus to induce a reporter gene. Image modified from:(Daringer, N. M., Dudek, R. M., Schwarz, K. A., & Leonard, J. N., 2014: Modular extracellular sensor architecture for engineering mammalian cell-based devices. ACS synthetic biology, 3(12), 892-902, http://pubs.acs.org/doi/abs/10.1021/sb400128g)
 +
<br><br>
 +
The MESA constructs that inspired OUTCASST, and therefore need to be verified in this chapter, are V2-MESA-35F-M-tTA and V2-MESA-35F-TEV. These chains have an extracellular domain which binds vascular endothelial growth factor (VEGF) with an intracellular region each. For V2-MESA-35F-M-tTA, the  intracellular region is the tetracycline-controlled transactivator (tTA) and a Tobacco Etch Virus (TEV) protease for V2-MESA-35F-TEV. pL3-TRE-LucGFP-2L  and pBI-MCS-EYFP were used as reporter plasmids, which express luciferase-GFP fusion protein and yellow fluorescent protein (YFP), respectively.
 +
<br><br>
 +
A Cre reporter has constituently active dsRED and was used as transfection control. In our later experiments with YFP, blue fluorescent protein (BFP) was used as a transfection control to avoid spectrum overlap.
 +
<br><br>
 +
Replicating this system is of major importance to our final DNA Biosensor design because we need to verify that the same approach would work for our system as well. Finally, we would compare it to model data and to benchmark output. Unfortunately, we could not reach this stage.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-3">Materials</h2>
 +
<ul>
 +
<li />V2-MESA-35F-M-tTA (https://www.addgene.org/84502/)
 +
<li />V2-MESA-35F-TEV (https://www.addgene.org/84503/)
 +
<li />pL3-TRE-LucGFP-2L (https://www.addgene.org/11685/)
 +
<li />Cre reporter (https://www.addgene.org/62732/)
 +
<li />pBI-MCS-EYFP (http://www.addgene.org/58855/)
 +
<li />pSLQ-Set1-BFP (not on addgene)
 +
<li />VEGF-164 (cat.: 583102, biolegend)
 +
</ul>
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-4">Methods</h2>
 +
We seeded HEK293T in a 24-well plate with mEF media and 1% penicillin-streptomycin. 24 h post-seeding the cells were transfected according to Table 1 in the supplement. The amounts of the plasmid in ng were the same between the wells for all different plasmids aside from the reporter plasmids and controls. Per well 180 ng of V2-MESA-35F-M-tTA; 15 ng of V2-MESA-35F-TEV and 25 ng of either pSLQ-Set1-BFP or Cre reporter was used. For reporter plasmids pL3-TRE-LucGFP-2L and pSLQ-Set1-BFP, four different amounts were used, namely 250 ng, 275 ng, 300 ng and 350 ng. Wells where the total amount of plasmid was less than 500 ng were supplemented with random  DNA up to a total of 500 ng.
 +
<br><br>
 +
The media was refreshed 24 h post transfection and 250 ng of VEGF was added per mL of media. The results were obtained by FACS (BD FacsAria Fusion machine) approximately 18 h later.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-5">Results</h2>
 +
The results of the flow cytometry analysis are shown in table 1. The GFP and YFP reporter plasmid concentrations for transfection were varied between 250 ng and 350 ng per well. After adding VEGF, GFP signal increased in all samples except for the sample containing 250 ng GFP, which showed a decrease. The cells that were transfected with a GFP concentration of 350 ng showed the greatest increase in GFP activity (9.2%). In figure 2 the FACS plots for 350 ng GFP are shown.
 +
<br><br>
 +
<b>Table 1.</b> Heatmap of the flow cytometry data. The percentages shown is the relative difference of fluorescence compared to control. The colour scale has been set with a minimum of -19.4%, a midpoint of 0% and maximum of 27.1%. Overall, signal induction appears to be more efficient with the YFP plasmid, but the data is inconsistent.
 +
<br>
 +
<img width="600" src="https://static.igem.org/mediawiki/2017/7/70/Uufacsheatmap.png">
 +
<br>
 +
<br>
 +
 
 +
For the YFP samples, all concentrations showed an increase in YFP activity (including the control samples). The greatest increase was observed in the samples containing 300 ng YFP, with a 27.9% increase. In figure 3 the FACS plots for 300 ng YFP are shown. Furthermore, the samples with 350 ng YFP showed a markedly lower increase in activity (1.2%). In general the YFP samples showed a greater increase in activity than the GFP samples.
 +
 
 +
<br><br>
 +
 
 +
<img src="https://static.igem.org/mediawiki/2017/1/1c/Uumesafigure2.png"> <img src="https://static.igem.org/mediawiki/2017/d/dc/Uumesafigure2b.png">
 +
<br>
 +
<b>Figure 2.</b> 350 ng GFP. (Left) Plot before adding VEGF. (Right) Plot after adding VEGF. [GFP] is GFP activity.
 +
<br>
 +
<br>
 +
 
 +
<img src="https://static.igem.org/mediawiki/2017/7/74/Uumesafigure3a.png"> <img src="https://static.igem.org/mediawiki/2017/e/ed/Uumesafigure3b.png">
 +
<br>
 +
<b>Figure 3.</b> 300 ng YFP. (Left) Plot before adding VEGF. (Right) Plot after adding VEGF. [Q2] is YFP activity.
 +
<br><br>
 +
 
 +
The experiment was repeated with duplicates of samples with 275 and 300 ng YFP and 350 and 450 ng GFP (table 1). All GFP samples show a decrease except for one which shows a negligible increase in GFP activity after adding VEGF. The duplicates did not give similar results, especially for the 450 GFP samples.
 +
<br><br>
 +
 
 +
YFP samples show a little induction, but there are, again, large differences between duplicates. The first 275 YFP sample can not be included because media was not refreshed prior to transfection, which was done in all the other samples. This could explain the odd result. The second YFP 300 sample showed 10.8% increase in YFP activity after adding VEGF, but the other YFP 300 sample showed hardly any induction.
 +
<br><br>
 +
 
 +
In figure 4 extra controls are shown, comparing 300 ng YFP with target chain but without the protease chain to 300 ng YFP with both the target and protease chain (all without VEGF). The same is shown for 350 ng GFP, in figure 5. There is not much difference in intensity between the sample with protease chain compared to without.
 +
<br><br>
 +
 
 +
<img src="https://static.igem.org/mediawiki/2017/4/4b/Uumesafigure4a.png"> <img src="https://static.igem.org/mediawiki/2017/2/27/Uumesafigure4b.png">
 +
<br>
 +
<b>Figure 4.</b> 300 ng YFP. (Left) with protease chain. (Right) without protease chain. [Q2] is YFP activity.
 +
 
 +
<br>
 +
<br>
 +
 
 +
<img src="https://static.igem.org/mediawiki/2017/0/0b/Uumesafigure5a.png"> <img src="https://static.igem.org/mediawiki/2017/f/fe/Uumesafigure5b.png">
 +
<br>
 +
<b>Figure 5.</b> 350 ng GFP. (Left) with protease chain. (Right) without protease chain. [GFP] is GFP activity.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-6">Discussion</h2>
 +
 
 +
The goal of these experiments was to verify the MESA system in our own lab. We had little success in the matter. In the original article the authors managed to achieve a doubling of output when the ligand was added, while we only achieved 25% more signal at best. The output also was inconsistent. Any number of reasons can be the cause of this. The most likely explanation is the difference in amount of plasmid we added compared to the original authors. Due to the costs of transfection, less plasmid of each kind was used. Though the absolute amount of plasmid was reduced, the ratio of the TC plasmid and PC plasmid was maintained. The ratio between the TC/PC plasmids and the reporter plasmid were not maintained however. A possible cause for the lack of output might be that too little of reporter plasmid was used. This however seems unlikely, since in our latest experiments the amounts of reporter plasmid were similar to the amounts the original authors used. Rather, it could be that the amount of TC/PC plasmids used was too little compared to reporter plasmid. Another difference is the method of transfection; we used lipofectamine for transfectio n. This, coupled with the differences in plasmid amounts could have some influence on the results.
 +
<br><br>
 +
 
 +
The results were inconsistent. Even between duplicates we found large differences in outcome. Possible explanations include, for example, errors during preparation of the samples and differences in the duration under trypsin. However, the latter can not explain the inconsistency between duplicates.
 +
<br><br>
 +
 
 +
The controls of the MESA system, with only the target chain without the protease chain, showed a similar level of signal as the samples with both chains, as was seen in figure 4 and 5. This could imply that the MESA plasmids that were used are not functional, as it is expected that the target chain on it’s own will show minimal background signalling. Alternatively it could imply that the reporter is very leaky, showing little differences between TC, TC/PC and TC/PC with VEGF. Additionally, we used mEF media for cell culturing, which also contains fetal bovine serum. Fetal bovine serum can contain VEGF, although we would assume this amount is negligible compared to the amount of VEGF we add.
 +
<br><br>
 +
 
 +
In conclusion, the MESA system still needs tuning to function in our lab. The  best option would be to use the same transfection method as the original authors did and use the exact same amounts of each plasmid. To be sure, DMEM medium could be used rather than mEF. If it does not work in spite of these changes, it is important to look for other potential reasons.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-7">Supplementary</h2>
 +
 
 
</script>
 
</script>
  
 
<script id="page-outcasst" type="text/template">
 
<script id="page-outcasst" type="text/template">
−
<div class="page-heading">OUTCASST</div>
+
<div class="page-heading">OUTCASST system production</div>
−
1
+
After the replication of the MESA construct and testing the activity of secreted Cas9 and Cpf1, we sought to combine these two components into their final form: the OUTCASST system.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-2">Introduction</h2>
 +
To produce the OUTCASST system, catalytically inactive Cas9 and Cpf1 need to be expressed on the extracellular domain of the MESA construct instead of the original extracellular VEGF binding domain. The first step in this process is to make dead versions of Cas9 and Cpf1 (dCas9 and dCpf1) by introducing mutations. This way the two proteins won’t be able to cut the DNA strands in separate pieces and are only able to bind the DNA. When our target DNA remains in one pieces it makes co-localization of the two transmembrane proteins possible. For the OUTCASST system, we substituted dCas9 for the extracellular domain of the MESA chain with the Tobacco Etch Virus (TEV) protease and we substituted dCpf1 to the MESA chain with the tetracycline-controlled transactivator (tTA). Lastly, we wanted to test the OUTCASST system for functionality and optimize it. However, we ran into problems while substituting the extracellulair domains of MESA for dCas9 and dCpf1 and therefore we did not test the functionality of the OUTCASST system, unfortunately.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-3">Materials</h2>
 +
 
 +
Plasmids
 +
<ul>
 +
<li />lenti-Cas9-Blast (https://www.addgene.org/52962/)
 +
<li />lenti-AsCpf1-Blast (https://www.addgene.org/84750/)
 +
<li />V2-MESA-35F-M-tTA (https://www.addgene.org/84502/)
 +
<li />V2-MESA-35F-TEV (https://www.addgene.org/84503/)
 +
<li />pL3-TRE-LucGFP-2L (https://www.addgene.org/11685/)
 +
<li />Cre reporter (https://www.addgene.org/62732/)
 +
</ul>
 +
<br>
 +
Primers for mutagenisis
 +
<ul>
 +
<li />dCAS9 D10A fw: tacagcatcggcctggcaatcggcaccaactctg
 +
<li />dCAS9 D10A rv: cagagttggtgccgattgccaggccgatgctgta
 +
<li />dCAS9 H840A fw: cgactacgatgtggacgctatcgtgcctcagagc
 +
<li />dCAs9 H840A rv: gctctgaggcacgatagcgtccacatcgtagtcg
 +
<li />dCpf1 D908A fw: ctatcatcggcatcgctcggggcgagagaaa
 +
<li />dCpf1 D908A rv: tttctctcgccccgagcgatgccgatgatag
 +
</ul>
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-4">Methods</h2>
 
</script>
 
</script>
  
 
<script id="page-modeling-and-mathematics" type="text/template">
 
<script id="page-modeling-and-mathematics" type="text/template">
 
<div class="page-heading">Modeling and Mathematics</div>
 
<div class="page-heading">Modeling and Mathematics</div>
−
1
+
 
 +
The first thing we did to get a good overview of the system dynamics was to try and graphically represent the chemical interactions of the OUTCASST system as a small reaction network. From this network, we can already see that, if we disregard production and degradation of the proteins  (so under conditions of conservation of mass) all target chain proteins will be cleaved over time. For the eventual equilibrium outcome, the cleavage rate does not matter. It only matters for the duration of equilibrium onset. So, if the cleavage speed is of no importance for the end-result, does it affect sensitivity in another way?
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-2">Optimization of the protease cleavage rate</h2>
 +
Since the concentration of substrate will be exceedingly low for our sensor, the number of binding events due to substrate will also be small. It would be ideal if each binding event would lead to cleavage while transient meetings between the two proteins only rarely lead to cleavage. This would reduce the chance of false positive signals. Considering the great binding affinities of both Cas9 and Cpf1 for gRNA complementary DNA, binding events are much longer in duration than transient meetings of the two proteins.
 +
<br><br>
 +
In the image to the side, you can see a schematic illustration of the difference in half-life of the complex formed by transient and substrate-mediated interaction.
 +
<br><br>
 +
In the image, for clarity, we have taken the half-life of transient complex as 5 arbitrary time units and that of the substrate-mediated complex is set to 100.
 +
<br><br>
 +
In the real system, these values will be much wider apart, but we took these as a clear illustration of the point we wish to make.
 +
<br><br>
 +
Consider two different versions of our system: one with a fast-cleaving protease and the second with a slow-cleaving protease. In the image to the left, we plotted the probability distribution of cleavage occurring over time for these two versions of our Protease Chain protein. Note that the probability that it will cleave over time will always be 1, the timespan wherein this happens simply differs.
 +
For the mathematicians amongst those who are reading this: These plots are simple lognormal distributions, for the distribution cannot take negative values as it is impossible to cleave before the complex has been formed.
 +
<br><br>
 +
We can now see that the probability of cleavage for the slow cleaver is much smaller than that of the fast cleaver in the timespan that the transient complex persists. Of course, the concentration of the substrate-mediated complex decreases over time, so the total cleavage decreases when it cleaves later. To investigate how much the transient and substrate-mediated complex contribute to signal development for both Protease Chain variants, we define:
 +
<br><br>
 +
<b>FORMULA</b>
 +
<br><br>
 +
Wherein S’ is the increase in signal, given by the probability of cleavage (p_c) for the remaining uncleaved complex. The remaining uncleaved complex is given by the remaining complex fraction (C) and how likely it is that it has not already been cleaved (one minus the integral of p_c from 0 until that timepoint).
 +
<br><br>
 +
When we solve this for each Protease Chain version and for both the transient and substrate-mediated complex, we end up with time-plots of the resulting signal contribution of a single binding event over time. In these plots, we can see that, for the slow cleaver, shown in the top image to the left, the resulting substrate-mediated complex signal is about half of that for the fast cleaver, as shown in the lower image. The signal is less strong but, in theory, this is not a problem since the signal can be amplified by the cells.
 +
<br><br>
 +
For the fast cleaver, we can see a much bigger issue. The signal contribution of the transient complex, i.e. the false positive, is ten-fold smaller than the signal contribution of the substrate-mediated complex but, considering that transient encounters will be a lot more frequent than substrate-binding events, the false positive signal can be multiplied many times, making it  a lot stronger than the substrate-mediated signal can ever be. This is not the case for the slower cleaver, where the transient complex signal contribution is in the order of 10^-7, and thus falls on the abscissa.
 +
<br><br>
 +
Using the contributions of a single transient binding event and a single substrate-mediated binding event, we can calculate a proxy for precision by dividing the contribution of the true signal (substrate-mediated) by the contribution of the false signal (transient). For the slow rate, the contribution of a single substrate-mediated event is almost 48 000 times that of the transient occurrence. For the fast cleavage rate, this is only 17 times.
 +
<br><br>
 +
If we assume that the transient interaction occurs 100 times more frequently than the substrate-binding event, ‘true’ signal strength would only be 0.17 times that of the background for the fast cleaver whereas it would still be 480 times stronger than the background for the slow cleaver.
 +
<br><br>
 +
In conclusion, for minimization of false positive results, the cleavage rate should result in a cleavage duration that is near the half-life of the uncleaved complex between target-chain, protease-chain and substrate. Increasing the cleavage rate would not contribute to sensitivity and merely decrease precision.
 +
<br><br>
 +
A full work-out of this demonstration in mathematica notebook can be found <a target=_BLANK href="https://drive.google.com/drive/folders/0B_qbow6tESp8b2FNb3pMa1psLTA">here</a>.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-3">Optimization of protein production rates</h2>
 +
&hellip;
 +
 
 
</script>
 
</script>
  
 
<script id="page-interlab-study" type="text/template">
 
<script id="page-interlab-study" type="text/template">
−
<div class="page-heading">Interlab study</div>
+
<div class="page-heading">InterLab Study 2017</div>
−
1
+
Utrecht 2017 participated in the Fourth International InterLaboratory Measurement Study for the Bronze Medal Requirements. The aim of this year’s study was to produce common, comparable units for measuring green fluorescence protein (GFP) with different plate readers around the world and to see how reliable different RBS test devices are with respect to the reproducibility of their results.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-2">Introduction</h2>
 +
It is very important that measurements in all engineering disciplines are reliable and reproducible. However, the compatibility of measurements in different labs around the world has always been difficult. This is why there is a need for robust measurement procedures. The iGEM Measurement Committee has chosen Green Fluorescent Protein as the measurement marker for this study, as it is one of the most commonly used markers in the lifesciences. For this fourth interlab study, fluorescence measurements were performed with E. coli. Six different GFP expression plasmids and additional positive and negative control plasmids were used. The protocols for this study were provided by the iGEM organisation to ensure method uniformity between participating labs.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-3">Materials</h2>
 +
<ul>
 +
<li />InterLab Parts and Measurement Kit (http://parts.igem.org/Help:2017_DNA_Distribution#Measurement_Kit)
 +
<li />Plate reader: Biotek Synergy HT
 +
<li />E. coli DH5-alpha cells
 +
</ul>
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-4">Methods</h2>
 +
<ul>
 +
<li />Protocol for the transformation of competent E. coli: single tube transformation protocol (http://parts.igem.org/Help:Protocols/Transformation)
 +
<li />Protocol for the plate reader (https://static.igem.org/mediawiki/2017/8/85/InterLab_2017_Plate_Reader_Protocol.pdf)
 +
</ul>
 +
<br>
 +
All eight plasmids were transformed in competent E. coli DH5-alpha cells with heat shock. After incubating overnight at 37°C, single colonies were picked and grown in 5mL LB medium with chloramphenicol. These cultures were grown at 37°C while being shaken at 200 rpm (instead of the recommended 220 rpm).
 +
<br><br>
 +
Ludox-S40 and fluorescein were used to calibrate the OD600 and fluorescence measurements, respectively. To gain a homogeneous bacterial concentration, the OD600 of the overnight cultures were measured and diluted to achieve an OD600 of 0.02.
 +
<br><br>
 +
The OD600 and the fluorescence were measured with the plate reader for all eight different plasmid samples, for both the undiluted and diluted cultures, at different time intervals. The filter settings for excitation and emission for measuring the fluorescence were 485/20 and 528/20, respectively. The gain was set to 35.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-5">Results</h2>
 +
All results were integrated in the Excel template file provided by iGEM. In figure 1 the relative fluorescence expression per cell of the diluted cultures is plotted against the time for all devices i.e. plasmid constructs. Here, it is visible that device 1 has very deviating values relative to the other devices. In figure 2 test device 1 is omitted to get a better view at the other devices. Here it is visible that test devices 3, 5 and 6 follow closer to the negative control, while test devices 2 and 4 follow closer to the positive control.
 +
 
 +
<img width="600" src="https://static.igem.org/mediawiki/2017/6/60/Uuinterlab_figure1.png">
 +
<br><br>
 +
<b>Figure 1.</b> The relative fluorescence per cell over time for the negative and the positive controls and the six test devices of the diluted cultures.
 +
<br>
 +
<br>
 +
<img width="600" src="https://static.igem.org/mediawiki/2017/0/03/Uuinterlab_figure2.png">
 +
<br><br>
 +
<b>Figure 2.</b> The relative fluorescence per cell over time for the negative and the positive controls and test device 2 till 6 of the diluted cultures.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-6">Discussion</h2>
 +
The most notable results are those of test device 1, which deviates most from the other samples. It also has a greater standard deviation in comparison to the rest of the data points, although the  standard deviations for all cases are too small to be visible in the graphs. The results of all teams participating in this year’s Interlab Study will be analysed by iGEM to see which plasmid has the most precise and reliable gene expression. The ultimate aim is to improve the reliability of measurements around the world. We hope that the data generated here has helped in this process.
 
</script>
 
</script>
  
Line 558: Line 913:
  
 
<style type="text/css">
 
<style type="text/css">
 +
.page-container ul, .page-container ol { padding-left: 20px; }
 +
.page-container ul, .page-container ol { text-align: left; }
 +
 
.shuffle-container .aspect:hover { opacity: 1; }
 
.shuffle-container .aspect:hover { opacity: 1; }
  
Line 957: Line 1,315:
 
"secretion" : {
 
"secretion" : {
 
1: "Secretion",
 
1: "Secretion",
−
2: "Hmmmm"
+
2: "Introduction",
 +
3: "Methods",
 +
4: "Results",
 +
5: "Discussion"
 
},
 
},
 
"mesa-replication" : {
 
"mesa-replication" : {
 
1: "MESA replication",
 
1: "MESA replication",
−
2: "Hmmmm"
+
2: "Introduction",
 +
3: "Materials",
 +
4: "Methods",
 +
5: "Results",
 +
6: "Discussion",
 +
7: "Supplementary",
 
},
 
},
 
"outcasst" : {
 
"outcasst" : {
−
1: "OUTCASST",
+
1: "OUTCASST system production",
−
2: "Hmmmm"
+
2: "Introduction",
 +
3: "Materials",
 +
4: "Methods",
 +
5: "Results",
 +
6: "Discussion"
 
},
 
},
 
"modeling-and-mathematics" : {
 
"modeling-and-mathematics" : {
 
1: "Modeling and Mathematics",
 
1: "Modeling and Mathematics",
−
2: "Hmmmm"
+
2: "Optimization of the protease cleavage rate",
 +
3: "Optimization of protein production rates",
 
},
 
},
 
"interlab-study" : {
 
"interlab-study" : {
−
1: "Interlab study",
+
1: "InterLab Study 2017",
−
2: "Hmmmm"
+
2: "Introduction",
 +
3: "Materials",
 +
4: "Methods",
 +
5: "Results",
 +
6: "Discussion",
 
},
 
},
 
"stakeholders" : {},
 
"stakeholders" : {},

Revision as of 19:57, 15 October 2017

<!DOCTYPE html>

  • Home
  • Experimental
  • Human practices
  • Team & Sponsors


Cas9 & Cpf1 secretion
and activity
Comparison of endonuclease activity for Cas9 and Cpf1 that has been produced in, and excreted by, HEK293 cells.
MESA two-component system replication
Details on the MESA two-component system, explanation of its relation to our design and the results of its reproduction.
OUTCASST system production
Detailed explanation of the OUTCASST mechanism, experimental progress and technical prospects.
Modeling and
mathematics
Ordinary differential equations, cellular automaton and an object based model for optimal linker-length estimation.
InterLab study participation
Results and details of our measurements for the iGEM 2017 InterLab Study.
Stakeholders & opinions
Interviews and dialogues with stakeholders, potential users, third parties and experts relating to pathogen detection or DNA-based diagnostics.
Risks & safety-issues
Implications and design considerations relating to safety in the usage and implementation of OUTCASST as a diagnostics tool.
Design & integration
OUTCASST toolkit and product design with factors such as bio-safety and user-friendliness taken into account.
Meet our team
About us, our interests and roles in the team and our supervisors.
Sponsors
A listing of our sponsors, how they assisted us and our gratitude for their assistance.
Achievements
A short description of all that we have achieved during our participation in the iGEM.
Intro
The problem
The system
The OUTCASST two-component system
This year, Utrecht University participates in the iGEM for the first time. We aim to create a cheap DNA detection kit for disease diagnosis that is easy to use and does not rely on complicated sequencing technologies.

The problem

Disease diagnosis is of great importance for healthcare. In developing countries, diagnoses often have to be made based on limited information, even though accurate disease determination based on pathogen specific DNA sequences is possible through sequencing technologies. These technologies, however, require specialised equipment and expertise that simply is not available everywhere. The OUTCASST two-component system and detection kit hopes to alleviate this problem.
Start
2
3
4

The system

The OUTCASST two-component system consists of two proteins, expressed to the membrane of a dryable cell. One of the proteins is a Cas9-fusion and the other contains Cpf1. Both proteins can be given a guide RNA that makes it bind to a specific, user-chosen, complementary sequence. When both proteins bind a DNA fragment from a sample, they co-localize, so that a transcription factor is released intracellularly which then induces an intracellular reporter mechanism such as a dye or fluorescent signal.
Binding of components with search-specific gRNA sequences.

Next
DNA sample fragment binds to one of the components.

Next
Fragment binding with both components induces co-localization.

Next
Protease cleaves, transcription factor is released from complex.