Zhiling Zhou (Talk | contribs) |
Zhiling Zhou (Talk | contribs) |
||
Line 1: | Line 1: | ||
− | |||
<html lang="zh-CN"> | <html lang="zh-CN"> | ||
<head> | <head> | ||
− | |||
<link href="https://2017.igem.org/Zju/css/bootstrap?action=raw&ctype=text/css" rel="stylesheet" media="screen" /> | <link href="https://2017.igem.org/Zju/css/bootstrap?action=raw&ctype=text/css" rel="stylesheet" media="screen" /> | ||
<link href="https://2017.igem.org/Zju/css/bootstraptheme?action=raw&ctype=text/css" rel="stylesheet" id="bs-theme-stylesheet"> | <link href="https://2017.igem.org/Zju/css/bootstraptheme?action=raw&ctype=text/css" rel="stylesheet" id="bs-theme-stylesheet"> | ||
− | |||
<link href="https://2017.igem.org/Zju/css/docs/min?action=raw&ctype=text/css" rel="stylesheet" type="text/css"/> | <link href="https://2017.igem.org/Zju/css/docs/min?action=raw&ctype=text/css" rel="stylesheet" type="text/css"/> | ||
+ | <!-- <link href="css/doc-style.css" rel="stylesheet" type="text/css"/> --> | ||
<link href="https://2017.igem.org/Zju/css/doc-style?action=raw&ctype=text/css" rel="stylesheet"> | <link href="https://2017.igem.org/Zju/css/doc-style?action=raw&ctype=text/css" rel="stylesheet"> | ||
<link href="https://2017.igem.org/Zju/css/responsive/min?action=raw&ctype=text/css" rel="stylesheet"> | <link href="https://2017.igem.org/Zju/css/responsive/min?action=raw&ctype=text/css" rel="stylesheet"> | ||
− | + | <!-- 按钮的字体 --> | |
+ | <link href='http://fonts.googleapis.com/css?family=Yanone+Kaffeesatz:700' rel='stylesheet' type='text/css'> | ||
+ | <!-- 按钮的字体end --> | ||
<script> | <script> | ||
var _hmt = _hmt || []; | var _hmt = _hmt || []; | ||
</script> | </script> | ||
− | |||
</head> | </head> | ||
Line 68: | Line 67: | ||
#content_wrapper p { | #content_wrapper p { | ||
− | font-family: ' | + | font-family: 'Yanone Kaffeesatz',Tahoma, Geneva, sans-serif; |
} | } | ||
Line 99: | Line 98: | ||
vertical-align: baseline; | vertical-align: baseline; | ||
font-size: 0.875em; | font-size: 0.875em; | ||
− | font-family:' | + | font-family:'Yanone Kaffeesatz', verdana, sans-serif; |
} | } | ||
Line 108: | Line 107: | ||
margin-top: 0.2em; | margin-top: 0.2em; | ||
color: #3399ff; | color: #3399ff; | ||
− | font-family:' | + | font-family:'Yanone Kaffeesatz', verdana, sans-serif; |
} | } | ||
Line 116: | Line 115: | ||
margin-top: 1em; | margin-top: 1em; | ||
text-align: left; | text-align: left; | ||
− | font-family:' | + | font-family:'Yanone Kaffeesatz', verdana, sans-serif; |
} | } | ||
.TextContent p{ | .TextContent p{ | ||
margin-bottom: 1.2em; | margin-bottom: 1.2em; | ||
− | font-family:' | + | font-family:'Yanone Kaffeesatz', verdana, sans-serif; |
} | } | ||
Line 217: | Line 216: | ||
font-weight: 100; | font-weight: 100; | ||
text-align: left; | text-align: left; | ||
+ | line-height: 35px; | ||
} | } | ||
Line 248: | Line 248: | ||
width: 100px; | width: 100px; | ||
} | } | ||
+ | |||
.ArticleHead{ | .ArticleHead{ | ||
− | + | font-family: 'Tempus Sans ITC',georgia !important; | |
− | + | font-size: 40px !important; | |
− | + | font-weight: 800 !important; | |
− | + | color: #56A36C !important; | |
− | + | text-align: center !important; | |
margin-bottom: 0 !important; | margin-bottom: 0 !important; | ||
− | + | margin-top: .6em !important; | |
} | } | ||
.H3Head{ | .H3Head{ | ||
− | + | font-family: 'Tempus Sans ITC',georgia !important; | |
− | + | color: #FEC43E !important; | |
− | + | font-size: 25px !important; | |
− | + | font-weight: 400 !important; | |
− | + | text-align: left !important; | |
margin-bottom: 0 !important; | margin-bottom: 0 !important; | ||
margin-top:.6em !important; | margin-top:.6em !important; | ||
Line 271: | Line 272: | ||
.PP{ | .PP{ | ||
− | + | font-family:Tahoma, Geneva, sans-serif !important; | |
− | + | font-size: 20px !important; | |
− | + | font-weight: 100 !important; | |
− | + | text-align: left !important; | |
} | } | ||
.Retract{ | .Retract{ | ||
− | + | padding-left: 50px; | |
} | } | ||
.GreenAH{ | .GreenAH{ | ||
− | + | color: #56A36C; | |
} | } | ||
.YellowAH{ | .YellowAH{ | ||
− | + | color: #FEC43E; | |
} | } | ||
Line 298: | Line 299: | ||
} | } | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
h2{ | h2{ | ||
− | + | font-family: 'Tempus Sans ITC'; | |
− | + | font-weight: 500; | |
− | + | font-size: 35px; | |
− | + | text-align: left; | |
} | } | ||
h3{ | h3{ | ||
− | + | font-family: 'Tempus Sans ITC'; | |
− | + | font-weight: 500; | |
− | + | font-size: 32px; | |
− | + | text-align: left; | |
} | } | ||
h4{ | h4{ | ||
− | + | font-family: 'Tempus Sans ITC'; | |
− | + | font-weight: 500; | |
− | + | font-size: 28px; | |
− | + | text-align: left; | |
} | } | ||
h5{ | h5{ | ||
− | + | font-family: 'Tempus Sans ITC'; | |
− | + | font-weight: 500; | |
− | + | font-size: 25px; | |
− | + | text-align: left; | |
} | } | ||
p{ | p{ | ||
− | + | margin:0; | |
− | + | font-size:17px; | |
− | + | line-height: 30px; | |
− | + | /*padding-bottom: 20px;*/ | |
− | + | color: #111111; | |
} | } | ||
Line 360: | Line 352: | ||
text-align: left !important; | text-align: left !important; | ||
} | } | ||
+ | /*文中自定义*/ | ||
− | . | + | /*老姜要好看一点的表格*/ |
− | { | + | .tableNice thead, .tableNice tr { |
− | + | text-align: center; | |
− | border: | + | border-top-width: 1px; |
+ | border-top-style: solid; | ||
+ | border-top-color: #b1c6d9; | ||
+ | } | ||
+ | .tableNice { | ||
+ | width: auto; | ||
+ | align: center; | ||
+ | border-bottom-width: 1px; | ||
+ | border-bottom-style: solid; | ||
+ | border-bottom-color: #D0E9FF; | ||
} | } | ||
− | + | /* Padding and font style */ | |
− | + | .tableNice td, .tableNice th { | |
− | + | padding: 5px 10px; | |
− | + | font-size: 12px; | |
− | + | ||
+ | color: #00343F; | ||
} | } | ||
− | . | + | /* Alternating background colors */ |
− | { | + | .tableNice tr:nth-child(even) { |
− | + | background: transparent; | |
+ | |||
+ | } | ||
+ | .tableNice tr:nth-child(odd) { | ||
+ | background: #EBFFFF; | ||
} | } | ||
− | /* | + | .tableOuter |
+ | { | ||
+ | align: center; | ||
+ | text-align: left; | ||
+ | } | ||
+ | /*老姜要好看一点的表格止*/ | ||
</style> | </style> | ||
Line 387: | Line 399: | ||
<!-- <h1><a class="navbar-brand" href="index.html">MuMei Lab</a></h1> --> | <!-- <h1><a class="navbar-brand" href="index.html">MuMei Lab</a></h1> --> | ||
− | + | ||
+ | <div class="container"> | ||
<!-- header --> | <!-- header --> | ||
<div class="header-w3layouts"> | <div class="header-w3layouts"> | ||
Line 493: | Line 506: | ||
</div> | </div> | ||
− | <p></p> | + | <p></p> |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<div style="width: 100%" class="container zjuContent"> | <div style="width: 100%" class="container zjuContent"> | ||
Line 505: | Line 513: | ||
<div class="bs-docs-section"> | <div class="bs-docs-section"> | ||
+ | <div style="height: 50px;"></div> | ||
− | + | <h1 id="improve" class="ArticleHead GreenAH">Part Collection</h1> | |
− | + | <p class="PP">It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the Wild-type T7 promoter to get a collection of modified T7 promoters.</p> | |
− | + | <p class="PP">T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the site from -20 to -12. The sequences of these modified promoters are shown in the Table below.</p> | |
− | + | <h2 id="sms" class="H2Head">Sequences of Modified Promoters</h2> | |
<table class="table"> | <table class="table"> | ||
<tr><th class="yellowTable">Part number</th><th class="yellowTable">Sequence(-20~+6)</th></tr> | <tr><th class="yellowTable">Part number</th><th class="yellowTable">Sequence(-20~+6)</th></tr> | ||
Line 522: | Line 531: | ||
</table> | </table> | ||
− | + | <h2 id="test" class="H2Head">Test</h2> | |
<p class="PP">To test the function of mutant promoters, we chose the <a class="cite" href="http://parts.igem.org/Part:BBa_E1010">mRFPas</a> our reporter. By assessing the relative fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure below.</p> | <p class="PP">To test the function of mutant promoters, we chose the <a class="cite" href="http://parts.igem.org/Part:BBa_E1010">mRFPas</a> our reporter. By assessing the relative fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure below.</p> | ||
<div class="imgdiv"><img class="textimg" src="https://static.igem.org/mediawiki/2017/2/23/ZJU_China_imporve_1.png"></div> | <div class="imgdiv"><img class="textimg" src="https://static.igem.org/mediawiki/2017/2/23/ZJU_China_imporve_1.png"></div> | ||
− | + | <p class="capture">Relative Strength of wildtype T7 promoter and mutant promoters</p> | |
<p class="PP">As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.</p> | <p class="PP">As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.</p> | ||
</div> | </div> | ||
− | + | ||
<!-- 右侧监听开始 --> | <!-- 右侧监听开始 --> | ||
<div class="col-md-3 disappear-on-top" role="complementary"> | <div class="col-md-3 disappear-on-top" role="complementary"> | ||
− | <nav style="position: fixed; top: 100px ; left:50px; " class="bs-docs-sidebar hidden-print hidden-xs hidden-sm"> | + | <nav style="position: fixed; top: 100px ; left:50px;" class="bs-docs-sidebar hidden-print hidden-xs hidden-sm"> |
<ul class="nav bs-docs-sidenav shorterli"> | <ul class="nav bs-docs-sidenav shorterli"> | ||
+ | |||
<li><a href="#improve">Improve Part</a></li> | <li><a href="#improve">Improve Part</a></li> | ||
<li><a href="#sms">Sequences of Modified Promoters</a></li> | <li><a href="#sms">Sequences of Modified Promoters</a></li> | ||
<li><a href="#test">Test</a></li> | <li><a href="#test">Test</a></li> | ||
− | |||
</ul> | </ul> | ||
<a class="back-to-top" href="#top"> | <a class="back-to-top" href="#top"> | ||
<!-- <i class="fa fa-arrow-up nav_icon"></i> --> | <!-- <i class="fa fa-arrow-up nav_icon"></i> --> | ||
− | + | <img style="width: 50px;" src="https://static.igem.org/mediawiki/2017/d/da/ZJU_China_UP.png"> | |
</a> | </a> | ||
Line 560: | Line 569: | ||
<p><br></p> | <p><br></p> | ||
<p class="copyright">Copyright © 2017 ZJU-IGEM | <a href="http://www.zju.edu.cn/">Zhejiang University</a> |</p> | <p class="copyright">Copyright © 2017 ZJU-IGEM | <a href="http://www.zju.edu.cn/">Zhejiang University</a> |</p> | ||
− | + | <p><br></p> | |
+ | <!--<p class="copyright">Contact us:<a class="copyright" href="">WeChat</a></p>--> | ||
</div> | </div> | ||
</div> | </div> | ||
Line 574: | Line 584: | ||
<script src="https://static.igem.org/mediawiki/2017/e/e0/ZJUChina_button.txt"></script> | <script src="https://static.igem.org/mediawiki/2017/e/e0/ZJUChina_button.txt"></script> | ||
− | + | ||
− | <script src="https://2017.igem.org/ | + | <script src="https://2017.igem.org/Team:ZJU-China/js/scrollingnavnonPic?action=raw&ctype=text/javascript"></script> |
<script src="https://static.igem.org/mediawiki/2017/c/c0/ZJUChina_txtSmoothScroll.min.txt"></script> | <script src="https://static.igem.org/mediawiki/2017/c/c0/ZJUChina_txtSmoothScroll.min.txt"></script> | ||
</body> | </body> | ||
</html> | </html> |
Revision as of 00:25, 30 October 2017
Part Collection
It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the Wild-type T7 promoter to get a collection of modified T7 promoters.
T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the site from -20 to -12. The sequences of these modified promoters are shown in the Table below.
Sequences of Modified Promoters
Part number | Sequence(-20~+6) |
---|---|
BBa_K525998(wild type) | gagtaatacgactcactatagggaaa |
BBa_K2207024 | tagtaatacgactcactatagggaaa |
BBa_K2207025 | aagtaatacgactcactatagggaaa |
BBa_K2207026 | gaataatacgactcactatagggaaa |
BBa_K2207027 | gattaatacgactcactatagggaaa |
BBa_K2207028 | gattaataagactcactatagggaaa |
BBa_K2207029 | gattaatatgactcactatagggaaa |
BBa_K2207030 | tattaatacgactcactatagggaaa |
Test
To test the function of mutant promoters, we chose the mRFPas our reporter. By assessing the relative fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure below.
Relative Strength of wildtype T7 promoter and mutant promoters
As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.