Experiment
Overview of experiment
In our project, we first designed toehold switches the detect H7N9 and H5N1 virus in silico based on our modelling. We then constructed the plasmids that express switches and triggers by DNA synthesis and standard cloning method. Validation of the toehold switches was performed by co-expressing the switch and trigger plasmids in E. coli and in cell free system. Meanwhile, we also constructed our toehold switches and trigger cloning tool to allow convenient construction of switch and trigger expressing plasmid. Using the cloning tool, we tried to improve one existing toehold switch in the Registry. We also characterized two reporter protein (mRFP and amaJlime) in the registry to facilitate our project.
In silico design of Influenza Toehold switches
According to Green et al., the optimal length of RNA to be detected by a toehold switch is around 30 bp. In other words, a target RNA with 1000 bp in length will give 970 possible switches. However, the performances of each possible switch are different, since the performance is governed by serval parameters in the target region, such as the minimum free energy (For more information, please visit RNA thermodynamics modelling page ). To minimize the manpower on screening of the switches, we constructed an online toehold switch design program. Apart from basic thermodynamic parameters, it also screens for rare codon, stop codon and RFC illegal sites along the sequence. In addition, the built- in BLAST function also automatically screen for nonspecific region to avoid false positive detection. Ultimately, the program can sort a list of “best” Toehold Switch sequence according to their free energy using the embedded function of “Vienna RNA” (8). The program facilitates the construction of toehold switch by providing a user-friendly interface with novel screening function.
We chose 3 toehold switches with “good” predicted performance to target each RNA (For more information, please visit RNA thermodynamics modelling page). (e.g. H5-1, H5-2 and H5-3 to detect H5 RNA). The figure above shows the detection region of each toehold switch. Before constructing the toehold switches, we ensured all the switches passed the modelling test.
Construction of toehold switch and trigger- expressing plasmid
We choose mRFP as the reporter of our toehold switches because it is very distinguishable by naked eyes while at the same time it can be quantified by measuring the fluorescence signal using a plate reader. The upper picture showed the general structure of our toehold switch. After having the toehold switch sequences generated by our program, we linked it with the reporter sequence and synthesized them using IDT’s sponsored gBlock synthesis service. The gBlocks were used as template and amplified by PCR. The bands with correct size is gel- purified. We inserted the purified PCR products into pSB4C5 (for switch) or pSB1k3 (for trigger) using restriction cut and ligation. Sequencing result confirm all 30 constructed were successfully constructed.
Below is a table illustrating the information of the backbone:
Switch
Trigger
Backbone pSB4C5
pSB1k3
Ori pSC101 (~5 copies)
pMB1 (~100-300 copies)
Resistance chloramphenicol
kanamycin
We choose these two backbone with different Ori and antibiotic resistance gene because they will be used in latter co- transformation experiment. In co- transformation experiment, the two plasmids should not share the same type of origin of replication (ORI), since they will compete for the replication machinery and affect the copy number. In addition, having two different antibiotic resistance gene allow co-transformation.
In vivo assay: co- transformation in E. coli
Since cell free system is relatively expensive to us, we would like to first validate our switches in E. coli, which can be much cheaper. The assay is done by co-transformation of switch-expressing plasmid and trigger expressing plasmid. Negative control is done by co-transformation of switch-expressing plasmid and empty- trigger expressing plasmid. Colony of the transformant was picked to grow overnight starter culture. Expression of reporter mRFP was done by shaking culture for 6 hours after 1% inoculation. Cells were placed in 96 well plates after harvesting and washing with PBS buffer. Fluorescence intensity was measured by a plate reader. We later checked for different of florescent signal between the switch-trigger cotransformant and the negative control. In theory, if the toehold switch worked as expected, the florescent signal in switch-trigger cotransformant must be higher than that in negative control.
In vitro assay: Cell free system
We used the Promega S30 T7 High-Yield Protein Expression System as our cell free system. After the in vivo test, we choose the workable switch to test in a cell free system. We expressed: the toehold switch plasmid, toehold switch and trigger pair, J61002(constitutive mRFP generator; positive control) and a luciferease-expressing plasmid (positive control provided by the manufacturer) in separate cell free reactions. Negative control was done by replacing DNA with water. We followed exactly the protocol provided by the company in our experiment. The reaction was done by mixing 2 μg DNA, S30 Premix and S30 Extract together to a reaction volume of 50ul, followed by incubating at 37C for an hour. The florescent signal from the reacted mixture was then determined by plate reader. Overexpression of protein in the reacted mixture was checked by SDS-PAGE.
Toehold switch and trigger cloning tool: BBa_K2254000 & BBa_K2254001
During our construction of switches, we realized that it would be relatively expensive to synthesis toehold switch together with the linker and reporter gene. We also want to have a convenient tool to construct and validate switches. Therefore, we constructed our toehold switch and trigger cloning tool that utilize the type IIS restriction enzymes Eco31I. Using the biobricks, user can just construct their toehold switch or trigger by ordering 2 primer-like oligo. It also utilizes screening technique that is similar to blue white screening. User can use this biobrick to construct their toehold switch that use pT7 as promoter and mRFP as reporter.
To use the biobricks to clone switches and triggers, user can just order 2 oligos (similar to primer) and insert the short DNA into the biobricks by restriction cut and ligation. For the 2 oligos (about 60nt), one oligo should contain forward toehold switch sequence with AGGG at 5’ end, and another one should contain reverse complement toehold switch sequence with AGTA at 5’ end. To allow convenient screening of correct clone, there is a constitutive promoter (J23100) and RBS (B0034) situated between two Eco31I sites. Double digestion by Eco31I will remove them, and insertion of switch will block the translation of mRFP, resulting colonies that don’t express mRFP, whereas ligation of single digested plasmid will give red colonies.
The toehold switch will be linked to a flexible linker (AACCTGGCGGCAGCGCAAAAG) followed by mRFP reporter (E1010) and a double terminator (B0015). The linker is used to separate the coding sequence in the toehold switch and the reporter to prevent interference of protein folding. When the toehold switch hairpin is linearized by its orthogonal trigger RNA, RBS will be exposed, allowing the translation of downstream mRFP reporter gene. Since an Xhoi site is present between the linker and the mRFP sequence, the reporter can be easily changed by restriction digestion followed by ligation.
Improving existing biobricks and project: Cancer switches
Previously, the CGU Taiwan 2015 team was also working on toehold switch. They designed toehold switches to detect biomarker of oral cancer. We investigated their project and found that their toehold switches have room for improvement.
Firstly, they use luciferase as reporter gene. We think that luciferase is not feasible to be used for on- site diagnosis sense the luciferase activity need to be measured by machine. Secondly, we inputted the sequence of those oral cancer biomarker into our program and found that a better switch can be designed by choosing another region for detection (see modelling page). Therefore, we improved their biobricks by using In silico design of switch and RFP as reporter.
Characterization of chromoprotein
Different types of body fluid have different pH (figure). Since we are going to use body fluid as sample in our influenza diagnostic test, we would like to investigate if the pH in body fluid can interfere the reporter protein we used in our test. Theoretically, fluorescent signal may be disturbed by pH because pH can interfere the folding and conformation of the fluorophore. Therefore, we characterized the fluorescence of 2 fluorescence protein: mRFP and amajLime in different pH condition. We hope to find out the optimum pH for the fluorescence protein and to check if they are suitable to be used in our diagnostic test.
pH values of commonly extracted body fluid:
Body Fluid
pH
Blood
7.4
Saliva
6.4
Ileum
8
Serum
7.2
Stomach
1.5
Urine
5.8
To examine the pH sensitivity of mRFP and amajLime, we inserted the biobrick to pSB1A2 and expressed them in E. coli. mRFP and amajLime were then purified form lysed cells by anion exchange chromatography and hydrophobic interaction chromatography (HIC).
Below picture shows the SDS–PAGE analysis of purification of amajLime (left) and mRFP (right).
F.1 to F.3 represents chronological order of elution in HIC. Sample were mixed with 10 µl SDS 2X gel-loading buffer and 10 µl were loaded on the SDS-Gel. The purest fraction, F.2 in both cases, were selected to proceed for pH stability test. To examine the pH stability of proteins, purified proteins were diluted into buffers ranging from pH2-pH12 while fluorescent intensity was recorded in plate reader.
