|
|
| Line 105: |
Line 105: |
| | <!--column--> | | <!--column--> |
| | <div class="column" id="column"> | | <div class="column" id="column"> |
| − | <div class="panel panel-default" >
| |
| − | <div class="panel-heading" style="color:#FFF;">
| |
| − | <a href="#panel1" data-toggle="collapse" style="text-decoration:none; " aria-expanded="false"><h4 class="panel-title">01. Transformation </h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel1">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Transformation</div>
| |
| − | <br/>
| |
| − | <p><strong>Requirements: </strong><br/>
| |
| − | —TransGen® Trans5α Chemically Competetent Cell<br/>
| |
| − | —LB broth<br/>
| |
| − | —iGEM DNA Distribution Kit Plates, Plasmid DNA or DNA ligation mix<br/>
| |
| − | —LB agar plates containing 15-100μg/mL antibiotic of choice<br/>
| |
| − | —Nuclease-free 1.5mL microcentrifuge tubes<br/>
| |
| − | —Nuclease-free 0.2mL PCR tubes<br/>
| |
| − | —Water bath of 42°C<br/>
| |
| − | —Shaking incubator of 37°C</p>
| |
| − | <br/>
| |
| − | <p><strong>Before Starting (if you need plasmids from iGEM DNA Distribution Kit Plates):</strong><br/>
| |
| − | 1. Punch a hole with a pipette tip through the foil cover into the corresponding well of the desired BioBrick part.<br/>
| |
| − | 2. Add 10μL sterile deionized water, pipette up and down several times.<br/>
| |
| − | 3. Transfer liquid from Step 2 into a 0.2 mL PCR tube.<br/>
| |
| − | 4. Repeat Steps 2-3 twice.<br/>
| |
| − | 5. Store liquid (BioBrick plasmid) at -20°C.</p>
| |
| − | <br/>
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Add 5-10μL plasmid or ligation system into 50μL fresh competent cells, which is contained in 1.5mL centrifuge tube. Then mix gently.<br/>
| |
| − | 2. Incubate the tube on ice for 30 minutes.<br/>
| |
| − | 3. Heat shock in the water bath at 42°C for 45 seconds.<br/>
| |
| − | 4. Incubate on ice for 2 min.<br/>
| |
| − | 5. Add 450μL fresh LB broth into the tube.<br/>
| |
| − | 6. Incubate for 1 hour under the condition of 37°C, 200rpm using a shaking incubator.<br/>
| |
| − | 7. Spread 250μL liquid from Step6 on a LB agar plate, which contains appropriate antibiotics.<br/>
| |
| − | 8. Incubate overnight at 37°C (about 12 hours, no more than 16 hours).</p>
| |
| − | </div>
| |
| − | </div>
| |
| | | | |
| − | </div>
| |
| − | <!--2-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel2" data-toggle="collapse" style="text-decoration:none; "><h4 class="panel-title">02. Growing the Single Colonies from Agar Plates</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel2">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Growing the Single Colonies from Agar Plates</div>
| |
| − | <br/>
| |
| − | <p><strong>Requirements:</strong><br/>
| |
| − | —LB agar plate containing transformed bacterial colonies incubated overnight<br/>
| |
| − | —LB broth<br/>
| |
| − | —Antibiotics<br/>
| |
| − | —50mL centrifuge tubes<br/>
| |
| − | —Shaking incubator of 37°C</p>
| |
| − | <br/>
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Add 10mL LB broth into a centrifuge tube, then add the appropriate antibiotic needed.<br/>
| |
| − | 2. Select the single colony using the pipette tip from the agar plate, which contains the bacterial cells. Then put the pipette tip into the tube from Step 1.<br/>
| |
| − | 3. Incubate overnight at 37°C (about 12 hours, no more than 16 hours).</p><br/>
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--3-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel3" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title">03. Making Glycerol Stocks</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel3">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Making Glycerol Stocks</div>
| |
| − | <br/>
| |
| − | <p><strong>Materials and Equipments:</strong><br/>
| |
| − | —Bacterial culture<br/>
| |
| − | —Glycerol<br/>
| |
| − | —1.5mL cryogenic microtubes</p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Add 200µL glycerol into a cryogenic microtube.<br/>
| |
| − | 2. Pipet 800µL bacterial culture into glycerol in the cryogenic microtube from step 1 and mix by pipetting, save in -20°C freezer.<br/>
| |
| − | 3. This glycerol stock can be used whenever required, by just adding 10µL glycerol stock into 10mL LB broth.</p><br/>
| |
| − |
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--4-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel4" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title">04. Plasmid Extraction</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel4">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Plasmid Extraction</div><br/>
| |
| − |
| |
| − | <p><strong>Requirements:</strong><br/>
| |
| − | —Omega E.Z.N.A.® Plasmid Mini Kit II<br/>
| |
| − | —100% ethanol<br/>
| |
| − | —Isopropanol<br/>
| |
| − | —Microcentrifuge capable of at least 13000 x g<br/>
| |
| − | —Nuclease-free 1.5mL microcentrifuge tubes<br/>
| |
| − | —Sterile deionized water<br/>
| |
| − | —Electric dry oven of 65°C<br/>
| |
| − | —Water bath of 65°C</p><br/>
| |
| − |
| |
| − | <p><strong>Before Starting:</strong><br/>
| |
| − | —Heat sterile deionized water to 65°C using water bath<br/>
| |
| − | —Add the vial of RNase A to the bottle of Solution I if there’s no mark on the bottle and store at 4°C<br/>
| |
| − | —Add some 100% ethanol to the bottle of DNA Wash Buffer if there’s no mark on the bottle and store at room temperature<br/>
| |
| − | —Add some isopropanol to the bottle of HBC Buffer if there’s no mark on the bottle and store at room temperature<br/>
| |
| − | (The volume of ethanol and isopropanol is showed on the tag of the bottle)</p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Pellet 1.5mL bacteria in a clean 1.5mL microcentrifuge tube by centrifugation at 10,000 x g for 1 minute at room temperature. Decant or aspirate medium and discard.<br/>
| |
| − | 2. Add 250μL Solution I/RNase, pipet up and down to mix thoroughly. Complete resuspension of cell pellet is vital for obtaining good yields.<br/>
| |
| − | 3. Add 250µL Solution II and gently mix by inverting and rotating the tube several times to obtain a clear lysate. A 2 minutes incubation is necessary. Avoid vigorous mixing as this will shear chromosomal DNA and lower plasmid purity.<br/>
| |
| − | 4. Add 350µL Solution III and mix immediately by inverting the tube several times until a flocculent white precipitate forms. Incubate for 2 minutes.<br/>
| |
| − | 5. Centrifuge at maximum speed (≥13,000 x g) for 10 minutes at room temperature. A compact white pellet will form. Promptly proceed to the next step.<br/>
| |
| − | 6. Insert a HiBind® DNA Mini Column into a 2mL Collection Tube.<br/>
| |
| − | 7. Transfer 700µL cleared lysate from Step 5 CAREFULLY aspirating it into the HiBind® DNA Mini Column. Be careful not to disturb the pellet and that no cellular debris is transferred to the HiBind® DNA Mini Column.<br/>
| |
| − | 8. Centrifuge at maximum speed for 1 minute.<br/>
| |
| − | 9. Discard the filtrate and reuse the collection tube.<br/>
| |
| − | 10. Repeat Steps 7-9 until all cleared lysate has been transferred to the HiBind® DNA Mini Column.<br/>
| |
| − | 11. Add 500µL HBC Buffer.<br/>
| |
| − | 12. Centrifuge at maximum speed for 1 minute.<br/>
| |
| − | 13. Discard the filtrate and reuse the collection tube.<br/>
| |
| − | 14. Add 700µL DNA Wash Buffer.<br/>
| |
| − | 15. Centrifuge at maximum speed for 1 minute.<br/>
| |
| − | 16. Discard the filtrate and reuse the collection tube.<br/>
| |
| − | 17. Centrifuge the empty HiBind® DNA Mini Column for 2 minutes at maximum speed to dry the column matrix.<br/>
| |
| − | 18. Transfer HiBind® DNA Mini Column to a clean 1.5mL microcentrifuge tube. Open the lid and put it in the electric dry oven for 10 minutes to volatilize alcohol.<br/>
| |
| − | 19. Add 60mL sterile deionized water directly to the center of the column membrane.<br/>
| |
| − | 20. Let sit at room temperature for 2 minutes.<br/>
| |
| − | 21. Centrifuge at maximum speed for 1 minute.<br/>
| |
| − | 22. Store DNA at -20 °C</p><br/>
| |
| − |
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--5-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel5" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title">05. Genomic DNA Extraction </h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel5">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Genomic DNA Extraction</div>
| |
| − | <br/>
| |
| − | <p><strong>Requirements:</strong><br/>
| |
| − | —TransGen EasyPure® Bacteria Genomic DNA Kit<br/>
| |
| − | —100% ethanol<br/>
| |
| − | —70% ethanol (for Gram-positive bacterium)<br/>
| |
| − | —Glass bead (for Actinobacillus)<br/>
| |
| − | —Lysozyme (produced by Sangon Biotech®)<br/>
| |
| − | —RNase A (produced by Takara®)<br/>
| |
| − | —Proteinase K (produced by Takara®)<br/>
| |
| − | —Microcentrifuge capable of at least 13,000 x g<br/>
| |
| − | —Nuclease-free 1.5mL microcentrifuge tubes<br/>
| |
| − | —Sterile deionized water<br/>
| |
| − | —Electric dry oven at 65°C<br/>
| |
| − | —Water bath at 55°C and 65°C</p><br/>
| |
| − |
| |
| − | <p><strong>Before Starting:</strong><br/>
| |
| − | —Add 15mL 100% ethanol into BB11 if there’s no mark on the bottle and store at room temperature<br/>
| |
| − | —Add 48mL 100% ethanol into WB11 if there’s no mark on the bottle and store at room temperature<br/>
| |
| − | —Weight 4mg lysozyme in a microcentrifuge tube, and add 200μL RB11, store at 4°C<br/>
| |
| − | —Heat sterile deionized water to 65°C using water bath</p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Pellet 1.5mL bacteria in a clean 1.5mL microcentrifuge tube by centrifugation at 12,000 x g for 1 minute at room temperature. Decant or aspirate medium and discard.<br/>
| |
| − | 2. Add 200μL RB11/lysozyme, pipet up and down to mix thoroughly. Incubate at 37°C for 60 minutes.<br/>
| |
| − | 3. Centrifuge at 10,000 x g for 1 minute. Discard the liquid.<br/>
| |
| − | <strong>Note: </strong>For Gram-positive bacterium, a re-suspension using 70% ethanol before this step is needed. For Actinobacillus, it’s necessary to scatter the hyphostroma.<br/>
| |
| − | 4. Add 100μL LB11 and 20μL Proteinase K, pipet up and down to mix thoroughly.<br/>
| |
| − | 5. Incubate at 55°C for 15 minutes, shake the tube every 5 minutes.<br/>
| |
| − | <strong>Note:</strong> If the liquid is not limpid, another 15 minutes incubation may be necessary. <br/>
| |
| − | 6. Add 20μL RNase A, mix thoroughly, and incubate at room temperature for 2 minutes.<br/>
| |
| − | 7. Add 400μL BB11, vortex 30 seconds.<br/>
| |
| − | 8. Transfer 700μL liquid from Step 7 into a Genomic Spin Column.<br/>
| |
| − | 9. Centrifuge at 12,000 x g for 30 seconds, discard the filtrate and reuse the collection tube.<br/>
| |
| − | 10. Repeat Steps 8-9 until all liquid has been transferred to the Genomic Spin Column.<br/>
| |
| − | 11. Add 500μL CB11 into the Genomic Spin Column, centrifuge at 12,000 x g for 30 seconds, discard the filtrate and reuse the collection tube.<br/>
| |
| − | 12. Repeat Step 11 once.<br/>
| |
| − | 13. Add 500μL WB11 into the Genomic Spin Column, centrifuge at 12,000 x g for 30 seconds, discard the filtrate and reuse the collection tube.<br/>
| |
| − | 14. Repeat Step 13 once.<br/>
| |
| − | 15. Centrifuge the empty Genomic Spin Column for 2 minutes at 12,000 x g to dry the column matrix.<br/>
| |
| − | 16. Transfer the column to a clean 1.5mL microcentrifuge tube. Open the lid and put it in the electric dry oven for 10 minutes to volatilize alcohol.<br/>
| |
| − | 17. Add 75μL sterile deionized water into the column.<br/>
| |
| − | 18. Let sit at room temperature for 2 minutes.<br/>
| |
| − | 19. Centrifuge at 12,000 x g for 1 minute.<br/>
| |
| − | 20. Repeat Steps 17-19 once.<br/>
| |
| − | 21. Store DNA at -20 °C. </p><br/>
| |
| − |
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--6-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel6" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title">06. DNA Gel Electrophoresis</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel6">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">DNA Gel Electrophoresis</div>
| |
| − | <br/>
| |
| − | <p><strong>Requirements</strong><br/>
| |
| − | —50× TAE concentrate Solution (produced by Solarbio®)<br/>
| |
| − | —Agarose (produced by Biowest®)<br/>
| |
| − | —DNA dye (TransGen® GelStain)<br/>
| |
| − | —100mL Erlenmeyer flask<br/>
| |
| − | —Distilled water<br/>
| |
| − | —Microwave oven<br/>
| |
| − | —DNA samples<br/>
| |
| − | —10× Loading buffer (produced by Takara®)<br/>
| |
| − | —DNA marker (produced by TranGen®)<br/>
| |
| − | —Electrophoresis instrument</p><br/>
| |
| − |
| |
| − | <p><strong>Before Starting: </strong><br/>
| |
| − | —Dilute 50× TAE concentrate Solution to 1× TAE buffer with distilled water<br/>
| |
| − | —Add 10× loading buffer into marker and DNA samples. Loading buffer should occupy 10% of total volume. </p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Weigh 0.36g agarose in an Erlenmeyer flask.<br/>
| |
| − | 2. Add 30mL 1× TAE buffer into the flask from Step 1. <br/>
| |
| − | 3. Make agarose melt by microwave oven (medium-high heat, about 3 minutes).<br/>
| |
| − | 4. Add 3μL TransGen® GelStain, mix by shocking.<br/>
| |
| − | 5. Assemble gel pouring apparatus by inserting gate into slots.<br/>
| |
| − | 6. Pour agarose gel into the gel tray.<br/>
| |
| − | 7. Cool for 40 minutes to solidify the DNA agarose gel.<br/>
| |
| − | 8. Remove the pouring apparatus, put the gel into an electrophoresis instrument. <br/>
| |
| − | 9. Pipet marker and DNA samples which have been mixed with loading buffer into the slots.<br/>
| |
| − | 10. Turn on the electrophoresis instrument, set the working electric current at 75-100mA.<br/>
| |
| − | 11. Electrophoresis for 45-60 minutes.<br/>
| |
| − | 12. Turn off the instrument, take the gel into the gel formatter to take and save photos.</p><br/>
| |
| − |
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--7-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel7" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title">07. Gel Extraction</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel7">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Gel Extraction</div><br/>
| |
| − |
| |
| − | <p><strong>Requirements:</strong><br/>
| |
| − | —Omega E.Z.N.A.® Gel Extraction Kit<br/>
| |
| − | —DNA agarose gel sliced from the electrophoresed gel<br/>
| |
| − | —100% ethanol<br/>
| |
| − | —Microcentrifuge capable of at least 13,000 x g<br/>
| |
| − | —Nuclease-free 1.5 mL microcentrifuge tubes<br/>
| |
| − | —Sterile deionized water<br/>
| |
| − | —Electric dry oven of 55°C and 65°C<br/>
| |
| − | —Water bath of 65°C</p><br/>
| |
| − |
| |
| − | <p><strong>Before starting:</strong><br/>
| |
| − | —Heat sterile deionized water to 65°C using water bath<br/>
| |
| − | —Add 100mL 100% ethanol to the bottle of SPW Wash Buffer if there’s no mark on the bottle, store at room temperature</p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Put the gel slice in a clean 1.5mL microcentrifuge tube.<br/>
| |
| − | 2. Add Binding Buffer to fill the microcentrifuge tube from Step 1.<br/>
| |
| − | 3. Incubate at 55°C in a water bath, until the gel has completely melted. Shake the tube every 2-3 minutes.<br/>
| |
| − | 4. Insert a HiBind® DNA Mini Column in a 2mL Collection Tube.<br/>
| |
| − | 5. Add 700µL solution from Step 3 to the HiBind® DNA Mini Column.<br/>
| |
| − | 6. Centrifuge at 10,000 × g for 1 minute at room temperature.<br/>
| |
| − | 7. Discard the filtrate and reuse collection tube.<br/>
| |
| − | 8. Repeat Steps 5-7 until all of the sample has been transferred to the column.<br/>
| |
| − | 9. Add 300µL Binding Buffer.<br/>
| |
| − | 10. Centrifuge at maximum speed (≥13,000 x g) for 1 minute at room temperature.<br/>
| |
| − | 11. Discard the filtrate and reuse collection tube.<br/>
| |
| − | 12. Add 700µL SPW Wash Buffer.<br/>
| |
| − | 13. Centrifuge at maximum speed for 1 minute at room temperature.<br/>
| |
| − | 14. Discard the filtrate and reuse collection tube.<br/>
| |
| − | 15. Centrifuge the empty HiBind® DNA Mini Column for 2 minutes at maximum speed to dry the column matrix.<br/>
| |
| − | 16. Transfer the HiBind® DNA Mini Column to a clean 1.5mL microcentrifuge tube. Open the lid and put it in the electric dry oven for 10 minutes to volatilize alcohol.<br/>
| |
| − | 17. Add 35µL sterile deionized water directly to the center of the column membrane.<br/>
| |
| − | 18. Let sit at room temperature for 2 minutes.<br/>
| |
| − | 19. Centrifuge at maximum speed for 1 minute.<br/>
| |
| − | 20. Store DNA at -20°C.</p><br/>
| |
| − |
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--8-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel8" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title">08. PCR</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel8">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">PCR (Polymerase Chain Reaction)</div><br/>
| |
| − |
| |
| − | <p><strong>Requirements:</strong><br/>
| |
| − | —Takara PrimeSTAR® Max DNA Polymerase<br/>
| |
| − | —DNA template<br/>
| |
| − | —Primers (synthetized by Sangon Biotech®)<br/>
| |
| − | —Nuclease-free 0.2mL PCR tubes<br/>
| |
| − | —PCR instrument</p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. The choice of reaction system:<br/><br/>
| |
| − |
| |
| − | <img src="https://static.igem.org/mediawiki/2016/0/07/T--XMU-China--Interlab-Protocol1_and_.jpg" width="100%;"/><br/><br/>
| |
| − | 2. The choice of PCR program:<br/><br/>
| |
| − | <img src="https://static.igem.org/mediawiki/2016/b/b0/T--XMU-China--Interlab-Protocol2_and_.jpg" width="100%;"/><br/><br/>
| |
| − | <strong>Note: </strong>x is the annealing temperature of the reaction, usually 5°C to 10°C lower than Tm of the primer.<br/>
| |
| − | <strong>The calculation of Tm: </strong>Tm=4(G+C)+2(A+T)
| |
| − |
| |
| − |
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--9-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel9" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title">09. PCR Purification</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel9">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">PCR Purification:</div><br/>
| |
| − |
| |
| − | <p><strong>Requirements:</strong><br/>
| |
| − | —Omega E.Z.N.A.® Cycle Pure Kit<br/>
| |
| − | —PCR product<br/>
| |
| − | —100% ethanol<br/>
| |
| − | —Microcentrifuge capable of at least 13,000 x g<br/>
| |
| − | —Nuclease-free 1.5mL microcentrifuge tubes<br/>
| |
| − | —Sterile deionized water<br/>
| |
| − | —Electric dry oven of 65°C<br/>
| |
| − | —Water bath of 65°C</p><br/>
| |
| − |
| |
| − | <p><strong>Before Starting:</strong><br/>
| |
| − | —Heat sterile deionized water to 65°C using water bath<br/>
| |
| − | —Add 100mL 100% ethanol to the bottle of DNA Wash Buffer if there’s no mark on the bottle and store at room temperature</p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Determine the volume of PCR product, and transfer the product into a clean 1.5mL microcentrifuge tube.<br/>
| |
| − | 2. Add 4-5 volumes CP Buffer. For PCR products smaller than 200bp, add 6 volumes CP Buffer.<br/>
| |
| − | 3. Vortex to mix thoroughly. <br/>
| |
| − | 4. Insert a HiBind® DNA Mini Column into a 2mL Collection Tube.<br/>
| |
| − | 5. Add the sample from Step 3 to the HiBind® DNA Mini Column.<br/>
| |
| − | 6. Centrifuge at maximum speed (≥13,000 x g) for 1 minute at room temperature.<br/>
| |
| − | 7. Discard the filtrate and reuse collection tube.<br/>
| |
| − | 8. Add 700µL DNA Wash Buffer.<br/>
| |
| − | 9. Centrifuge at maximum speed for 1 minute.<br/>
| |
| − | 10. Discard the filtrate and reuse collection minute.<br/>
| |
| − | 11. Centrifuge the empty HiBind® DNA Mini Column at maximum speed for 2 minutes to dry the column.<br/>
| |
| − | 12. Transfer the HiBind® DNA Mini Column into a clean 1.5mL microcentrifuge tube. Open the lid and put it in the electric dry oven for 10 minutes to volatilize alcohol.<br/>
| |
| − | 13. Add 40µL sterile deionized water directly to the center of column matrix.<br/>
| |
| − | 14. Let sit at room temperature for 2 minutes.<br/>
| |
| − | 15. Centrifuge at maximum speed for 1 minute.<br/>
| |
| − | 16. Store DNA at -20°C. </p><br/>
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--10-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel10" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title">10. Restriction Digest</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel10">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Restriction Digest</div><br/>
| |
| − |
| |
| − | <p><strong>Requirements: </strong><br/>
| |
| − | —Plasmid DNA or PCR product<br/>
| |
| − | —Restriction enzymes and buffers (produced by Takara Bio®)<br/>
| |
| − | —Nuclease-free 0.2mL PCR tubes<br/>
| |
| − | —Water bath at 37°C</p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Prepare reaction systems in a 0.2mL PCR tube according to the following table:<br/><br/>
| |
| − |
| |
| − | <img src="https://static.igem.org/mediawiki/2016/6/69/T--XMU-China--Notebooks-Protocol3_and_.jpg" width="100%; "/><br/><br/>
| |
| − | Choose the buffer according to the following table:<br/><br/>
| |
| − |
| |
| − | <img src="https://static.igem.org/mediawiki/2016/1/16/T--XMU-China--Notebooks-Protocol4_and_.jpg" width="100%;" /><br/><br/>
| |
| − |
| |
| − | 2. Incubate in the water bath at 37°C for 6-8 hours.</p>
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--11-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading" style=" background: linear-gradient(to bottom, ##FFB90F 0px, #9F0000 100%);">
| |
| − | <a href="#panel11" data-toggle="collapse" style="text-decoration:none;"style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title" id="section-2">11. Ligation</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel11">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Ligation</div><br/>
| |
| − |
| |
| − | <p><strong>Requirements:</strong><br/>
| |
| − | —Digested DNA<br/>
| |
| − | —T4 ligase and buffer (produced by Takara Bio®)<br/>
| |
| − | —Nuclease-free 0.2mL PCR tubes<br/>
| |
| − | —Water bath at 16°C or fridge at 4°C</p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | Prepare reaction systems in a 0.2mL PCR tube according to the following table:<br/><br/>
| |
| − |
| |
| − | <img src="https://static.igem.org/mediawiki/2016/3/39/T--XMU-China--Notebooks-Protocol5_and_.jpg" width="100%;" /><br/><br/>
| |
| − | <img src="https://static.igem.org/mediawiki/2016/f/f2/T--XMU-China--Notebooks-Protocol6_and_.jpg" width="30%;"/><br/><br/>
| |
| − | V_1: insert<br/>
| |
| − | V_2:vector<br/>
| |
| − | M: molar weight (size)<br/>
| |
| − | C: conc. (ng/mL)<br/>
| |
| − | 2. Incubate in the water bath at 16°C for 6 hours or fridge at 4°C for 12 hours. </p>
| |
| − | </div>
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <h1 style="border-bottom: 1px solid #aaa;color: #EE7600;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
| |
| − | padding-bottom: -5%;">Characterization</h1>
| |
| − | <div class="panel-group" id="myAccordion" style="margin-left:5%;margin-right:5%;">
| |
| − | <!--1-->
| |
| − | <div class="panel panel-default" >
| |
| − | <div class="panel-heading" style="color:#FFF;">
| |
| − | <a href="#panel01" data-toggle="collapse" style="text-decoration:none; " aria-expanded="false"><h4 class="panel-title">01. Transformation </h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel01">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Transformation</div>
| |
| − | <br/>
| |
| − | <p><strong>Requirements: </strong><br/>
| |
| − | —TransGen® BL21(DE3) Chemically Competetent Cell<br/>
| |
| − | —LB broth<br/>
| |
| − | —Expression plasmid containing coding sequence<br/>
| |
| − | —LB agar plates containing 15-100μg/mL antibiotic of choice<br/>
| |
| − | —Nuclease-free 1.5mL microcentrifuge tubes<br/>
| |
| − | —Water bath of 42°C<br/>
| |
| − | —Shaking incubator of 37°C
| |
| − | </p>
| |
| − | <br/>
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Add 5-10μL plasmid into 50μL fresh competent cells, which is contained in 1.5mL centrifuge tube. Then mix gently.<br/>
| |
| − | 2. Incubate the tube on ice for 30 minutes<br/>
| |
| − | 3. Heat shock in the water bath at 42°C for 45 seconds.<br/>
| |
| − | 4. Incubate on ice for 2 min.<br/>
| |
| − | 5. Add 450μL fresh LB broth into the tube.<br/>
| |
| − | 6. Incubate for 1 hour under the condition of 37°C, 200rpm using a shaking incubator.<br/>
| |
| − | 7. Spread 250μL liquid from Step6 on a LB agar plate, which contains appropriate antibiotics.<br/>
| |
| − | 8. Incubate overnight at 37°C (about 12 hours, no more than 16 hours).<br/>
| |
| − | 9. Growing the Single Colonies from Agar Plates (the same protocol as Molecular Cloning).
| |
| − | </p>
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--2-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel02" data-toggle="collapse" style="text-decoration:none; "><h4 class="panel-title">02. Expression</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel02">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Expression</div>
| |
| − | <br/>
| |
| − | <p><strong>Requirements:</strong><br/>
| |
| − | —Bacteria containing expression plasmid<br/>
| |
| − | —Inductor (such as IPTG, AHL, AIP and so on)<br/>
| |
| − | —Nuclease-free 50mL centrifuge tubes<br/>
| |
| − | —Shaking incubator of 18°C<br/>
| |
| − | </p>
| |
| − | <br/>
| |
| − | <p><strong>Protocol (in this part, we choose IPTG as inductor, and pET-28a plasmid as expression system):</strong><br/>
| |
| − | 1. Add 10μL，30μL，50μL，70μL，100μL 0.1M IPTG separately to the medium. Incubated at 18 ℃, shaken at 200rpm overnight. <br/>
| |
| − | <strong>Note: Different plasmids and inductors may need different protocols, please design your protocol carefully.</strong><br/>
| |
| − | 2. After inducting expression, you may need an SDS-PAGE electrophoresis, HPLC analysis or other ways to check your expression. </p><br/>
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--3-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel03" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title" >03. AHL Sensing Protocol</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel03">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">AHL Sensing Protocol</div>
| |
| − | <br/>
| |
| − | <p><strong>Requirements: </strong><br/>
| |
| − | —TransGen® Trans5α Chemically Competetent Cell<br/>
| |
| − | —LB broth<br/>
| |
| − | —Plasmid DNA <br/>
| |
| − | —LB agar plates containing 15-100μg/mL antibiotic of choice<br/>
| |
| − | —Antibiotics<br/>
| |
| − | —AHL<br/>
| |
| − | —Nuclease-free 1.5mL microcentrifuge tubes<br/>
| |
| − | —Nuclease-free 0.2mL PCR tubes<br/>
| |
| − | —Water bath of 42°C<br/>
| |
| − | —Shaking incubator of 37°C<br/>
| |
| − | —50mL centrifuge tubes<br/>
| |
| − | —96-well plates<br/>
| |
| − | —Tecan® Infinite M200pro microplate reader
| |
| − | </p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1.Mix the BBa_K1960000 on pSB1A1 and BBa_K1960001 on pSB1C3 together in the ratio of 1:1, transform the mixed plasmid on a LB agar plate which contains ampicillin and chloramphenicol antibiotics.<br/>
| |
| − | 2.Incubate overnight at 37°C for 12 hours.<br/>
| |
| − | 3.Grow the Single Colonies from Agar Plates.<br/>
| |
| − | 4.Do a 1/750 dilution of cells into fresh media with ampicillin and chloramphenicol antibiotics.<br/>
| |
| − | 5.Incubate at 37°C for 3 hours. Add AHL by the concentration of 0ng/μL， 1ng/μL, 10ng/μL, 20ng/μL. Each condition is in triplicate.<br/>
| |
| − | 6.At thirty minutes intervals, add 100 microlitres into each well of the 96 Well plate laid on the ice.<br/>
| |
| − | 7. Continue sampling for 900 minutes.<br/>
| |
| − | 8. Measurements of absorbance and fluorescence: <br/>
| |
| − | (1) OD 600<br/>
| |
| − | Device: Plate Reader（Tecan Infinite M200pro） Wavelengths: 600 nm absorption. <br/>
| |
| − | (2) Fluorescence (CFP and GFP)<br/>
| |
| − | Device: Plate Reader（Tecan Infinite M200pro）, 96-well plates. <br/>
| |
| − | Wavelengths: CFP:439 nm excitation, 476 nm emission; GFP: 485 nm excitation, 520 nm emission.
| |
| − | </p><br/>
| |
| − |
| |
| − | </div>
| |
| − | </div>
| |
| − | </div>
| |
| − | <!--4-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel04" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title" id="section-3">04. sRNA Protocol</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel04">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">sRNA Protocol</div>
| |
| − | <br/>
| |
| − | <p><strong>Requirements: </strong><br/>
| |
| − | —TransGen® Trans5α Chemically Competetent Cell<br/>
| |
| − | —LB broth<br/>
| |
| − | —Plasmid DNA <br/>
| |
| − | —LB agar plates containing 50μg/mL antibiotic of choice<br/>
| |
| − | —Antibiotics<br/>
| |
| − | —Nuclease-free 1.5mL microcentrifuge tubes<br/>
| |
| − | —Nuclease-free 0.2mL PCR tubes<br/>
| |
| − | —Water bath of 42°C<br/>
| |
| − | —Shaking incubator of 37°C<br/>
| |
| − | —50mL centrifuge tubes<br/>
| |
| − | —96-well plates<br/>
| |
| − | —Bioscreen C MBR (both hardware and software)
| |
| − | </p><br/>
| |
| − |
| |
| − | <p><strong>Protocol:</strong><br/>
| |
| − | 1. Design the sRNA cassettes. Take the reverse complement of the target sequence which was selected from position +1 to +24 beginning with the start codon (ATG) of gene chloramphenicol acetyltransferase.<br/>
| |
| − | 2. Synthetize complete sRNA expression cassettes, arrange the pR promoter, guide sequence, hfq protein binding domain and transcriptional terminator sequences.<br/>
| |
| − | 3. Construct the pSB1AC3-sRNA plasmid.<br/>
| |
| − | 4. Transfer the pSB1AC3-sRNA and pSB1AC3-mRFP into the chemical competent cells(DH5α) on LB agar plates which contains ampicillin antibiotics.<br/>
| |
| − | 5. Select single clone and incubate at 37°C, measure the OD600 after 1 hour and adjust their OD600 to the same level by the LB medium.<br/>
| |
| − | 6. Add the chloramphenicol antibiotics with the concentration of 50 ug/ml. Incubate at 37°C and measure the OD600 continuously by the Bioscreen C.
| |
| − | </p><br/>
| |
| − |
| |
| − | </div>
| |
| − | </div>
| |
| − | </div>
| |
| − | </div>
| |
| − | <h1 style="border-bottom: 1px solid #aaa;color: #EE7600;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
| |
| − | padding-bottom: -5%;">Addenda</h1>
| |
| − | <div class="panel-group" id="myAccordion" style="margin-left:5%;margin-right:5%;">
| |
| − | <!--1-->
| |
| − | <div class="panel panel-default" >
| |
| − | <div class="panel-heading" style="color:#FFF;">
| |
| − | <a href="#panel21" data-toggle="collapse" style="text-decoration:none; " aria-expanded="false"><h4 class="panel-title">01. Antibiotics </h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel21">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Antibiotics</div>
| |
| − | <br/>
| |
| − | <img src="https://static.igem.org/mediawiki/2016/0/0e/T--XMU-China--Addenda1_and_.jpg" width="100%;" /><br/>
| |
| − | <p><strong>Note: All of these antibiotics are produced by SolarBio®.</strong></p>
| |
| − | </div>
| |
| − | </div>
| |
| − |
| |
| − | </div>
| |
| − | <!--2-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel22" data-toggle="collapse" style="text-decoration:none; "><h4 class="panel-title">02. Culture Mediums</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel22">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Culture Mediums</div>
| |
| − | <br/>
| |
| − | <img src="https://static.igem.org/mediawiki/2016/f/fc/A_picture_for_medium.png" width="100%;" /><br/>
| |
| − | <br/>
| |
| − |
| |
| − | </div>
| |
| − | </div>
| |
| − | </div>
| |
| − | <!--3-->
| |
| − | <div class="panel panel-accordion panel-default">
| |
| − | <div class="panel-heading">
| |
| − | <a href="#panel23" data-toggle="collapse" style="text-decoration:none;padding-bottom: .17em;"><h4 class="panel-title" id="section-4">03. Primers and Sequence</h4></a>
| |
| − | </div>
| |
| − | <div class="panel-collapse collapse" id="panel23">
| |
| − | <div class="panel-body">
| |
| − | <div id="title_p" style="padding-bottom: .17em;color: #EE7600;
| |
| − | font-size: 30px;
| |
| − | text-align:justify;
| |
| − | margin-top:30px;
| |
| − | margin-bottom: 0px;
| |
| − | border-bottom: 1px solid #aaa;
| |
| − | margin-bottom: .6em;
| |
| − | text-shadow: 0 0 1px black;">Primers and Sequence</div>
| |
| − | <br/>
| |
| − | <p><strong>Primers:</strong><br/>
| |
| − | <strong>1. VF2 and VR</strong><br/>
| |
| − | VF2: TGCCACCTGACGTCTAAGAA<br/>
| |
| − | VR: ATTACCGCCTTTGAGTGAGC<br/>
| |
| − |
| |
| − | <strong>2. Formaldehyde dismutase</strong><br/>
| |
| − | Forward: GCTCTAGAATGGCCGGTAATAAAAGCGTCGTCTATC<br/>
| |
| − | Reverse: CGCTGCAGACTAGTTCATTTATTCTTCAACATGCCATGC<br/>
| |
| − | <strong>Note: Our primers are synthetized by Sangon Biotech®, Shanghai</strong>
| |
| − |
| |
| − | </p><br/>
| |
| − |
| |
| − | <p style="word-break: break-all;"
| |
| − | ><strong>Sequence:</strong><br/>
| |
| − | <strong>Formaldehyde dismutase </strong><br/>
| |
| − | ATGGCCGGTAATAAAAGCGTCGTCTATCATGGGACCCGTGATCTTCGGGTTGAAACAGTTCCTTATCCCAAGCTTGAGCACAATAATCGAAAGCTTGAACATGCGGTGATTTTAAAGGTTGTATCAACAAATATTTGTGGTTCAGATCAACACATTTATCGTGGGCGCTTTATCGTTCCTAAAGGTCACGTGCTCGGGCACGAAATTACTGGGGAAGTGGTAGAAAAGGGCTCGGATGTCGAATTAATGGACATCGGCGATTTAGTGTCTGTGCCTTTTAATGTTGCGTGCGGGCGGTGCCGCAACTGTAAAGAGGCGCGATCTGACGTTTGTGAAAATAACCTGGTCAACCCAGATGCGGATTTAGGTGCCTTTGGCTTTGACTTGAAAGGGTGGTCTGGTGGTCAAGCTGAGTATGTTCTTGTTCCTTATGCTGACTATATGCTGCTCAAGTTTGGTGATAAAGAACAGGCGATGGAAAAAATAAAAGACCTGACGCTTATCTCAGATATTCTACCGACAGGTTTTCACGGTTGCGTTTCTGCTGGAGTGAAGCCAGGTAGCCATGTTTACATTGCAGGTGCAGGTCCAGTAGGACGTTGTGCGGCGGCGGGGGCGCGACTGTTAGGAGCGGCATGTGTGATCGTGGGCGACCAGAATCCTGAGCGCCTGAAGCTGCTATCTGATGCCGGTTTTGAAACGATCGACTTACGTAACTCTGCACCGCTGCGCGATCAGATTGATCAGATACTAGGTAAGCCGGAAGTCGACTGTGGTGTAGATGCGGTTGGTTTTGAAGCACATGGCCTTGGTGACGAAGCTAATACTGAGACGCCTAACGGTGCCCTAAATAGCCTCTTTGATGTAGTCCGAGCAGGTGGCGCAATCGGAATTCCGGGTATTTATGTAGGGAGCGACCCTGATCCTGTTAATAAAGATGCAGGGAGCGGACGCTTGCATCTTGACTTCGGCAAGATGTGGACAAAATCCATACGGATTATGACTGGAATGGCACCAGTGACAAACTACAATCGCCATCTGACCGAAGCAATACTTTGGGATCAAATGCCTTATTTGTCCAAGGTGATGAATATTGAAGTGATTACACTTGATCAAGCACCGGATGGGTATGCGAAATTCGATAAGGGGTCTCCCGCTAAGTTTGTTATCGATCCGCATGGCATGTTGAAGAATAAATGA<br/>
| |
| − |
| |
| − | </div>
| |
| − | </div>
| |
| − | </div>
| |
| − | </div>
| |
| | </div> | | </div> |
| | <!--end column--> | | <!--end column--> |
