Difference between revisions of "Team:ZJU-China/Part Collection"

Line 1: Line 1:
−
{{ZJU-China}}
+
<html lang="zh-CN">
−
<html>
+
  <head>
  
  
−
</div>
+
<link href="https://2017.igem.org/Zju/css/bootstrap?action=raw&ctype=text/css" rel="stylesheet" media="screen" />
−
<div class="clear"></div>
+
<link href="https://2017.igem.org/Zju/css/bootstraptheme?action=raw&ctype=text/css" rel="stylesheet" id="bs-theme-stylesheet">
 +
<link href='https://2017.igem.org/Team:ZJU-China/cs/font?action=raw&ctype=text/css' rel='stylesheet' type='text/css'>
 +
<link href="https://2017.igem.org/Zju/css/docs/min?action=raw&ctype=text/css" rel="stylesheet" type="text/css"/>
 +
<link href="https://2017.igem.org/Zju/css/doc-style?action=raw&ctype=text/css" rel="stylesheet">
 +
<link href="https://2017.igem.org/Zju/css/responsive/min?action=raw&ctype=text/css" rel="stylesheet">
  
 +
<script>
 +
  var _hmt = _hmt || [];
 +
</script>
 +
      <link rel="stylesheet" href="../css/doc-style.css">
 +
  </head>
  
  
 +
<style>
 +
/*Override default CSS*/
 +
#sideMenu, #top_title {display:none;}
 +
#content { padding:0px; width:100%; margin-top:-7px; margin-left:0px;background-color: transparent;}
  
  
−
<div class="column full_size">
+
/* set all basic objects to neutral formatting*/
 +
html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, font, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, caption {
 +
    margin: 0;
 +
    padding: 0;
 +
    border: 0;
 +
    outline: 0;
 +
    font-size: 100%;
 +
    vertical-align: baseline;
 +
    background: transparent;
 +
}
  
 +
#globalWrapper {
 +
    margin: 0;
 +
    padding: 0;
 +
    border: 0;
 +
    outline: 0;
 +
    font-size: 100%;
 +
    vertical-align: baseline;
 +
    background: transparent;
 +
}
  
−
<h1> Part Collection </h1>
 
  
 +
/* set page to fill window*/
 +
html{
 +
  height: 100%;
 +
}
 +
body {
 +
  min-height: 100%;
 +
  background-color: #FFFFFF;
 +
}
  
−
<p>Did your team make a lot of great parts? Is there a theme that ties all your parts together? Do you have more than 10 parts in this collection? Did you make a CRISPR collection, a MoClo collection, or a collection of awesome pigment parts? Describe your parts collection on this page, so the judges can evaluate you for the Best Part Collection award.</p>
 
  
−
<p>
+
#content_wrapper {
−
While you should put all the characterization information for your parts on the Registry, you are encouraged to explain how all your parts form a collection on this page.
+
    position: relative;
−
</p>
+
  top: 0px;
−
<br>
+
  left: 0px; 
−
<h3>Best Part Collection Special Prize</h3>
+
  margin: 0px;
−
<p>Did your team make a lot of great parts? Is there a team that ties all your parts together? Do you have more than 10 parts in this collection? Did you make a CRISPR collection, a MoClo collection or a collection of awesome pigment parts? Tell the judges you should be evaluated for the Best Parts Collection award! To be eligible for this award, these parts must adhere to <a href="http://parts.igem.org/DNA_Submission">Registry sample submission guidelines</a> and have been sent to the Registry of Standard Biological Parts.
+
    width: 100%;
−
<br><br>
+
    height: 100%;
−
If you have a collection of parts you wish to nominate your team for this <a href="https://2017.igem.org/Judging/Awards">special prize</a>, make sure you add your part numbers to your <a href="https://2017.igem.org/Judging/Judging_Form">judging form</a> and delete the box at the top of this page.</p>
+
  text-align:center;
−
<br>
+
    background-color: #FFFFFF;
 +
}
  
 +
#content_wrapper p {
 +
    font-family: 'Tempus Sans ITC',Tahoma, Geneva, sans-serif;
 +
}
  
 +
#content_wrapper a {
 +
    color:#004789;
 +
}
  
−
<div class="highlight">
 
−
<h4>Note</h4>
 
−
<p>This page should list all the parts in the collection your team made during your project. You must add all characterization information for your parts on the Registry. You should not put characterization information on this page.</p>
 
  
 +
#footer {
 +
    position:absolute;   
 +
    bottom: 0px;
 +
    left: 0px;
 +
    width: 100%;
 +
    margin-top: 0px;
 +
    margin-bottom: 20px;
 +
    background-color: #FFFFFF;
 +
    text-align: center;
 +
}
 +
 +
.center {
 +
  width: 60%;
 +
    margin-top: 16px;
 +
  min-width: 500px;
 +
    padding-bottom:32px;
 +
  display: inline-block;       
 +
}
 +
 +
.TextContent { 
 +
  text-align: left;
 +
  vertical-align: baseline;
 +
  font-size: 0.875em;
 +
  font-family:'Tempus Sans ITC', verdana, sans-serif;
 +
}
 +
 +
.TextContent h1{
 +
  text-align: center;
 +
  font-size: 1.5rem;
 +
  margin-bottom: 1em;
 +
  margin-top: 0.2em;
 +
  color: #3399ff;
 +
  font-family:'Tempus Sans ITC', verdana, sans-serif;
 +
}
 +
 +
.TextContent h2{
 +
  line-height: 1.6;
 +
  margin-bottom: 0em;
 +
  margin-top: 1em;
 +
  text-align: left;
 +
  font-family:'Tempus Sans ITC', verdana, sans-serif;
 +
}
 +
 +
.TextContent p{
 +
  margin-bottom: 1.2em;
 +
  font-family:'Tempus Sans ITC', verdana, sans-serif;
 +
}
 +
 +
.Page_Wide { 
 +
  width:100%;
 +
}
 +
 +
.Quarter_Image {
 +
  width:25%;
 +
  max-height:250px;
 +
  float:left;
 +
}
 +
 +
.Quarter_Image img {
 +
    display:block;
 +
    margin:auto;
 +
    max-height: 250px; 
 +
    width: auto;
 +
}
 +
 +
.SocialMediaIconWrapper {
 +
    width:100%;
 +
}
 +
 +
.SocialMediaIcon {
 +
    width:4%;
 +
    height:auto;
 +
    margin-left:20px;
 +
    display: inline-block;
 +
    float:left;
 +
 +
}
 +
 +
.SocialMediaIcon img{
 +
    max-width:100%;
 +
  height:auto
 +
}
 +
 +
.TeamImage {
 +
  width:100%;
 +
}
 +
 +
.TeamImage img { 
 +
    max-width:100%;
 +
  height:auto
 +
}
 +
 +
.sponsors {
 +
  width: 100%; 
 +
}
 +
 +
.sponsor_row {   
 +
  width: 100%;
 +
}
 +
 +
.sponsor_img {   
 +
  width: 16.6666667%;
 +
  float:left;   
 +
}
 +
 +
.sponsor_img img{ 
 +
  max-width:100%;
 +
  height:auto
 +
}
 +
 +
.clear {
 +
    clear:both;
 +
}
 +
 +
.clear.extra_space {
 +
    height: 20px;
 +
}
 +
 +
.line_divider {
 +
    border-top: 1px solid #d3d3d3;
 +
    width: 98%;
 +
    margin: auto;
 +
}
 +
 +
.copyright{
 +
  color: #888888;
 +
  font-size: 13px;
 +
  text-align: center !important;
 +
}
 +
 +
 +
.copyright a{
 +
  color: #d2ebe3;
 +
  border-bottom: dotted 1px #a5d8c7;
 +
}
 +
 +
.PP {
 +
    font-family: georgia;
 +
    font-size: 20px;
 +
    font-weight: 100;
 +
    text-align: left;
 +
}
 +
 +
/*文中自定义*/
 +
.CuteButton:active {
 +
    -webkit-box-shadow: 0px 3px 0px rgba(0,52,63,1), 0px 3px 6px rgba(0,0,0,.9);
 +
    -moz-box-shadow: 0px 3px 0px rgba(0,52,63,1), 0px 3px 6px rgba(0,0,0,.9);
 +
    box-shadow: 0px 3px 0px rgba(0,52,63,1), 0px 3px 6px rgba(0,0,0,.9);
 +
    position: relative;
 +
    top: 6px;
 +
}
 +
 +
.YellowCB {
 +
    background-color: rgba(254,196,62,1);
 +
    -webkit-box-shadow: 0px 9px 0px rgba(245,253,202,1), 0px 9px 25px rgba(0,0,0,.7);
 +
    -moz-box-shadow: 0px 9px 0px rgba(245,253,202,1), 0px 9px 25px rgba(0,0,0,.7);
 +
    box-shadow: 0px 9px 0px rgba(245,253,202,1), 0px 9px 25px rgba(0,0,0,.7);
 +
}
 +
 +
.GreenCB {
 +
    background-color: rgba(25,148,117,1);
 +
    -webkit-box-shadow: 0px 9px 0px rgba(4,77,34,1), 0px 9px 25px rgba(0,0,0,.7);
 +
    -moz-box-shadow: 0px 9px 0px rgba(4,77,34,1), 0px 9px 25px rgba(0,0,0,.7);
 +
    box-shadow: 0px 9px 0px rgba(4,77,34,1), 0px 9px 25px rgba(0,0,0,.7);
 +
}
 +
 +
.SmallCB {
 +
    font-size: 1.5em;
 +
    margin-left: 2px;
 +
    padding: 2px 10px ;
 +
    width: 100px;
 +
}
 +
 +
 +
.ArticleHead{
 +
  font-family: 'Tempus Sans ITC',georgia !important;
 +
  font-size: 40px !important;
 +
  font-weight: 800 !important;
 +
  color: #56A36C !important;
 +
  text-align: center !important;
 +
    margin-bottom: 0 !important;
 +
    /*margin-top: .6em !important;*/
 +
}
 +
 +
.H3Head{
 +
  font-family: 'Tempus Sans ITC',georgia !important;
 +
  color: #FEC43E !important;
 +
  font-size: 25px !important;
 +
  font-weight: 400 !important;
 +
  text-align: left !important;
 +
    margin-bottom: 0 !important;
 +
    margin-top:.6em !important;
 +
}
 +
 +
.PP{
 +
  font-family:Tahoma, Geneva, sans-serif !important;
 +
  font-size: 20px !important;
 +
  font-weight: 100 !important;
 +
  text-align: left !important;
 +
}
 +
 +
 +
.Retract{
 +
  padding-left: 50px;
 +
}
 +
 +
.GreenAH{
 +
  color: #56A36C;
 +
}
 +
 +
.YellowAH{
 +
  color: #FEC43E;
 +
}
 +
 +
.contentLi{
 +
    margin:0;
 +
    font-size:17px;
 +
    line-height: 27px;
 +
    padding-bottom: 20px;
 +
    color: #111111;
 +
}
 +
 +
.grayTable
 +
{
 +
    background-color: #979797;
 +
}
 +
 +
.yellowTable
 +
{
 +
    background-color: #CD9B1D;
 +
    color: #000;
 +
}
 +
 +
h2{
 +
  font-family: 'Tempus Sans ITC';
 +
  font-weight: 500;
 +
  font-size: 35px;
 +
  text-align: left;
 +
}
 +
 +
h3{
 +
  font-family: 'Tempus Sans ITC';
 +
  font-weight: 500;
 +
  font-size: 32px;
 +
  text-align: left;
 +
}
 +
 +
h4{
 +
  font-family: 'Tempus Sans ITC';
 +
  font-weight: 500;
 +
  font-size: 28px;
 +
  text-align: left;
 +
}
 +
 +
h5{
 +
  font-family: 'Tempus Sans ITC';
 +
  font-weight: 500;
 +
  font-size: 25px;
 +
  text-align: left;
 +
}
 +
 +
p{
 +
  margin:0;
 +
  font-size:17px;
 +
  line-height: 30px;
 +
  /*padding-bottom: 20px;*/
 +
  color: #111111;
 +
}
 +
 +
.bs-docs-sidenav
 +
{
 +
    font-family:Tahoma, Geneva, sans-serif !important;
 +
    font-size: 20px !important;
 +
    font-weight: 100 !important;
 +
    text-align: left !important;
 +
}
 +
 +
 +
.textli li{
 +
    font-family:Tahoma, Geneva, sans-serif !important;
 +
    font-size: 20px !important;
 +
    font-weight: 100 !important;
 +
    text-align: left !important;
 +
}
 +
 +
.nonStyleTable
 +
{
 +
    background: transparent !important;
 +
    border:none !important;
 +
}
 +
 +
.textimg{
 +
    /*width:50%;*/
 +
    /*margin-top: 20px;*/
 +
    /*padding-bottom: 20px;*/
 +
    text-align: center;
 +
}
 +
 +
.redgene
 +
{
 +
    color: #3d7b4f !important;
 +
}
 +
 +
/*文中自定义*/
 +
</style>
 +
 +
  <body id="page-top" data-spy="scroll" data-target=".navbar-fixed-top">
 +
  <div class="page-loader"></div>
 +
      <!-- Docs master nav -->
 +
                  <!-- <h1><a class="navbar-brand" href="index.html">MuMei Lab</a></h1> -->
 +
 +
    <div class="container">
 +
      <!-- header -->
 +
      <div class="header-w3layouts">
 +
          <!-- Navigation -->
 +
          <nav class="navbar navbar-default navbar-fixed-top">
 +
              <div class="navbar-header page-scroll">
 +
                  <button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-ex1-collapse">
 +
                  </button>
 +
 +
                  <a href="https://2017.igem.org/Team:ZJU-China">
 +
                      <img style="margin-top:11px" class="navbar-brand"  src="https://static.igem.org/mediawiki/2017/d/d5/ZJUChina_logo.png">
 +
                  </a>
 +
 +
                  <!-- <h1><a class="navbar-brand" href="index.html">My Design</a></h1> -->
 +
 +
              </div>
 +
              <!-- Collect the nav links, forms, and other content for toggling -->
 +
              <div class="collapse navbar-collapse navbar-ex1-collapse">
 +
                  <ul class="nav navbar-nav navbar-right cl-effect-15">
 +
                      <!-- Hidden li included to remove active class from about link when scrolled up past about section -->
 +
                      <li class="hidden"><a class="page-scroll" href="#page-top"></a> </li>
 +
 +
                      <li class="m_nav_item dropdown">
 +
                          <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Overview<b class="caret"></b></a>
 +
                          <ul class="dropdown-menu ">
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Overview">Project Description</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Demonstrate">Demonstrate</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Achievements">Achievements</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Applied_Design">Applied Design</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Improve">Improve Parts</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/InterLab">InterLab</a></li>
 +
 +
                          </ul>
 +
                      </li>
 +
 +
                      <li class="m_nav_item dropdown">
 +
                          <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Project<b class="caret"></b></a>
 +
                          <ul class="dropdown-menu ">
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Project/st">Chemical Transduction</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Project/mt">Medium Wave Transduction</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Project/tp">Trichoderma Proof</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Project/voc">VOC sensors</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Project/Downstream">Downstream</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Project/conclusion">Conclusion</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Notebook">Notebook</a></li>
 +
                          </ul>
 +
                      </li>
 +
 +
                      <li class="m_nav_item dropdown" >
 +
                          <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Model<b class="caret"></b></a>
 +
                          <ul class="dropdown-menu ">
 +
                              <!--<li><a href="https://2017.igem.org/Team:ZJU-China/Model">Summery</a></li>-->
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Model">VOC analysis</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Model/Coculture">Coculture</a></li>
 +
 +
                          </ul>
 +
                      </li>
 +
 +
                      <li class="m_nav_item dropdown">
 +
                          <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Parts<b class="caret"></b></a>
 +
                          <ul class="dropdown-menu ">
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Composite_Part">Composite Parts</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Part_Collection">Part Collection</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Basic_Part">Basic Parts</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Parts">All Parts</a></li>
 +
 +
 +
                          </ul>
 +
                      </li>
 +
 +
                      <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware">Hardware</a></li>
 +
 +
                      <li class="m_nav_item dropdown" >
 +
                          <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Safety<b class="caret"></b></a>
 +
                          <ul class="dropdown-menu ">
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Safety">Environment</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Safety/Lab">Laboratory</a></li>
 +
                          </ul>
 +
                      </li>
 +
 +
                      <li class="m_nav_item dropdown">
 +
                          <a href="#" class="dropdown-toggle link" data-toggle="dropdown">HP<b class="caret"></b></a>
 +
                          <ul class="dropdown-menu ">
 +
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Human_Practices">Summary</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/HP/Silver">Silver</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/HP/Gold_Integrated">Gold Integrated</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Engagement">Engagement</a></li>
 +
                          </ul>
 +
                      </li>
 +
 +
                      <li class="m_nav_item dropdown" >
 +
                          <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Team<b class="caret"></b></a>
 +
                          <ul class="dropdown-menu ">
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Collaborations">Collaboration</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Team">Teammates</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Attributions">Attribution</a></li>
 +
                          </ul>
 +
                      </li>
 +
 +
                  </ul>
 +
              </div>
 +
          </nav>
 +
      </div>
 +
  </div>
 +
 +
<p></p>
 +
<div style="margin-top:0;padding-top:0">
 +
  <img src="https://static.igem.org/mediawiki/2017/6/61/ZJU_China_interlab_header.jpg" width="100%">
 +
  <!-- <img src="images/HP_temp/banner.jpg" width="100%"> -->
 
</div>
 
</div>
 +
 +
 +
<div style="width: 100%" class="container zjuContent">
 +
  <div class="col-md-3"></div>
 +
    <div class="col-md-9" role="main">
 +
      <div class="bs-docs-section">
 +
 +
 +
  <h1 id="improve" class="ArticleHead GreenAH">Part Collection</h1>
 +
      <p class="PP">It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the Wild-type T7 promoter to get a collection of modified T7 promoters.</p>
 +
      <p class="PP">T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the site from -20 to -12. The sequences of these modified promoters are shown in the Table below.</p>
 +
    <h2 id="sms" class="H2Head">Sequences of Modified Promoters</h2>
 +
          <table class="table">
 +
              <tr><th class="yellowTable">Part number</th><th class="yellowTable">Sequence(-20~+6)</th></tr>
 +
              <tr><th class="grayTable">BBa_K525998(wild type)</th><th>gagtaatacgactcactatagggaaa</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207024</th><th><a class="redgene">t</a>agtaatacgactcactatagggaaa</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207025</th><th>aa<a class="redgene">g</a>taatacgactcactatagggaaa</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207026</th><th>ga<a class="redgene">a</a>taatacgactcactatagggaaa</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207027</th><th>ga<a class="redgene">t</a>taatacgactcactatagggaaa</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207028</th><th>ga<a class="redgene">t</a>taata<a class="redgene">a</a>gactcactatagggaaa</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207029</th><th>ga<a class="redgene">t</a>taata<a class="redgene">t</a>gactcactatagggaaa</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207030</th><th><a class="redgene">t</a>a<a class="redgene">t</a>taatacgactcactatagggaaa</th></tr>
 +
          </table>
 +
 +
      <h2 id="test" class="H2Head">Test</h2>
 +
          <p class="PP">To test the function of mutant promoters, we chose the <a class="cite" href="http://parts.igem.org/Part:BBa_E1010">mRFPas</a> our reporter. By assessing the relative fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure below.</p>
 +
          <div class="imgdiv"><img class="textimg" src="https://static.igem.org/mediawiki/2017/2/23/ZJU_China_imporve_1.png"></div>
 +
            <p class="capture">Relative Strength of wildtype T7 promoter and mutant promoters</p>
 +
          <p class="PP">As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.</p>
 +
  
 
</div>
 
</div>
  
 +
 +
 +
<!-- 右侧监听开始 -->
 +
<div class="col-md-3 disappear-on-top" role="complementary">
 +
  <nav  style="position: fixed; top: 100px ; left:50px; " class="bs-docs-sidebar hidden-print hidden-xs hidden-sm">
 +
    <ul class="nav bs-docs-sidenav shorterli">
 +
        <li><a href="#improve">Improve Part</a></li>
 +
        <li><a href="#sms">Sequences of Modified Promoters</a></li>
 +
        <li><a href="#test">Test</a></li>
 +
 +
    </ul>
 +
 +
  <a class="back-to-top" href="#top">
 +
  <!--  <i class="fa fa-arrow-up nav_icon"></i> -->
 +
    <img style="width: 50px;" src="https://static.igem.org/mediawiki/2017/d/da/ZJU_China_UP.png">
 +
  </a>
 +
 +
           
 +
          </nav>
 +
        </div>
 +
       
 +
      </div>
 +
</div>
 +
<!-- 右侧监听结束 -->
 +
<!-- footer开始 -->
 +
<div class="footer"  style="background-color: #000000">
 +
  <div class="copyright container text-center">
 +
      <p><br></p>
 +
    <p class="copyright">Copyright &copy; 2017 ZJU-IGEM | <a href="http://www.zju.edu.cn/">Zhejiang University</a> |</p>
 +
    <p><br></p>
 +
  </div>
 +
</div>
 +
<!-- footer结束 -->
 +
 +
 +
<script src="https://code.jquery.com/jquery-2.1.4.min.js"></script>
 +
  <!--script src="js/bootstrap.min.js"></script-->
 +
  <script src="https://static.igem.org/mediawiki/2017/8/85/ZJUChina_js_docsmin.txt"></script>
 +
  <!--script src="js/button.js"></script-->
 +
  <script src="https://static.igem.org/mediawiki/2017/2/22/ZJUChina_bootstrap.min.txt"></script>
 +
  <script src="https://static.igem.org/mediawiki/2017/3/32/ZJUChina_docs.min.txt"></script>
 +
  <script src="https://static.igem.org/mediawiki/2017/e/e0/ZJUChina_button.txt"></script>
 +
 +
  <!--<script src="js/scrolling-nav.js"></script>-->
 +
  <script src="https://2017.igem.org/Zju/js/scrollingnav?action=raw&ctype=text/javascript"></script>
 +
  <script src="https://static.igem.org/mediawiki/2017/c/c0/ZJUChina_txtSmoothScroll.min.txt"></script>
 +
 +
  </body>
 
</html>
 
</html>

Revision as of 11:35, 29 October 2017

Part Collection

It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the Wild-type T7 promoter to get a collection of modified T7 promoters.

T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the site from -20 to -12. The sequences of these modified promoters are shown in the Table below.

Sequences of Modified Promoters

Part numberSequence(-20~+6)
BBa_K525998(wild type)gagtaatacgactcactatagggaaa
BBa_K2207024tagtaatacgactcactatagggaaa
BBa_K2207025aagtaatacgactcactatagggaaa
BBa_K2207026gaataatacgactcactatagggaaa
BBa_K2207027gattaatacgactcactatagggaaa
BBa_K2207028gattaataagactcactatagggaaa
BBa_K2207029gattaatatgactcactatagggaaa
BBa_K2207030tattaatacgactcactatagggaaa

Test

To test the function of mutant promoters, we chose the mRFPas our reporter. By assessing the relative fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure below.

Relative Strength of wildtype T7 promoter and mutant promoters

As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.


Copyright © 2017 ZJU-IGEM | Zhejiang University |