Difference between revisions of "Team:Kyoto/Experiments"

Line 111: Line 111:
 
<li><a href="#Methods of taking movies">4-14 Methods of taking movies</a></li>
 
<li><a href="#Methods of taking movies">4-14 Methods of taking movies</a></li>
 
<li><a href="#Way of making agar pad">4-15 Way of making agar pad</a></li>
 
<li><a href="#Way of making agar pad">4-15 Way of making agar pad</a></li>
−
<li><a href="#Soaking">4-16 Soaking</a></li>
+
<li><a href="#dsRNA">4-16 Synthesis of dsRNA</a></li>
 +
<li><a href="#Soaking">4-17 Soaking</a></li>
 
<!--------------------------------------------------------- BLOCK Contents-3 Methods  END------------------------------------------------------------>
 
<!--------------------------------------------------------- BLOCK Contents-3 Methods  END------------------------------------------------------------>
 
   </li>
 
   </li>
Line 219: Line 220:
 
<!------------------------------------------------------BLOCK Methods PY---------------------------------------------------------------->
 
<!------------------------------------------------------BLOCK Methods PY---------------------------------------------------------------->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Miniprep">Miniprep</h2>
+
<h2 id = "Miniprep">4-1 Miniprep</h2>
 
<p>
 
<p>
 
Minipreps were performed using FastGene&#8482;Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
 
Minipreps were performed using FastGene&#8482;Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
Line 226: Line 227:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Gel Extraction and PCR purification">Gel Extraction and PCR purification</h2>
+
<h2 id = "Gel Extraction and PCR purification">4-2 Gel Extraction and PCR purification</h2>
 
<p>
 
<p>
 
Gel Extraction was performed using Wizard® SV Gel and PCR Clean-Up System according to the manufacturer's protocols.  
 
Gel Extraction was performed using Wizard® SV Gel and PCR Clean-Up System according to the manufacturer's protocols.  
Line 233: Line 234:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Restriction Enzyme Digestion">Restriction Enzyme Digestion</h2>
+
<h2 id = "Restriction Enzyme Digestion">4-3 Restriction Enzyme Digestion</h2>
 
<p>
 
<p>
 
Restriction enzyme treatment was performed using Takara Bio's or NEB's restriction enzymes according to the respective manufacturer's protocols.
 
Restriction enzyme treatment was performed using Takara Bio's or NEB's restriction enzymes according to the respective manufacturer's protocols.
Line 240: Line 241:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Ligation">Ligation</h2>
+
<h2 id = "Ligation">4-4 Ligation</h2>
 
<p>
 
<p>
 
Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's
 
Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's
Line 247: Line 248:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Transformation">Transformation</h2>
+
<h2 id = "Transformation">4-5 Transformation</h2>
 
<ol>
 
<ol>
 
<li>Thaw competent cells on ice</li>
 
<li>Thaw competent cells on ice</li>
Line 258: Line 259:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "PCR">PCR</h2>
+
<h2 id = "PCR">4-6 PCR</h2>
 
<p>
 
<p>
 
PCR was performed using KAPA™HiFi HotStart ReadyMix (2x), KAPA™ 2G Robust HotStart ReadyMix (2x), PrimeSTAR® Max DNA Polymerase, GoTaq®, Takara Ex Taq, and Quick Taq® HS DyeMix according to the manufacturer's protocols
 
PCR was performed using KAPA™HiFi HotStart ReadyMix (2x), KAPA™ 2G Robust HotStart ReadyMix (2x), PrimeSTAR® Max DNA Polymerase, GoTaq®, Takara Ex Taq, and Quick Taq® HS DyeMix according to the manufacturer's protocols
Line 265: Line 266:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Sequencing">Sequencing</h2>
+
<h2 id = "Sequencing">4-7 Sequencing</h2>
 
<p>
 
<p>
 
We outsourced the sequencing to Macrogen
 
We outsourced the sequencing to Macrogen
Line 275: Line 276:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "RT-PCR">RT-PCR</h2>
+
<h2 id = "RT-PCR">4-8 RT-PCR</h2>
 
<p>
 
<p>
 
We extracted B. Xylophilus whole mRNA using Sepazol®-RNA Ⅰ Super G according to the manufacturer's protocol.  
 
We extracted B. Xylophilus whole mRNA using Sepazol®-RNA Ⅰ Super G according to the manufacturer's protocol.  
Line 285: Line 286:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "RTqPCR">RTqPCR</h2>
+
<h2 id = "RTqPCR">4-9 RTqPCR</h2>
 
<p>
 
<p>
 
????????
 
????????
Line 292: Line 293:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Western blotting (Sample preparation of S. cerevisiae)">Western blotting (Sample preparation of S. cerevisiae)</h2>
+
<h2 id = "Western blotting (Sample preparation of S. cerevisiae)">4-10 Western blotting (Sample preparation of S. cerevisiae)</h2>
 
<ol>
 
<ol>
 
<li>Cultivate 1ml of  S. cerevisiae culture whose OD600 values are 1.0</li>
 
<li>Cultivate 1ml of  S. cerevisiae culture whose OD600 values are 1.0</li>
Line 304: Line 305:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Western blotting (Basic protocol)">Western blotting (Basic protocol)</h2>
+
<h2 id = "Western blotting (Basic protocol)">4-11 Western blotting (Basic protocol)</h2>
 
<ol>
 
<ol>
 
<li>Apply sample to SDS-PAGE minigel (BIOCRAFT 15%)</li>
 
<li>Apply sample to SDS-PAGE minigel (BIOCRAFT 15%)</li>
Line 327: Line 328:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Culture using yeasts and measurement">Culture using yeasts and measurement</h2>
+
<h2 id = "Culture using yeasts and measurement">4-12 Culture using yeasts and measurement</h2>
 
<ol>
 
<ol>
 
<li>Prepare medium put on 3.5 cm plate.</li>
 
<li>Prepare medium put on 3.5 cm plate.</li>
Line 338: Line 339:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "The way of taking photos">The way of taking photos</h2>
+
<h2 id = "The way of taking photos">4-13 The way of taking photos</h2>
 
<ol>
 
<ol>
 
<li>Culture yeasts expressing GFP over night and dilute them three times with DW or SD liquid medium.</li>
 
<li>Culture yeasts expressing GFP over night and dilute them three times with DW or SD liquid medium.</li>
Line 348: Line 349:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Methods of taking movies">Methods of taking movies</h2>
+
<h2 id = "Methods of taking movies">4-14 Methods of taking movies</h2>
 
<ol>
 
<ol>
 
<li>Make agar pad.</li>
 
<li>Make agar pad.</li>
Line 359: Line 360:
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Way of making agar pad">Way of making agar pad</h2>
+
<h2 id = "Way of making agar pad">4-15 Way of making agar pad</h2>
 
<ol>
 
<ol>
 
<li>Make medium of 2% agar and sterlize by autoclave.</li>
 
<li>Make medium of 2% agar and sterlize by autoclave.</li>
Line 367: Line 368:
 
</ol>
 
</ol>
 
<!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ -->
 
<!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ -->
 +
<h2 id="dsRNA">4-16 Synthesis of dsRNA</h2>
 +
<p>We synthesyzed dsRNA by "MEGAscript™ T7 Transcription Kit."<br><a href="https://www.thermofisher.com/order/catalog/product/AM1334">https://www.thermofisher.com/order/catalog/product/AM1334</a></p>
  
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
−
<h2 id = "Soaking">Soaking</h2>
+
<h2 id = "Soaking">4-17 Soaking</h2>
 
<ol>
 
<ol>
 
<li>Soak B. xylophilus in 50μl of 2μg /μl dsRNA solution.</li>
 
<li>Soak B. xylophilus in 50μl of 2μg /μl dsRNA solution.</li>

Revision as of 07:38, 28 October 2017

Material&Methods

  • 1) Parts
  • 2) Primer list
  • 3) Materials
  • 4) Methods

    1) Parts

    Basic Parts
    Composite Parts

    2) Primer List

    primer namesequenceLengthTmGC%DesignerManufacturer
    tropomyosinFGATCGAGAAGGACAACGCCC206560FukudaMacrogen Japan Corp
    tropomyosinT7RTAATACGACTCACTATAGGGCTTGTTTTCTCCGGC
    TTCGG    		407948FukudaMacrogen Japan Corp
    tropomyosinT7FTAATACGACTCACTATAGGGGATCGAGAAGGACAA
    CGCCC    		407950FukudaMacrogen Japan Corp
    tropomyosinRCTTGTTTTCTCCGGCTTCGG206655FukudaMacrogen Japan Corp
    top-1FGACTTTTCGTGCGTCTTCGG206455FukudaMacrogen Japan Corp
    top-1T7RTAATACGACTCACTATAGGGCCCGGTTGAAAAGCA
    AGTGT    		407845FukudaMacrogen Japan Corp
    top-1T7FTAATACGACTCACTATAGGGGACTTTTCGTGCGTC
    TTCGG    		407848FukudaMacrogen Japan Corp
    top-1RCCCGGTTGAAAAGCAAGTGT206450FukudaMacrogen Japan Corp
    eef-1gFGCAAAGGTTGCCGGTAAGAC206455FukudaMacrogen Japan Corp
    eef-1gT7RTAATACGACTCACTATAGGGGACGGCAGAGGCCAA
    CTTTA    		407848FukudaMacrogen Japan Corp
    eef-1gT7FTAA
    TACGACTCACTATAGGGGCAAAGGTTGCCGGT
    AAGAC    		407748FukudaMacrogen Japan Corp
    eef-1gRGACGGCAGAGGCCAACTTTA206455FukudaMacrogen Japan Corp
    asbFGGACTTTGGTCGTTGTCCCA206355FukudaMacrogen Japan Corp
    asbT7RTAATACGACTCACTATAGGGTCCACAGCGTCCTTC
    AAGTC    		407548FukudaMacrogen Japan Corp
    asbT7FTAATACGACTCACTATAGGGGGACTTTGGTCGTTG
    TCCCA    		407848FukudaMacrogen Japan Corp
    asbRTCCACAGCGTCCTTCAAGTC206155FukudaMacrogen Japan Corp
    14-3-3proteinF-2TGGAGGGTGATCTCGTCCAT206255FukudaMacrogen Japan Corp
    14-3-3proteinT7R-2TAATACGACTCACTATAGGG CAAGGGGGATGGTT
    GGTCTC    		417849FukudaMacrogen Japan Corp
    14-3-3proteinT7F-2TAATACGACTCACTATAGGG TGGAGGGTGATCTC
    GTCCAT    		417646FukudaMacrogen Japan Corp
    14-3-3proteinR-2CAAGGGGGATGGTTGGTCTC206560FukudaMacrogen Japan Corp
    actinFAATGGCTCCGGTATGTGCAA206550FukudaMacrogen Japan Corp
    actinRTGGTGGTGAAAGAGTAGCCG206255FukudaMacrogen Japan Corp
    14-3-3zetaFCCTACAAGAACGTGGTCGGT206155FukudaMacrogen Japan Corp
    14-3-3zetaT7RTAATACGACTCACTATAGGGTGTGAGTGCTCGCAA
    ACTGT    		407545FukudaMacrogen Japan Corp
    14-3-3zetaT7FTAATACGACTCACTATAGGGCCTACAAGAACGTGG
    TCGGT    		407648FukudaMacrogen Japan Corp
    14-3-3zetaRTGTGAGTGCTCGCAAACTGT206050FukudaMacrogen Japan Corp
    14-3-3proFTCTCGGTCGCCTACAAGAAC206155FukudaMacrogen Japan Corp
    14-3-3proT7RTAATACGACTCACTATAGGGCCAGTCTCTCCCGTC
    TCGTT    		407750FukudaMacrogen Japan Corp
    14-3-3proT7FTAATACGACTCACTATAGGGTCTCGGTCGCCTACA
    AGAAC    		407548FukudaMacrogen Japan Corp
    14-3-3proRCCAGTCTCTCCCGTCTCGTT206260FukudaMacrogen Japan Corp
    AK1FTCGGAGACGGTTGTGTGAAGATG236652YoshimotoMacrogen Japan Corp
    AK1T7R TAATACGACTCACTATAGGGCAAGCACGGGTTGA
    ATGGGT    		417946YoshimotoMacrogen Japan Corp
    AK1T7FTAATACGACTCACTATAGGGTCGGAGACGGTTGTG
    TGAAGATG    		437747YoshimotoMacrogen Japan Corp
    AK1RCAAGCACGGGTTGAATGGGT206655YoshimotoMacrogen Japan Corp
    longAK2FTCCGAATCATGGCGAGAACC206655YoshimotoMacrogen Japan Corp
    longAK2T7RTAATACGACTCACTATAGGGCATGCCGGTCAACGG
    ATAGT    		407848YoshimotoMacrogen Japan Corp
    longAK2T7FTAATACGACTCACTATAGGGTCCGAATCATGGCGA
    GAACC    		407848YoshimotoMacrogen Japan Corp
    longAK2RCATGCCGGTCAACGGATAGT206455YoshimotoMacrogen Japan Corp
    shortAK2FCCGTTTTGGATTTGTCGCGT206750YoshimotoMacrogen Japan Corp
    shortAK2T7RTAATACGACTCACTATAGGGTCGATCTTCTTGACC
    GTCGC    		407748YoshimotoMacrogen Japan Corp
    shortAK2T7FTAATACGACTCACTATAGGGCCGTTTTGGATTTGT
    CGCGT    		407945YoshimotoMacrogen Japan Corp
    shortAK2RTCGATCTTCTTGACCGTCGC206455YoshimotoMacrogen Japan Corp
    gal1-1FcccCGAATTCccccattatctt226850YoshimotoMacrogen Japan Corp
    gal1-1RCTCCCACACCAGCATCCAA196358YoshimotoMacrogen Japan Corp
    gal1-2FAAGCTGGGCGCCACTTT176459YoshimotoMacrogen Japan Corp
    gal1-2RCAAGTCGTTGCTGAAGAAACATTTCAC276641YoshimotoMacrogen Japan Corp
    gal1-3FACTCGGCGTCCGGAG156173YoshimotoMacrogen Japan Corp
    gal1-3RtacccTGCAGgggagc165969YoshimotoMacrogen Japan Corp
    gpd-1FtctagaggatccccCGAATTC216352YoshimotoMacrogen Japan Corp
    gpd-1RCCGTTGACCGGCATGct176565YoshimotoMacrogen Japan Corp
    gpd-2FAATCCGCTGTGGCCGC166669YoshimotoMacrogen Japan Corp
    gpd-2RAACCACCTTCTTCGCACAGAAC226350YoshimotoMacrogen Japan Corp
    gpd-3FGACGTCCTTGGTGAAATGTTTC226145YoshimotoMacrogen Japan Corp
    gpd-3Rgggaaaaccctggcgttac196458YoshimotoMacrogen Japan Corp
    IK21CCTCCACAAAGGCCTCTCCT206460YoshimotoMacrogen Japan Corp
    IK22CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG357034YoshimotoMacrogen Japan Corp
    IK23ATTTATTGGAGAAAGATAACATATCATACTTTCCC356629YoshimotoMacrogen Japan Corp
    IK24AACCTTTATTGTGTGCACACTCAAAC266338YoshimotoMacrogen Japan Corp
    IK25GATAATATAAAGATGGGCAGCAGCCATCAT306940YoshimotoMacrogen Japan Corp
    IK26CCAATAAATCTATTCTTTAGCTCCTGACTCCAATA
    TTGTA    		407032YoshimotoMacrogen Japan Corp
    IK27ACTAGTGGATCCCCCCCTCCACAAAGGCCTCTCCT358160YoshimotoMacrogen Japan Corp
    IK28GAATTCCTGCAGCCCAACCTTTATTGTGTGCACAC
    TCAAAC    		418046YoshimotoMacrogen Japan Corp
    IK60GTGTAGGCCTCGGCATCCG196768YoshimotoMacrogen Japan Corp
    IK61TAATACGACTCACTATAGGGGTGGAGAGGGTGAAG
    GTGATG    		417749YoshimotoMacrogen Japan Corp
    IK62TAATACGACTCACTATAGGGTGCCATGTGTAATCC
    CAGCAG    		417746YoshimotoMacrogen Japan Corp
    IK81atgtatTCTAGAcTCCTCCACAAAGGCCTCTCCTG
    G    		367550DouMacrogen Japan Corp
    IK82GCCCCCTGCAtGCCCTCC187278DouMacrogen Japan Corp
    IK83GCGCAGGAGGGCaTGCAGG197374DouMacrogen Japan Corp
    IK84gtACTAGTgCTTTATATTATCAATATTTGTGTTTG
    TGGAGGGGGGGG    		477740DouMacrogen Japan Corp
    IK85GGGTCGCGGATCCgaaCtcATGG237565DouMacrogen Japan Corp
    IK86CGCTTCTTCCTGCCATgaGttcGGA257456DouMacrogen Japan Corp
    IK87atgtatTCTAGAcaatgggcagcagccatc307147DouMacrogen Japan Corp
    IK88gtACTAGTgCTATTCTTTAGCTCCTGACTCCA326644DouMacrogen Japan Corp
    IK89AAT CTA GAA GCG GCC GCA CAC GCT TT
    TTC    		387739DouMacrogen Japan Corp
    IK90GAACTAGTCAGAGATCTGAGTCCGGACTTGTACAG
    CTC    		387350DouMacrogen Japan Corp
    IK91ccgcaaaatcaggtgtgttg206350YoshimotoMacrogen Japan Corp
    IK92tatctttaccaattagtttcaatgtttagtaagg346326YoshimotoMacrogen Japan Corp
    IK93AATGACGCTGACGGTACAGG206155YoshimotoMacrogen Japan Corp
    IK94ATGCCCCAGACTGTGAGTTG206155YoshimotoMacrogen Japan Corp
    IK95ggttgtgtgaagatgaccgc206155YoshimotoMacrogen Japan Corp
    IK96tcttcagcagggacttgcag206255YoshimotoMacrogen Japan Corp
    IK97agcgttcaactagcagacca205950YoshimotoMacrogen Japan Corp
    IK98agggcagattgtgtggacag206155YoshimotoMacrogen Japan Corp
    IK99TGGCGAGAACCACCTTCTTC206355YoshimotoMacrogen Japan Corp
    IK100 GCTCCCTGGTTGAACGTGTA216152YoshimotoMacrogen Japan Corp
    IK21-2CCTCCACAAAGGCCTCTCCT206460YoshimotoMacrogen Japan Corp
    IK22-2CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG357034YoshimotoMacrogen Japan Corp
    IK121GCCTCTCCTGGGGTTTGAG196363OharaMacrogen Japan Corp
    IK122CTCCACAAACACAAATATTGATAATATAAAGatgg
    gcagc    		407335OharaMacrogen Japan Corp
    IK129CCTCCACAAACACAAATATTGATAATATAAAGatg
    ggcagcagccatcat    		508038OharaMacrogen Japan Corp
    IK130GGAAAGTATGATATGTTATCTTTCTCCAATAAATC
    TATTCTTTAGCTCCTGACTCCAATATTGTA    		657731OharaMacrogen Japan Corp
    IK101atgtcttctagagcggtaggt215648YoshimotoMacrogen Japan Corp
    IK102cctgattttgcggccgcatccgtcgaaactaagttctgg398554YoshimotoMacrogen Japan Corp
    IK103aacttagtttcgacggat gcggccgcaaaatcag
    g    		368350YoshimotoMacrogen Japan Corp
    IK104gcACTAGTtgaagcttctctatct245642YoshimotoMacrogen Japan Corp
    IK105atgtcttctagagccccattatcttagcctaaaaaaacc397338YoshimotoMacrogen Japan Corp
    IK106cctgattttgcggccgcctccatggtggcggc329069YoshimotoMacrogen Japan Corp
    IK107cccgccgccaccatggaggcggccgcaaaatcagg359471YoshimotoMacrogen Japan Corp

    3) Materials

    Kit

    NameSupplier
    Wizard® SV Gel and PCRPromega
    FastGene™Plasmid Mini KitNIPPON Genetics Co.,Ltd

    Restriction Enzyme

    NameSupplier
    EcoRITaKaRa, Promega
    PstITaKaRa, Promega
    SpeITaKaRa, Promega

    Polymerase

    NameSupplier
    KAPA™HiFi HotStart ReadyMix (2x)KAPABIOSYSTEMS
    KAPA2G™ Fast HotStart ReadyMix with dye (2x)KAPABIOSYSTEMS
    KAPATaq™EXtra HotStart ReadyMix with dyeKAPABIOSYSTEMS

    DNA ligase

    NameSupplier

    Marker

    NameSupplier
    1kb DNA LadderTaKaRa

    Organism

    NameSupplier
    E.coli DH5α GenotypeTaKaRa
    E.coli BL21(DE3)pLysS Competent CellsPromega

    Antibiotics

    NameSupplier

    Equipment

    Name Supplier
    BioPhotometereppendorf
    LABO SHAKERBIO CRAFT
    CO2 INCUBATORSANYO
    Pipette ControllerBiohit Midi Plus
    MiniCentrifuge Model GMC-060LMS CO.,LTD.
    HIGH-SPEED REFRIGERATED CENTRIFUGETOMY
    HIGH-PRESSURE STEAM STERILIZERTOMY
    VOTEX-GENE2Scientific Industryes
    Scanning Electron Miniscope TM1000sHITACHI
    Fluorescence Microscope BX61N-34-FL-1-DOLYMPUS
    SCIECE IMAGING SYSTEM LAS-3000Fuji film

    Backbone

    NameSupplier
    pSB1C3iGEM registry
    pSB1A2iGEM registry
    pSB3C5iGEM registry

    Buffer

    NameSupplier
    Sodium CarbonateWako
    Sodium BicarbonateWako
    Methanol(99.5%)Wako
    Sodium ChlorideWako
    SDSnacalai tesque
    Trisaminomethanenacalai tesque
    Potassium dihydrogenphosphsteSIGAMA-ALDRICH
    Potassium ChlorideWako
    GlycineWako
    Agar, PowderWako
    Agarose XPWako
    10% Hydrochloric AcidWako

    SDSPAGE&Westernblotting

    IMMOBILON - P Blotting SandwichesImmobilon
    REAL GEL PLATE (10%)BIO CRAFT
    BE-210(SDSPAGE)BIO CRAFT
    BE-330BIO CRAFT
    Amersham ECL Anti-Mouse IgGGE healthcare
    Amersham ECL Anti-rabbit IgGGE healthcare
    Amersham ECL Prime Blocking ReagentGE healthcare
    Amersham ECL Prime WB Detection ReagentGE healthcare

    B.xylophilus Experiment

    4) Methods

    4-1 Miniprep

    Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.

    4-2 Gel Extraction and PCR purification

    Gel Extraction was performed using Wizard® SV Gel and PCR Clean-Up System according to the manufacturer's protocols.

    4-3 Restriction Enzyme Digestion

    Restriction enzyme treatment was performed using Takara Bio's or NEB's restriction enzymes according to the respective manufacturer's protocols.

    4-4 Ligation

    Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's

    4-5 Transformation

    1. Thaw competent cells on ice
    2. Add DNA sample (2.5μl) to competent cells. leave them on ice for 15 minutes
    3. Keep them in heating block for 45 seconds, then cool on ice for 2 minutes
    4. Add 90μl SOC liquid culture medium, then incubate for 45 minutes at 37°C
    5. Seed cells onto LB+antibiotics agar plate. Incubate for 24 hours at 37°C

    4-6 PCR

    PCR was performed using KAPA™HiFi HotStart ReadyMix (2x), KAPA™ 2G Robust HotStart ReadyMix (2x), PrimeSTAR® Max DNA Polymerase, GoTaq®, Takara Ex Taq, and Quick Taq® HS DyeMix according to the manufacturer's protocols

    4-7 Sequencing

    We outsourced the sequencing to Macrogen

    http://www.macrogen-japan.co.jp/cap_seq_0203.php

    4-8 RT-PCR

    We extracted B. Xylophilus whole mRNA using Sepazol®-RNA Ⅰ Super G according to the manufacturer's protocol.

    RT-PCR was performed using ~~~ according to the manufacturer's protocol.

    4-9 RTqPCR

    ????????

    4-10 Western blotting (Sample preparation of S. cerevisiae)

    1. Cultivate 1ml of S. cerevisiae culture whose OD600 values are 1.0
    2. Pour 1ml of the S. cerevisiae cell culture into 1.5ml tubes
    3. Centrifuge 5000rpm for 1min and remove the supernatant
    4. Resuspend with 30ul of SDS sample buffer
    5. Heat samples for 10min at 100°C using block incubater
    6. Vortex well

    4-11 Western blotting (Basic protocol)

    1. Apply sample to SDS-PAGE minigel (BIOCRAFT 15%)
    2. Soak the gel in transfer buffer
    3. Soak PVDF membrane in 100% methanol for 30 sec
    4. Soak PVDF membrane and filter paper in transfer buffer, leave for 5 min
    5. Set filter paper, membrane, gels, filter paper in this order to semidry transfer from anode to cathode
    6. Transfer the proteins from the gel to the membrane with 100 mA for 1 h
    7. Soak membrane in blocking buffer (dilution of 5 g ECL Blocking reagent by 100ml of TBST) for 1 h
    8. Wash for 5 min 3 times with TBST
    9. Apply 1' antibody (dilution of 10 μl of 1’antibody by 10ml of Blocking buffer) and shake for 1 h
    10. Wash for 5 min 3 times with TBST
    11. Apply 2' antibody (dilution of 4μl of 2’antibody by 10ml of Blocking buffer) and shake for 1 h
    12. Wash for 5 min 3 times with TBST
    13. Drain excess wash buffer from the washed membrane and place on flat surface, protein side up
    14. Add detection reagent onto the membrane, covering all of the membrane
    15. Incubate for 5 minutes at room temperature
    16. Drain off excess detection reagent by dabbing with Kimwipe
    17. Place the sample in the CCD camera compartment and record the images

    4-12 Culture using yeasts and measurement

    1. Prepare medium put on 3.5 cm plate.
    2. Drop liquid-cultured yeasts on the center of medium.
    3. Disperse them by bacteria spreader and dry for 30min to 1 hour. Or leave them as they are.
    4. Pipette suspension including nematodes on the medium.
    5. Culture it at 25 ℃

    4-13 The way of taking photos

    1. Culture yeasts expressing GFP over night and dilute them three times with DW or SD liquid medium.
    2. Drop 200-300μl of water on the medium after one or two days, and pipette it in order to spread over the medium.
    3. Suck out 12ul of water on the medium and drop it on microscope slide.
    4. Cover it with cover glass and observe whether nematodes feed yeasts expressing GFP by fluorescence microscope.

    4-14 Methods of taking movies

    1. Make agar pad.
    2. Extract nematodes from PDA medium, collect them into 1.5ml tube and centrifuge it.
    3. Remove supernatant and put 1.5ul of suspension with nematodes into gap of cover glasses.
    4. Snap microscope slide with the finger and reach suspension to the center of agarose medium.
    5. Observe whether nematodes feed yeast expressing GFP by microscope and take videos of it.

    4-15 Way of making agar pad

    1. Make medium of 2% agar and sterlize by autoclave.
    2. Put sterlized slide glass between two of slide glasses covered with "Kimwipes", drop agar medium, then rapidly cover agar medium with another slide glass.
    3. After the medium sodifies, reveal slowly covered slide glass.
    4. Pipette yeasts on the medium, cover the medium on cover glass, and culture it for 1-2days.

    4-16 Synthesis of dsRNA

    We synthesyzed dsRNA by "MEGAscript™ T7 Transcription Kit."
    https://www.thermofisher.com/order/catalog/product/AM1334

    4-17 Soaking

    1. Soak B. xylophilus in 50μl of 2μg /μl dsRNA solution.
    2. Shake nematode suspensions lightly (200rpm) for 4 hours at 20℃
    3. Wash nematodes in DDW several times and allow them to recover at 20℃ in distilled water.
    4. Observe and record their morphology, locomotion, and mortality at 4, 8, 12, 24, 36, 48, and 60 hours.
    5. Score juveniles/adults as being dead if they did not move.