|
|
| (15 intermediate revisions by the same user not shown) |
| Line 1: |
Line 1: |
| − | <!DOCTYPE html>
| |
| − | <html lang="en">
| |
| | | | |
| − | <script type="text/javascript"> | + | <!-- |
| − | window.onload=function(){
| + | Design |
| − | document.getElementById('sideMenu').style.display='none';
| + | --> |
| − | document.getElementById('top_title').style.display='none';
| + | |
| − | }
| + | |
| − | </script>
| + | |
| | | | |
| − | <head>
| |
| − | <!-- css -->
| |
| − | <link href="https://2017.igem.org/Template:NEU-China/CSS/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet" />
| |
| − | <link href="https://2017.igem.org/Template:NEU-China/CSS/jquery_fancybox?action=raw&ctype=text/css" rel="stylesheet">
| |
| − | <link href="https://2017.igem.org/Template:NEU-China/CSS/flexslider?action=raw&ctype=text/css" rel="stylesheet" />
| |
| − | <link href="https://2017.igem.org/Template:NEU-China/CSS/style?action=raw&ctype=text/css" rel="stylesheet" />
| |
| − | <!-- Vendor Styles -->
| |
| − | <link href="https://2017.igem.org/Template:NEU-China/CSS/magnific-popup?action=raw&ctype=text/css" rel="stylesheet">
| |
| − | <!-- Block Styles -->
| |
| | | | |
| − | <link href="https://2017.igem.org/Template:NEU-China/CSS/gallery-1?action=raw&ctype=text/css" rel="stylesheet"> | + | <html lang="en"> |
| − |
| + | <script type="text/javascript"> |
| − | <!-- HTML5 shim, for IE6-8 support of HTML5 elements --> | + | window.onload=function(){ |
| − | <!--[if lt IE 9]> | + | document.getElementById('sideMenu').style.display='none'; |
| − | <script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script>
| + | document.getElementById('top_title').style.display='none'; |
| − | <![endif]-->
| + | |
| − | | + | document.getElementById('content').style.position='relative'; |
| − | </head> | + | document.getElementById('content').style.width='auto'; |
| − | <body> | + | document.getElementById('content').style.padding='0'; |
| − | <div id="wrapper"> | + | document.getElementById('content').style.margin='0'; |
| − | <!-- start header -->
| + | |
| − | <header>
| + | document.getElementById('globalWrapper').style.padding='0px'; |
| − | <div class="navbar navbar- default navbar-static-top"> | + | |
| − | | + | } |
| − | <div class="navbar-header"> | + | </script> |
| − | <button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse">
| + | |
| − | <span class="icon-bar"></span>
| + | <head> |
| − | <span class="icon-bar"></span>
| + | |
| − | <span class="icon-bar"></span>
| + | <link href="https://2017.igem.org/Template:NEU-China/css/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet"> |
| − | </button>
| + | <link href="https://2017.igem.org/Template:NEU-China/css/font-awesome_min?action=raw&ctype=text/css" rel="stylesheet"> |
| − | <a class="navbar-brand" href="https://2017.igem.org/Team:NEU-China">< img src="https:// static.igem.org/ mediawiki/2017/ c/ c0/ Logo_2. png" alt=" logo"/></a> | + | <link href="https://2017.igem.org/Template:NEU-China/css/animate_min?action=raw&ctype=text/css" rel="stylesheet"> |
| | + | <link href="https://2017.igem.org/Template:NEU-China/css/lightbox?action=raw&ctype=text/css" rel="stylesheet"> |
| | + | <link href="https://2017.igem.org/Template:NEU-China/css/main?action=raw&ctype=text/css" rel="stylesheet"> |
| | + | <link href="https://2017.igem.org/Template:NEU-China/css/responsive?action=raw&ctype=text/css" rel="stylesheet"> |
| | + | |
| | + | </head><!--/head--> |
| | + | |
| | + | <body> |
| | + | <header id="header"> |
| | + | <div class="navbar navbar- inverse" role="banner"> |
| | + | |
| | + | <div class="navbar-header"> |
| | + | <button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"> |
| | + | <span class="sr-only">Toggle navigation</span> |
| | + | <span class="icon-bar"></span> |
| | + | <span class="icon-bar"></span> |
| | + | <span class="icon-bar"></span> |
| | + | </button> |
| | + | |
| | + | <a class="navbar-brand" href="index.html"> |
| | + | <h1> |
| | + | <img src="https://static.igem.org/mediawiki/2017/4/4d/NEU-China-logo.png" alt="logo"> |
| | + | </h1> |
| | + | </a> |
| | + | |
| | + | </div> |
| | + | <div class="collapse navbar-collapse"> |
| | + | <ul class="nav navbar-nav navbar-right" style="margin-left: 0px;"> |
| | + | |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China">Home</a> |
| | + | </li> |
| | + | |
| | + | <li class="dropdown"> |
| | + | <a href="#">Project |
| | + | <i class="fa fa-angle-down"></i> |
| | + | </a> |
| | + | <ul role="menu" class="sub-menu"> |
| | + | |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Background">Background</a> |
| | + | </li> |
| | + | |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Description">Description</a> |
| | + | </li> |
| | + | |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Design">Design</a> |
| | + | </li> |
| | + | |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Experiments">Experiment & Results</a> |
| | + | </li> |
| | + | |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Demonstrate">Demostrate</a> |
| | + | </li> |
| | + | |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Model">Model</a> |
| | + | </li> |
| | + | |
| | + | </ul> |
| | + | </li> |
| | + | |
| | + | <li class="dropdown"> |
| | + | <a href="#">Notebook |
| | + | <i class="fa fa-angle-down"></i> |
| | + | </a> |
| | + | <ul role="menu" class="sub-menu"> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Progress">Progress</a> |
| | + | </li> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Protocol">Protocol</a> |
| | + | </li> |
| | + | </ul> |
| | + | </li> |
| | + | |
| | + | <li class="dropdown"> |
| | + | <a href="#">Parts |
| | + | <i class="fa fa-angle-down"></i> |
| | + | </a> |
| | + | <ul role="menu" class="sub-menu"> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Parts">Our Parts</a> |
| | + | </li> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/BiobricksForMedal">Biobricks For Medal</a> |
| | + | </li> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Basic_Part">Basic Parts</a> |
| | + | </li> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Safety">Safety</a> |
| | + | </li> |
| | + | </ul> |
| | + | </li> |
| | + | |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/InterLab">InterLab </a> |
| | + | </li> |
| | + | |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Collaborations">Collaborations </a> |
| | + | </li> |
| | + | |
| | + | <li class="dropdown"> |
| | + | <a href="#">Human Practices |
| | + | <i class="fa fa-angle-down"></i> |
| | + | </a> |
| | + | <ul role="menu" class="sub-menu"> |
| | + | |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Human_Practices">Human Practices</a> |
| | + | </li> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/HP/Silver">Silver</a> |
| | + | </li> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/HP/Gold_Integrated">Gold</a> |
| | + | </li> |
| | + | </ul> |
| | + | </li> |
| | + | <li class="dropdown"> |
| | + | <a href="#">Lab |
| | + | <i class="fa fa-angle-down"></i> |
| | + | </a> |
| | + | <ul role="menu" class="sub-menu"> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Team">Team</a> |
| | + | </li> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/Attributions">Attributions</a> |
| | + | </li> |
| | + | <li> |
| | + | <a href="https://2017.igem.org/Team:NEU-China/LabLife">Lab Life</a> |
| | + | </li> |
| | + | </ul> |
| | + | </li> |
| | + | </ul> |
| | + | </div> |
| | + | |
| | + | </div> |
| | + | </div> |
| | + | </header> |
| | + | <!--/#header--> |
| | + | |
| | + | |
| | + | <section id="page-breadcrumb"> |
| | + | <div class="vertical-center sun"> |
| | + | <div class="container"> |
| | + | <div class="row"> |
| | + | <div class="action"> |
| | + | <div class="col-sm-12"> |
| | + | <h1 class="title">Design</h1> |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | </div> | | </div> |
| − | <div class="navbar-collapse collapse ">
| + | </section> |
| − | <ul class="nav navbar-nav">
| + | <!--/#page-breadcrumb--> |
| − | <li class="active"><a href="https://2017.igem.org/Team:NEU-China">Home</a></li>
| + | |
| − | <li><a href="Background">Background</a></li>
| + | <section id="blog-details" class="padding-top" style="padding-top: 0px;"> |
| − | <li class="dropdown">
| + | <div class="container"> |
| − | <a href="#" data-toggle="dropdown" class="dropdown-toggle">Project <b class="caret"></b></a>
| + | |
| − | <ul class="dropdown-menu">
| + | <div class="col- md- 9 col-sm-7" style=" width: auto;"> |
| − | <li><a href="about.html">Description</a></li>
| + | |
| − | <li><a href="#">Design</a></li>
| + | <div class="col-md -12 col-sm-12"> |
| − | <li><a href="#">Experiment & Results</a></li>
| + | <div class=" single- blog blog- details two- column"> |
| − | <li><a href="#">Proof of Concept</a></li>
| + | <div class=" post- content overflow"> |
| − | </ul>
| + | |
| − | </li>
| + | <h2 class="post-title bold"><a href="#" style="color: #03b1f1;">Generally, the project design can be divided into three portions:</a></h2> |
| − | <li class="dropdown">
| + | <h3> |
| − | <a href="#" data-toggle="dropdown" class="dropdown-toggle">Lab <b class="caret"></b></a>
| + | Cloning ORs into pcDNA3.1+ respectively |
| − | <ul class="dropdown-menu">
| + | CRISPR/CAS9 system |
| − | <li><a href="services.html">Team</a></li>
| + | iSmeller system |
| − | <li><a href="#">Attributions</a></li>
| + | </h3> |
| − | <li><a href="#">Lab Life</a></li>
| + | |
| − | </ul>
| + | < h2 class=" post- title bold"><a href=" #" style=" color: #03b1f1;"> </a></ h2> |
| − | </li>
| + | < h2 class="post-title bold"><a href="#" style=" color: #03b1f1;"> Cloning ORs into pcDNA3.1+ respectively </ a></ h2> |
| − | <li><a href="https://2017.igem.org/Team:NEU-China/Safety">Safety</a></li>
| + | <h3> |
| − | <li class="dropdown">
| + | In order to express olfactory receptors in HEK293, we cloned OR1A1 and OR1D2 in pcDNA3.1+, which is a constitutive-expression vector. |
| − | <a href="#" data-toggle="dropdown" class="dropdown-toggle">Notebook <b class="caret"></b></a>
| + | |
| − | <ul class="dropdown-menu">
| + | </h3> |
| − | <li><a href="services.html">Progress</a></li>
| + | |
| − | <li><a href="#">Protocol</a></li>
| + | |
| − | </ul>
| + | |
| − | </li>
| + | |
| − | <li><a href="pricing.html">Human_Practices</a></li>
| + | |
| − | <li class="dropdown">
| + | |
| − | <a href="#" data-toggle="dropdown" class="dropdown-toggle">Parts <b class="caret"></b></a>
| + | |
| − | <ul class="dropdown-menu">
| + | |
| − | <li><a href="services.html">Our parts</a></li>
| + | |
| − | <li><a href="#">Biobricks for medal</a></li>
| + | |
| − | <li><a href="#">Basic Parts</a></li>
| + | |
| − | <li><a href="#">Part Collection</a></li>
| + | |
| − | </ul>
| + | |
| − | </li>
| + | |
| − | <li><a href="contact.html">Collaborations</a></li>
| + | |
| − | </ul>
| + | |
| − | </div> | + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </header><!-- end header -->
| + | |
| − | <section id="inner-headline">
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | <h2 class="pageTitle">Design</h2>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </section>
| + | |
| − | <section id="content">
| + | |
| − | <div class="container">
| + | |
| − |
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | <h3>How does iSmeller work?</h3>
| + | |
| − | <p>Once a specific odor binds to the olfactory receptor on the cell membrane, it leads to a series of signaling rally and consequently generates a flux of cAMP (cyclic AMP) which could be detected by a cAMP-activated reporter gene system. Complete olfactory receptor signaling exists primarily in the olfactory epithelia cells which are not easily cultured and amplified to generate the ex vivo biosensor, and the mixed expression of different endogenous olfactory receptors in these cells may generate high background or confounding noises to detect a specific odor from the engineering point of view. Eukaryotic HEK293 cells could overcome these pitfalls and allows us to introduce highly specific olfactory receptor signaling within those easily engineered cells. Moreover, such eukaryotic cell-based biosensor can better mimic the powerful mammalian nose by the combinatorial olfactory receptor design, compared to the prokaryote or cell-free based biosensor systems.</p>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − |
| + | |
| − | </div>
| + | |
| − | </section>
| + | |
| − |
| + | |
| − | </div>
| + | |
| − | <section id="bottom">
| + | |
| − | <!--LOGO群-->
| + | |
| − | <div class=" footer- logo text-center wow fadeInDown"> | + | |
| − | <img style="width: 105px;" src="img/HQ_page_logo.jpg"/>
| + | |
| − | <img style="width: 175px;" src="img/T--NEU-China--NEU.png"/>
| + | |
| − | <img style="width: 98px;" src="img/T--NEU-China--CLHS.png"/>
| + | |
| − | <img style="width: 112px;" src="img/T--NEU-China--BMIE.jpg"/>
| + | |
| − | <br/>
| + | |
| − | </div>
| + | |
| − | </section><!--/#bottom-->
| + | |
| − | <div id="sub-footer">
| + | |
| − | <div class="container">
| + | |
| − | <div class="row">
| + | |
| − | <div class="col-lg-6">
| + | |
| − | <div class="copyright">
| + | |
| − | <p>
| + | |
| − | Copyright © 2017 NEU-CHINA Team.
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | <div class="col-lg-6">
| + | |
| − | <ul class="social-network">
| + | |
| − | <li><a href=" https://2017.igem.org/Team:NEU-China" data-placement=" top"> Home</a></ li> | + | |
| − | </ul>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | <a href="#" class="scrollup"><i class="fa fa-angle-up active"></i></a> | + | |
| − | <!-- javascript | + | |
| − | ================================================== -->
| + | |
| − | <!-- Placed at the end of the document so the pages load faster -->
| + | |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/jquery?action=raw&ctype=text/javascript"></script> | + | |
| | | | |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/jquery_easing?action=raw&ctype=text/javascript"></script> | + | <table class="table table-striped text-center table-hover table-responsive" style="font-size: 14px"> |
| | + | <thead> |
| | + | <tr> |
| | + | <th style="text-align: center"> |
| | + | Name |
| | + | </th> |
| | + | <th style="text-align: center"> |
| | + | Specific odor molecule |
| | + | </th> |
| | + | <th style="text-align: center"> |
| | + | Forward primer |
| | + | </th> |
| | + | <th style="text-align: center"> |
| | + | Reverse primer |
| | + | </th> |
| | + | </tr> |
| | + | </thead> |
| | + | <tbody> |
| | + | |
| | + | <tr> |
| | + | <td>OR1A1</td> |
| | + | <td>β- citronellol</td> |
| | + | <td>cgtaagcttatgaccgagacatctcaggtggcccctgccggcggcagggaaaataac</td> |
| | + | <td>tatggatccttacgaggagattctcttgttg</td> |
| | + | |
| | + | </tr> |
| | + | <tr> |
| | + | <td>OR1D2</td> |
| | + | <td>bourgeonal</td> |
| | + | <td>cgtaagcttatgaccgagacatctcaggtggcccctgccggcggcgatggaggcaac</td> |
| | + | <td>tatctcgagttatgtcagcctcttaaagtgtttatctaggagtcttcc</td> |
| | + | </tr> |
| | + | </tbody> |
| | + | </table> |
| | + | <p>Table 1: cloning ORs into pcDNA3.1+ respectively</p> |
| | + | |
| | + | |
| | + | |
| | + | <h2 class="post-title bold"><a href="#" style="color: #03b1f1;">CRISPR/CAS9 gRNA Design: </a></h2> |
| | + | <h3> |
| | + | To achieve an intensified downstream signaling to enhance the detection sensitivity, we employed the CRISPR activation (CRISPRa) system to simultaneously increase the expression of the core components of olfactory receptor signaling via lentiviral transduction, including GNAL, RTP1 and RIC8B. At the endpoint, a cAMP-activated reporter gene (luciferase) is transfected to read out the signaling strength in response to specific and different range of odors. |
| | + | |
| | + | </h3> |
| | + | <table class="table table-striped text-center table-hover table-responsive" style="font-size: 14px"> |
| | + | <thead> |
| | + | <tr> |
| | + | <th style="text-align: center"> |
| | + | Gene |
| | + | </th> |
| | + | <th style="text-align: center"> |
| | + | Targeting sequence |
| | + | </th> |
| | + | |
| | + | <th style="text-align: center"> |
| | + | Function |
| | + | </th> |
| | + | </tr> |
| | + | </thead> |
| | + | <tbody> |
| | + | |
| | + | <tr> |
| | + | <td>GNAL-sg#1</td> |
| | + | <td>GAAACAATTCTCGTGTAAAA</td> |
| | + | |
| | + | <td rowspan="2" style="vertical-align: middle"> |
| | + | Encodes a stimulatory <br> |
| | + | G protein alpha subunit <br> |
| | + | which mediates odorant signaling <br> |
| | + | in the olfactory epithelium. |
| | + | |
| | + | </td> |
| | + | |
| | + | </tr> |
| | + | <tr> |
| | + | <td>GNAL-sg#2</td> |
| | + | <td>CGTCTCCGTTCATTGTGCTG</td> |
| | + | |
| | + | |
| | + | </tr> |
| | | | |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/bootstrap_min?action=raw&ctype=text/javascript"></script> | + | <tr> |
| − | | + | <td>RIC8B-sg#1</td> |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/jquery_fancybox_pack?action=raw&ctype=text/javascript"></script> | + | <td>CAACCCGCCAGCCTCCGCCC</td> |
| − | | + | <td rowspan="2" style="vertical-align: middle"> |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/jquery_fancybox-media?action=raw&ctype=text/javascript"></script> | + | Help the olfactory receptor<br> |
| − | | + | to anchor on the cell membrane |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/jquery_flexslider?action=raw&ctype=text/javascript"></script> | + | |
| − | | + | </td> |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/animate?action=raw&ctype=text/javascript"></script> | + | </tr> |
| − | | + | <tr> |
| − | <!-- Vendor Scripts --> | + | <td>RIC8B-sg#2</td> |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/modernizr_custom?action=raw&ctype=text/javascript"></script> | + | <td>GGGGGCGCGAGGCGTTTACC</td> |
| − | | + | |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/jquery_isotope_min?action=raw&ctype=text/javascript"></script> | + | </tr> |
| − | | + | <tr> |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/jquery_magnific-popup_min?action=raw&ctype=text/javascript"></script> | + | <td> RTP1-sg#1</td> |
| − | | + | <td> CTGCAATCTCAGTTCAGGGC</td> |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/animate?action=raw&ctype=text/javascript"></script> | + | <td rowspan="2" style="vertical-align: middle"> |
| − | | + | Help the olfactory receptor<br> |
| − | <script src="https://2017.igem.org/Template:NEU-China/Javascript/custom?action=raw&ctype=text/javascript"></script> | + | to anchor on the cell membrane |
| − |
| + | |
| − | </body> | + | </td> |
| − | </html> | + | </tr> |
| | + | <tr> |
| | + | <td>RTP1-sg#2</td> |
| | + | <td>GGCAACCTGCCTGGTTGCCG</td> |
| | + | |
| | + | </tr> |
| | + | </tbody> |
| | + | </table> |
| | + | <p>Table 2: CRISPR/CAS9 gRNA Design</p> |
| | + | |
| | + | |
| | + | <img src="https://static.igem.org/mediawiki/2017/4/49/NEU-China-DesignPic1.png" alt="" style="margin-left: 150px;"/> |
| | + | <h2 class="post-title bold"><a href="#" style="color: #03b1f1;">iSmeller system: </a></h2> |
| | + | <h3> |
| | + | As a proof-of-principle, we choose two odor compound/receptor pairs (β-citronellol/OR1A1 and bourgeonal/OR1D2) to construct the iSmeller odor sensors and evaluate their sensitivity and specificity. |
| | + | We also designed multiple sgRNAs targeting three signal pathway core genes GNAL, RTP1 and RIC8B. When a specific odor molecule binds to the corresponding olfactory receptor, it will open the downstream cAMP pathway, resulting in a certain amount of cAMP at the end point, which can be used for the final signal detection. |
| | + | |
| | + | </h3> |
| | + | <img src="https://static.igem.org/mediawiki/2017/b/b2/NEU-China-DesignPic2.png" alt="" style="margin-left: 150px;"/> |
| | + | |
| | + | |
| | + | |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | + | |
| | + | </div> |
| | + | </div> |
| | + | </section> |
| | + | <!--/#blog--> |
| | + | |
| | + | |
| | + | <footer id="footer"> |
| | + | <div class="container"> |
| | + | <div class="row"> |
| | + | <div class="col-sm-12 text-center bottom-separator"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/9/99/NEU-China-under.png" class="img-responsive inline" alt=""> |
| | + | </div> |
| | + | <div class="col-sm-12 bottom-separator" style="margin-bottom: 0px;margin-left: 70px;"> |
| | + | <div class="clients-logo wow fadeIn" data-wow-duration="1000ms" data-wow-delay="600ms"> |
| | + | <div class="col-xs-3 col-sm-2"> |
| | + | <a href="#"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/7/7e/NEU-China-igem.png" class="img-responsive" alt=""> |
| | + | </a> |
| | + | </div> |
| | + | <div class="col-xs-3 col-sm-2"> |
| | + | <a href="#"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/f/fc/NEU-China-NEU.png" class="img-responsive" alt=""> |
| | + | </a> |
| | + | </div> |
| | + | <div class="col-xs-3 col-sm-2"> |
| | + | <a href="#"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/1/17/NEU-China-CLHS.png" class="img-responsive" alt=""> |
| | + | </a> |
| | + | </div> |
| | + | <div class="col-xs-3 col-sm-2"> |
| | + | <a href="#"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/4/45/NEU-China-SC.jpeg" class="img-responsive" alt=""> |
| | + | </a> |
| | + | </div> |
| | + | <div class="col-xs-3 col-sm-2"> |
| | + | <a href="#"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/e/e5/NEU-China-BMIE.jpeg" class="img-responsive" alt=""> |
| | + | </a> |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | + | <div class="col-sm-12 bottom-separator" style="margin-bottom: 0px;margin-left: 70px;"> |
| | + | <div class="clients-logo wow fadeIn" data-wow-duration="1000ms" data-wow-delay="600ms"> |
| | + | <div class="col-xs-3 col-sm-2"> |
| | + | <a href="#"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/5/5e/NEU-China-addgene.png" class="img-responsive" |
| | + | alt=""> |
| | + | </a> |
| | + | </div> |
| | + | <div class="col-xs-3 col-sm-2"> |
| | + | <a href="#"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/d/d9/NEU-China-snapgene.png" class="img-responsive" |
| | + | alt=""> |
| | + | </a> |
| | + | </div> |
| | + | <div class="col-xs-3 col-sm-2"> |
| | + | <a href="#"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/d/db/NEU-China-sam.png" class="img-responsive" alt=""> |
| | + | </a> |
| | + | </div> |
| | + | <div class="col-xs-3 col-sm-2"> |
| | + | <a href="#"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/5/5c/NEU-China-igv.png" class="img-responsive" alt=""> |
| | + | </a> |
| | + | </div> |
| | + | <div class="col-xs-3 col-sm-2"> |
| | + | <a href="#"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/e/e5/NEU-China-NCBI.png" class="img-responsive" alt=""> |
| | + | </a> |
| | + | </div> |
| | + | |
| | + | </div> |
| | + | </div> |
| | + | |
| | + | <div class="col-sm-12"> |
| | + | <div class="copyright-text text-center"> |
| | + | <p>Copyright © 2017 NEU-CHINA Team. All Rights Reserved.</p> |
| | + | |
| | + | |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | + | </footer> |
| | + | <!--/#footer--> |
| | + | |
| | + | <script type="text/javascript" src="https://2017.igem.org/Template:NEU-China/js/jquery?action=raw&ctype=text/javascript"></script> |
| | + | <script type="text/javascript" src="https://2017.igem.org/Template:NEU-China/js/bootstrap_min?action=raw&ctype=text/javascript"></script> |
| | + | <script type="text/javascript" src="https://2017.igem.org/Template:NEU-China/js/lightbox_min?action=raw&ctype=text/javascript"></script> |
| | + | <script type="text/javascript" src="https://2017.igem.org/Template:NEU-China/js/wow_min?action=raw&ctype=text/javascript"></script> |
| | + | <script type="text/javascript" src="https://2017.igem.org/Template:NEU-China/js/main?action=raw&ctype=text/javascript"></script> |
| | + | |
| | + | </body> |
| | + | |
| | + | </html> |
