|
|
(16 intermediate revisions by the same user not shown) |
Line 1: |
Line 1: |
− | {{NEU-China}}
| |
− | <html>
| |
| | | |
| + | <!-- |
| + | Design |
| + | --> |
| | | |
| | | |
| + | <html lang="en"> |
| + | <script type="text/javascript"> |
| + | window.onload=function(){ |
| + | document.getElementById('sideMenu').style.display='none'; |
| + | document.getElementById('top_title').style.display='none'; |
| + | |
| + | document.getElementById('content').style.position='relative'; |
| + | document.getElementById('content').style.width='auto'; |
| + | document.getElementById('content').style.padding='0'; |
| + | document.getElementById('content').style.margin='0'; |
| + | |
| + | document.getElementById('globalWrapper').style.padding='0px'; |
| + | |
| + | } |
| + | </script> |
| + | |
| + | <head> |
| + | |
| + | <link href="https://2017.igem.org/Template:NEU-China/css/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet"> |
| + | <link href="https://2017.igem.org/Template:NEU-China/css/font-awesome_min?action=raw&ctype=text/css" rel="stylesheet"> |
| + | <link href="https://2017.igem.org/Template:NEU-China/css/animate_min?action=raw&ctype=text/css" rel="stylesheet"> |
| + | <link href="https://2017.igem.org/Template:NEU-China/css/lightbox?action=raw&ctype=text/css" rel="stylesheet"> |
| + | <link href="https://2017.igem.org/Template:NEU-China/css/main?action=raw&ctype=text/css" rel="stylesheet"> |
| + | <link href="https://2017.igem.org/Template:NEU-China/css/responsive?action=raw&ctype=text/css" rel="stylesheet"> |
| + | |
| + | </head><!--/head--> |
| + | |
| + | <body> |
| + | <header id="header"> |
| + | <div class="navbar navbar-inverse" role="banner"> |
| + | <div class="container"> |
| + | <div class="navbar-header"> |
| + | <button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"> |
| + | <span class="sr-only">Toggle navigation</span> |
| + | <span class="icon-bar"></span> |
| + | <span class="icon-bar"></span> |
| + | <span class="icon-bar"></span> |
| + | </button> |
| + | |
| + | <a class="navbar-brand" href="index.html"> |
| + | <h1> |
| + | <img src="https://static.igem.org/mediawiki/2017/4/4d/NEU-China-logo.png" alt="logo"> |
| + | </h1> |
| + | </a> |
| + | |
| + | </div> |
| + | <div class="collapse navbar-collapse"> |
| + | <ul class="nav navbar-nav navbar-right" style="margin-left: 0px;"> |
| + | |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China">Home</a> |
| + | </li> |
| + | |
| + | <li class="dropdown"> |
| + | <a href="#">Project |
| + | <i class="fa fa-angle-down"></i> |
| + | </a> |
| + | <ul role="menu" class="sub-menu"> |
| + | |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Background">Background</a> |
| + | </li> |
| + | |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Description">Description</a> |
| + | </li> |
| + | |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Design">Design</a> |
| + | </li> |
| + | |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Experiments">Experiment & Results</a> |
| + | </li> |
| + | |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Demonstrate">Demostrate</a> |
| + | </li> |
| + | |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Model">Model</a> |
| + | </li> |
| + | |
| + | </ul> |
| + | </li> |
| + | |
| + | <li class="dropdown"> |
| + | <a href="#">Notebook |
| + | <i class="fa fa-angle-down"></i> |
| + | </a> |
| + | <ul role="menu" class="sub-menu"> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Progress">Progress</a> |
| + | </li> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Protocol">Protocol</a> |
| + | </li> |
| + | </ul> |
| + | </li> |
| + | |
| + | <li class="dropdown"> |
| + | <a href="#">Parts |
| + | <i class="fa fa-angle-down"></i> |
| + | </a> |
| + | <ul role="menu" class="sub-menu"> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Parts">Our Parts</a> |
| + | </li> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/BiobricksForMedal">Biobricks For Medal</a> |
| + | </li> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Basic_Part">Basic Parts</a> |
| + | </li> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Safety">Safety</a> |
| + | </li> |
| + | </ul> |
| + | </li> |
| + | |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/InterLab">InterLab </a> |
| + | </li> |
| + | |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Collaborations">Collaborations </a> |
| + | </li> |
| + | |
| + | <li class="dropdown"> |
| + | <a href="#">Human Practices |
| + | <i class="fa fa-angle-down"></i> |
| + | </a> |
| + | <ul role="menu" class="sub-menu"> |
| + | |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Human_Practices">Human Practices</a> |
| + | </li> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/HP/Silver">Silver</a> |
| + | </li> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/HP/Gold_Integrated">Gold</a> |
| + | </li> |
| + | </ul> |
| + | </li> |
| + | <li class="dropdown"> |
| + | <a href="#">Lab |
| + | <i class="fa fa-angle-down"></i> |
| + | </a> |
| + | <ul role="menu" class="sub-menu"> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Team">Team</a> |
| + | </li> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/Attributions">Attributions</a> |
| + | </li> |
| + | <li> |
| + | <a href="https://2017.igem.org/Team:NEU-China/LabLife">Lab Life</a> |
| + | </li> |
| + | </ul> |
| + | </li> |
| + | </ul> |
| + | </div> |
| + | |
| + | </div> |
| + | </div> |
| + | </header> |
| + | <!--/#header--> |
| + | |
| + | |
| + | <section id="page-breadcrumb"> |
| + | <div class="vertical-center sun"> |
| + | <div class="container"> |
| + | <div class="row"> |
| + | <div class="action"> |
| + | <div class="col-sm-12"> |
| + | <h1 class="title">Design</h1> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | </section> |
| + | <!--/#page-breadcrumb--> |
| + | |
| + | <section id="blog-details" class="padding-top" style="padding-top: 0px;"> |
| + | <div class="container"> |
| + | <div class="row"> |
| + | <div class="col-md-9 col-sm-7" style="width: auto;"> |
| + | <div class="row"> |
| + | <div class="col-md-12 col-sm-12"> |
| + | <div class="single-blog blog-details two-column"> |
| + | <div class="post-content overflow"> |
| + | |
| + | <h2 class="post-title bold"><a href="#" style="color: #03b1f1;">Generally, the project design can be divided into three portions:</a></h2> |
| + | <h3> |
| + | Cloning ORs into pcDNA3.1+ respectively |
| + | CRISPR/CAS9 system |
| + | iSmeller system |
| + | </h3> |
| + | |
| + | <h2 class="post-title bold"><a href="#" style="color: #03b1f1;"> </a></h2> |
| + | <h2 class="post-title bold"><a href="#" style="color: #03b1f1;">Cloning ORs into pcDNA3.1+ respectively </a></h2> |
| + | <h3> |
| + | In order to express olfactory receptors in HEK293, we cloned OR1A1 and OR1D2 in pcDNA3.1+, which is a constitutive-expression vector. |
| + | |
| + | </h3> |
| | | |
− | <div class="column full_size"> | + | <table class="table table-striped text-center table-hover table-responsive" style="font-size: 14px"> |
− | <h1>Design</h1> | + | <thead> |
− | <p> | + | <tr> |
− | Design is the first step in the design-build-test cycle in engineering and synthetic biology. Use this page to describe the process that you used in the design of your parts. You should clearly explain the engineering principles used to design your project. | + | <th style="text-align: center"> |
− | </p> | + | Name |
| + | </th> |
| + | <th style="text-align: center"> |
| + | Specific odor molecule |
| + | </th> |
| + | <th style="text-align: center"> |
| + | Forward primer |
| + | </th> |
| + | <th style="text-align: center"> |
| + | Reverse primer |
| + | </th> |
| + | </tr> |
| + | </thead> |
| + | <tbody> |
| + | |
| + | <tr> |
| + | <td>OR1A1</td> |
| + | <td>β- citronellol</td> |
| + | <td>cgtaagcttatgaccgagacatctcaggtggcccctgccggcggcagggaaaataac</td> |
| + | <td>tatggatccttacgaggagattctcttgttg</td> |
| + | |
| + | </tr> |
| + | <tr> |
| + | <td>OR1D2</td> |
| + | <td>bourgeonal</td> |
| + | <td>cgtaagcttatgaccgagacatctcaggtggcccctgccggcggcgatggaggcaac</td> |
| + | <td>tatctcgagttatgtcagcctcttaaagtgtttatctaggagtcttcc</td> |
| + | </tr> |
| + | </tbody> |
| + | </table> |
| + | <p>Table 1: cloning ORs into pcDNA3.1+ respectively</p> |
| + | |
| + | |
| + | |
| + | <h2 class="post-title bold"><a href="#" style="color: #03b1f1;">CRISPR/CAS9 gRNA Design: </a></h2> |
| + | <h3> |
| + | To achieve an intensified downstream signaling to enhance the detection sensitivity, we employed the CRISPR activation (CRISPRa) system to simultaneously increase the expression of the core components of olfactory receptor signaling via lentiviral transduction, including GNAL, RTP1 and RIC8B. At the endpoint, a cAMP-activated reporter gene (luciferase) is transfected to read out the signaling strength in response to specific and different range of odors. |
| + | |
| + | </h3> |
| + | <table class="table table-striped text-center table-hover table-responsive" style="font-size: 14px"> |
| + | <thead> |
| + | <tr> |
| + | <th style="text-align: center"> |
| + | Gene |
| + | </th> |
| + | <th style="text-align: center"> |
| + | Targeting sequence |
| + | </th> |
| + | |
| + | <th style="text-align: center"> |
| + | Function |
| + | </th> |
| + | </tr> |
| + | </thead> |
| + | <tbody> |
| + | |
| + | <tr> |
| + | <td>GNAL-sg#1</td> |
| + | <td>GAAACAATTCTCGTGTAAAA</td> |
| + | |
| + | <td rowspan="2" style="vertical-align: middle"> |
| + | Encodes a stimulatory <br> |
| + | G protein alpha subunit <br> |
| + | which mediates odorant signaling <br> |
| + | in the olfactory epithelium. |
| + | |
| + | </td> |
| + | |
| + | </tr> |
| + | <tr> |
| + | <td>GNAL-sg#2</td> |
| + | <td>CGTCTCCGTTCATTGTGCTG</td> |
| + | |
| + | |
| + | </tr> |
| | | |
− | <p> | + | <tr> |
− | This page is different to the "Applied Design Award" page. Please see the <a href="https://2017.igem.org/Team:NEU-China/Applied_Design">Applied Design</a> page for more information on how to compete for that award.
| + | <td>RIC8B-sg#1</td> |
− | </p> | + | <td>CAACCCGCCAGCCTCCGCCC</td> |
− | | + | <td rowspan="2" style="vertical-align: middle"> |
− | </div> | + | Help the olfactory receptor<br> |
− | | + | to anchor on the cell membrane |
− | <div class="column half_size"> | + | |
− | <h5>What should this page contain?</h5> | + | </td> |
− | <ul> | + | </tr> |
− | <li>Explanation of the engineering principles your team used in your design</li> | + | <tr> |
− | <li>Discussion of the design iterations your team went through</li> | + | <td>RIC8B-sg#2</td> |
− | <li>Experimental plan to test your designs</li> | + | <td>GGGGGCGCGAGGCGTTTACC</td> |
− | </ul> | + | |
− | | + | </tr> |
− | </div> | + | <tr> |
− | | + | <td> RTP1-sg#1</td> |
− | <div class="column half_size"> | + | <td> CTGCAATCTCAGTTCAGGGC</td> |
− | <h5>Inspiration</h5> | + | <td rowspan="2" style="vertical-align: middle"> |
− | <ul> | + | Help the olfactory receptor<br> |
− | <li><a href="https://2016.igem.org/Team:MIT/Experiments/Promoters">2016 MIT</a></li> | + | to anchor on the cell membrane |
− | <li><a href="https://2016.igem.org/Team:BostonU/Proof">2016 BostonU</a></li> | + | |
− | <li><a href="https://2016.igem.org/Team:NCTU_Formosa/Design">2016 NCTU Formosa</a></li> | + | </td> |
− | </ul> | + | </tr> |
− | </div> | + | <tr> |
− | | + | <td>RTP1-sg#2</td> |
− | | + | <td>GGCAACCTGCCTGGTTGCCG</td> |
− | | + | |
− | </html> | + | </tr> |
| + | </tbody> |
| + | </table> |
| + | <p>Table 2: CRISPR/CAS9 gRNA Design</p> |
| + | |
| + | |
| + | <img src="https://static.igem.org/mediawiki/2017/4/49/NEU-China-DesignPic1.png" alt="" style="margin-left: 150px;"/> |
| + | <h2 class="post-title bold"><a href="#" style="color: #03b1f1;">iSmeller system: </a></h2> |
| + | <h3> |
| + | As a proof-of-principle, we choose two odor compound/receptor pairs (β-citronellol/OR1A1 and bourgeonal/OR1D2) to construct the iSmeller odor sensors and evaluate their sensitivity and specificity. |
| + | We also designed multiple sgRNAs targeting three signal pathway core genes GNAL, RTP1 and RIC8B. When a specific odor molecule binds to the corresponding olfactory receptor, it will open the downstream cAMP pathway, resulting in a certain amount of cAMP at the end point, which can be used for the final signal detection. |
| + | |
| + | </h3> |
| + | <img src="https://static.igem.org/mediawiki/2017/b/b2/NEU-China-DesignPic2.png" alt="" style="margin-left: 150px;"/> |
| + | |
| + | |
| + | |
| + | </div> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | |
| + | </div> |
| + | </div> |
| + | </section> |
| + | <!--/#blog--> |
| + | |
| + | |
| + | <footer id="footer"> |
| + | <div class="container"> |
| + | <div class="row"> |
| + | <div class="col-sm-12 text-center bottom-separator"> |
| + | <img src="https://static.igem.org/mediawiki/2017/9/99/NEU-China-under.png" class="img-responsive inline" alt=""> |
| + | </div> |
| + | <div class="col-sm-12 bottom-separator" style="margin-bottom: 0px;margin-left: 70px;"> |
| + | <div class="clients-logo wow fadeIn" data-wow-duration="1000ms" data-wow-delay="600ms"> |
| + | <div class="col-xs-3 col-sm-2"> |
| + | <a href="#"> |
| + | <img src="https://static.igem.org/mediawiki/2017/7/7e/NEU-China-igem.png" class="img-responsive" alt=""> |
| + | </a> |
| + | </div> |
| + | <div class="col-xs-3 col-sm-2"> |
| + | <a href="#"> |
| + | <img src="https://static.igem.org/mediawiki/2017/f/fc/NEU-China-NEU.png" class="img-responsive" alt=""> |
| + | </a> |
| + | </div> |
| + | <div class="col-xs-3 col-sm-2"> |
| + | <a href="#"> |
| + | <img src="https://static.igem.org/mediawiki/2017/1/17/NEU-China-CLHS.png" class="img-responsive" alt=""> |
| + | </a> |
| + | </div> |
| + | <div class="col-xs-3 col-sm-2"> |
| + | <a href="#"> |
| + | <img src="https://static.igem.org/mediawiki/2017/4/45/NEU-China-SC.jpeg" class="img-responsive" alt=""> |
| + | </a> |
| + | </div> |
| + | <div class="col-xs-3 col-sm-2"> |
| + | <a href="#"> |
| + | <img src="https://static.igem.org/mediawiki/2017/e/e5/NEU-China-BMIE.jpeg" class="img-responsive" alt=""> |
| + | </a> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | <div class="col-sm-12 bottom-separator" style="margin-bottom: 0px;margin-left: 70px;"> |
| + | <div class="clients-logo wow fadeIn" data-wow-duration="1000ms" data-wow-delay="600ms"> |
| + | <div class="col-xs-3 col-sm-2"> |
| + | <a href="#"> |
| + | <img src="https://static.igem.org/mediawiki/2017/5/5e/NEU-China-addgene.png" class="img-responsive" |
| + | alt=""> |
| + | </a> |
| + | </div> |
| + | <div class="col-xs-3 col-sm-2"> |
| + | <a href="#"> |
| + | <img src="https://static.igem.org/mediawiki/2017/d/d9/NEU-China-snapgene.png" class="img-responsive" |
| + | alt=""> |
| + | </a> |
| + | </div> |
| + | <div class="col-xs-3 col-sm-2"> |
| + | <a href="#"> |
| + | <img src="https://static.igem.org/mediawiki/2017/d/db/NEU-China-sam.png" class="img-responsive" alt=""> |
| + | </a> |
| + | </div> |
| + | <div class="col-xs-3 col-sm-2"> |
| + | <a href="#"> |
| + | <img src="https://static.igem.org/mediawiki/2017/5/5c/NEU-China-igv.png" class="img-responsive" alt=""> |
| + | </a> |
| + | </div> |
| + | <div class="col-xs-3 col-sm-2"> |
| + | <a href="#"> |
| + | <img src="https://static.igem.org/mediawiki/2017/e/e5/NEU-China-NCBI.png" class="img-responsive" alt=""> |
| + | </a> |
| + | </div> |
| + | |
| + | </div> |
| + | </div> |
| + | |
| + | <div class="col-sm-12"> |
| + | <div class="copyright-text text-center"> |
| + | <p>Copyright © 2017 NEU-CHINA Team. All Rights Reserved.</p> |
| + | |
| + | |
| + | </div> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | </footer> |
| + | <!--/#footer--> |
| + | |
| + | <script type="text/javascript" src="https://2017.igem.org/Template:NEU-China/js/jquery?action=raw&ctype=text/javascript"></script> |
| + | <script type="text/javascript" src="https://2017.igem.org/Template:NEU-China/js/bootstrap_min?action=raw&ctype=text/javascript"></script> |
| + | <script type="text/javascript" src="https://2017.igem.org/Template:NEU-China/js/lightbox_min?action=raw&ctype=text/javascript"></script> |
| + | <script type="text/javascript" src="https://2017.igem.org/Template:NEU-China/js/wow_min?action=raw&ctype=text/javascript"></script> |
| + | <script type="text/javascript" src="https://2017.igem.org/Template:NEU-China/js/main?action=raw&ctype=text/javascript"></script> |
| + | |
| + | </body> |
| + | |
| + | </html> |