Generally, the project design can be divided into three portions:
Cloning ORs into pcDNA3.1+ respectively CRISPR/CAS9 system iSmeller system
Cloning ORs into pcDNA3.1+ respectively
In order to express olfactory receptors in HEK293, we cloned OR1A1 and OR1D2 in pcDNA3.1+, which is a constitutive-expression vector.
| Name | Specific odor molecule | Forward primer | Reverse primer |
|---|---|---|---|
| OR1A1 | β- citronellol | cgtaagcttatgaccgagacatctcaggtggcccctgccggcggcagggaaaataac | tatggatccttacgaggagattctcttgttg |
| OR1D2 | bourgeonal | cgtaagcttatgaccgagacatctcaggtggcccctgccggcggcgatggaggcaac | tatctcgagttatgtcagcctcttaaagtgtttatctaggagtcttcc |
Table 1: cloning ORs into pcDNA3.1+ respectively
CRISPR/CAS9 gRNA Design:
To achieve an intensified downstream signaling to enhance the detection sensitivity, we employed the CRISPR activation (CRISPRa) system to simultaneously increase the expression of the core components of olfactory receptor signaling via lentiviral transduction, including GNAL, RTP1 and RIC8B. At the endpoint, a cAMP-activated reporter gene (luciferase) is transfected to read out the signaling strength in response to specific and different range of odors.
| Gene | Binding sequence | Position | Function |
|---|---|---|---|
| GNAL | GAAACAATTCTCGTGTAAAA | Sense sequence | cloning into lenti sgRNA(MS2)-puro backbone vector for CRISPRa（gRNA） |
| GNAL | CGTCTCCGTTCATTGTGCTG | Antisense sequence | |
| RIC8B | CAACCCGCCAGCCTCCGCCC | Sense sequence | |
| RIC8B | GGGGGCGCGAGGCGTTTACC | Antisense sequence | |
| RTP1 | CTGCAATCTCAGTTCAGGGC | Sense sequence | |
| RTP1 | GGCAACCTGCCTGGTTGCCG | Antisense sequence |
iSmeller system:
As a proof-of-principle, we choose two odor compound/receptor pairs (β-citronellol/OR1A1 and bourgeonal/OR1D2) to construct the iSmeller odor sensors and evaluate their sensitivity and specificity. We also designed multiple sgRNAs targeting three signal pathway core genes GNAL, RTP1 and RIC8B. When a specific odor molecule binds to the corresponding olfactory receptor, it will open the downstream cAMP pathway, resulting in a certain amount of cAMP at the end point, which can be used for the final signal detection.
