1. In silico designed toehold switches to detect H7N9 and H5N1 viruses based on our modelling.
2. Constructed plasmids containing switches or triggers by DNA synthesis and standard cloning method.
3. Validated the toehold switches by co-expressing the switch and trigger plasmids in E. coli and cell free system.
4. Constructed cloning tools for toehold switch and trigger to allow convenient replacement of switch and trigger in the plasmids.
5. Improved one existing toehold switch in the Registry.
6. Characterized two reporter proteins (mRFP and amaJlime) in the Registry.

In silico design of Influenza Toehold switches

According to Green et al., the optimal length of RNA to be detected by a toehold switch is around 30 bp. In other words, a target RNA with 1000 bp in length will give 970 possible switches. However, the performances of each possible switches are different, since the performance is governed by serval parameters in the target region, such as the minimum free energy of the RNA (For more information, please visit RNA thermodynamics modelling page). To minimize the manpower on screening of the switches, we constructed an online toehold switch design program . Apart from the basic thermodynamic parameters, it also screens for rare codons, stop codons and RFC illegal sites along the sequence. In addition, the built-in BLAST function also automatically screen for nonspecific region to avoid false positive detection. Ultimately, the program can sort a list of “best” Toehold Switch sequence according to their free energy using the embedded function of “Vienna RNA” (8). The program facilitates the construction of toehold switch by providing a user-friendly interface with novel screening function.

To detect influenza A, Polymerase Basic Protein 2 (PB2) gene is used as a positive control as it is influenza A-specific. Further subtyping requires a subtype-specific RNA that can also fulfil the criteria for being a good toehold switch. We downloaded the latest influenza gene sequences from the Influenza Research Database and inputted to our program to generate switches to detect H5, H7, N1, N9 and PB2 RNAs. The sequences used are listed below:

3 toehold switches with “good” predicted performance were chosen to target each RNA (For more information, please visit RNA thermodynamics modelling page). For example, the three switches are named as H5-1, H5-2 and H5-3 for H5 RNA detection. The figure above shows the detection region of each toehold switch. Before constructing the toehold switches, we ensured all the switches passed our modelling criteria.

Construction of toehold switch and trigger-expressing plasmid

The upper picture showed the general structure of our toehold switch. mRFP was chosen as the reporter of our toehold switches because it is very distinguishable by naked eyes while at the same time it can be quantified by measuring the fluorescence signal using a plate reader. After having the toehold switch sequences generated by our program, we linked it with the reporter sequence and synthesized them using IDT’s sponsored gBlock synthesis service. The gBlocks were used as template and amplified by PCR. The bands with correct size were gel-purified. We inserted the purified PCR products into pSB4C5 (for switch) or pSB1K3 (for trigger) using restriction cut and ligation. Sequencing results confirmed all 30 constructs were cloned.

Below is a table with the information of the backbone:

These two backbones with different Ori and antibiotic resistance genes were used because they will be used in the following experiments. Two co-transformed plasmids should not have the same type of origin of replication (Ori), or otherwise, they will compete for the replication machinery and affect the copy number. In addition, having two different antibiotic resistance genes avoid dropping out of either one of the plasmids during selection.

In vivo assay: co-transformation in E. coli

Expressing our switches in E. coli is a cheaper and more familiar method to validate our switches and the program. The assay is done by co-transforming switch-expressing plasmid and trigger-expressing plasmid into E. coli BL21 (DE3). Negative control is done by co-transforming switch-expressing plasmid and empty pSB1K3. Single colonies of the transformants were picked and grown overnight starter culture. Expression of reporter mRFP was done by shaking culture for 6 hours after 1% inoculation. Cells were harvested, washed with PBS buffer, then aliquoted in 96-well plates. Fluorescence intensity was measured by BMG ClarioStar microplate reader. We later checked for difference of florescent signal between the switch-trigger co-transformants and the negative control. In theory, if the toehold switch works as expected, the florescent signal of switch-trigger co-transformants must be higher than that of the negative control.

In vitro assay: Cell free system

We used the Promega S30 T7 High-Yield Protein Expression System as our cell free system. After the in vivo test, we chose the workable switches to test in cell free system. We expressed: (1) toehold switch, (2) toehold switch and trigger pair, (3) J61002(constitutive mRFP generator as a positive control of the highest possible RFP expression), (3) luciferase positive control provided by the manufacturer, and (4) negative control where DNA is replaced with water in separate cell free reactions. We followed exactly the protocol provided by the company in our experiment. The reaction was done by mixing 2 μg DNA, S30 Premix and S30 Extract together to a reaction volume of 50 μl, followed by incubating at 37˚C for an hour. The florescent signal from the reacted mixture was then determined by BMG ClarioStar plate reader. Over-expression of protein in the reaction mixture was checked by SDS-PAGE.

Toehold switch and trigger cloning tools: BBa_K2254000 & BBa_K2254001

During our construction of switches, we realized that it would be relatively expensive to synthesis toehold switch together with the linker and reporter gene. We also want to have a convenient tool to construct and validate switches. Therefore, we constructed our toehold switch and trigger cloning tools that utilize the type IIS restriction enzyme Eco31I. Using the biobricks, user can simply construct their toehold switch or trigger by ordering 2 primer-like oligos. It also utilizes screening technique that is similar to blue/white screening. User can use this biobrick to construct their toehold switches that use pT7 as the promoter and mRFP as the reporter.

To use the biobricks to clone switches and triggers, user can just order 2 oligos (similar to primer) and insert the short DNA into the biobricks by restriction cut and ligation. For the 2 oligos (about 60 nt), one oligo should contain forward toehold switch sequence with AGGG at the 5’ end, and another one should contain reverse complement toehold switch sequence with AGTA at the 5’ end. To allow convenient screening of clones, there is a constitutive promoter (J23100) and RBS (B0034) situated between the two Eco31I sites. Digestion by Eco31I will remove them, and the subsequent insertion of switch will block the translation of mRFP, resulting in white colonies, whereas ligation of single digested plasmid will give red colonies.

The toehold switch will be linked to a flexible linker (AACCTGGCGGCAGCGCAAAAG) followed by mRFP reporter (E1010) and a double terminator (B0015). The linker is used to separate the coding sequence in the toehold switch and the reporter to prevent interference of protein folding. When the toehold switch hairpin is linearized by its orthogonal trigger RNA, RBS will be exposed, allowing the translation of downstream mRFP reporter gene. Since an XhoI site is present between the linker and the mRFP sequence, the reporter can be easily changed by restriction digestion followed by ligation.

Improving existing biobricks and project: Cancer switches

Previously, the Chang Gung University (CGU) Taiwan 2015 team also worked on toehold switch. They designed toehold switches to detect biomarker of oral cancer. We investigated their project and found that their toehold switches have room for improvement.

Firstly, they use luciferase as reporter gene. We think that luciferase is not feasible to be used for on-site diagnosis since the luciferase activity need to be measured by a reader. Secondly, we inputted the sequences of those oral cancer biomarkers into our program and found that a better switch can be designed by choosing another region for detection (see modelling page). Therefore, we improved their biobricks by using in silico design of switch and RFP as a reporter.

Characterization of chromoproteins

Different types of body fluid have different pH (figure). Since we are going to use body fluid as sample in our influenza diagnostic test, we would like to investigate if the pH in body fluid can interfere with the reporter protein we used in our test. Fluorescent signal is known to be pH-dependent because pH can change the folding and conformation of the fluorophore, and ionization states can also cause shift in the Excitation/Emission spectra (Ref). Therefore, we characterized the fluorescence of 2 fluorescent proteins: mRFP and amajLime at different pH. We want to find out their optimum pH and see if they are suitable to be the reporter protein in our diagnostic test.

To examine the performance of mRFP and amajLime under different pH, we inserted the biobricks into pSB1A2 and expressed them in E. coli. mRFP and amajLime were then purified form lysed cells by anion exchange chromatography (AEC) and hydrophobic interaction chromatography (HIC).

Below picture shows the SDS–PAGE analysis of purification after HIC? of amajLime (left) and mRFP (right).

F.1 to F.3 represents chronological order of elutions in HIC. Samples (volume?) were mixed with 10 µl 2X SDS gel-loading buffer and 10 µl of the mixture were loaded on the SDS-gel. The purest fraction, F.2 in both cases, were selected to proceed to pH stability test, where purified proteins were diluted in buffers in the range of pH 2-12 to a final concentration of ZZZ mg/mL, and the fluorescence intensity at XXX nm (Ex YYY nm) was recorded by BMG ClarioStar plate reader.