Difference between revisions of "Team:Kyoto/Experiments"
| Line 108: | Line 108: | ||
<div class="example"> | <div class="example"> | ||
<table width="20px"> | <table width="20px"> | ||
| − | + | <tr><th>primer name</th><th class="example" width=30%>sequence</th><th width=8%>Length</th><th width=5%>Tm</th><th width=8%>GC%</th><th width=10%>Designer</th><th>Manufacturer</th></tr><tr><td>tropomyosinF</td><td>GATCGAGAAGGACAACGCCC</td><td>20</td><td>65</td><td>60</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>tropomyosinT7R</td><td>TAATACGACTCACTATAGGGCTTGTTTTCTCCGGC<br>TTCGG</td><td>40</td><td>79</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>tropomyosinT7F</td><td>TAATACGACTCACTATAGGGGATCGAGAAGGACAA<br>CGCCC</td><td>40</td><td>79</td><td>50</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>tropomyosinR</td><td>CTTGTTTTCTCCGGCTTCGG</td><td>20</td><td>66</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>top-1F</td><td>GACTTTTCGTGCGTCTTCGG</td><td>20</td><td>64</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>top-1T7R</td><td>TAATACGACTCACTATAGGGCCCGGTTGAAAAGCA<br>AGTGT</td><td>40</td><td>78</td><td>45</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>top-1T7F</td><td>TAATACGACTCACTATAGGGGACTTTTCGTGCGTC<br>TTCGG</td><td>40</td><td>78</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>top-1R</td><td>CCCGGTTGAAAAGCAAGTGT</td><td>20</td><td>64</td><td>50</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>eef-1gF</td><td>GCAAAGGTTGCCGGTAAGAC</td><td>20</td><td>64</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>eef-1gT7R</td><td>TAATACGACTCACTATAGGGGACGGCAGAGGCCAA<br>CTTTA</td><td>40</td><td>78</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>eef-1gT7F</td><td>TAA<br>TACGACTCACTATAGGGGCAAAGGTTGCCGGT<br>AAGAC</td><td>40</td><td>77</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>eef-1gR</td><td>GACGGCAGAGGCCAACTTTA</td><td>20</td><td>64</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>asbF</td><td>GGACTTTGGTCGTTGTCCCA</td><td>20</td><td>63</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>asbT7R</td><td>TAATACGACTCACTATAGGGTCCACAGCGTCCTTC<br>AAGTC</td><td>40</td><td>75</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>asbT7F</td><td>TAATACGACTCACTATAGGGGGACTTTGGTCGTTG<br>TCCCA</td><td>40</td><td>78</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>asbR</td><td>TCCACAGCGTCCTTCAAGTC</td><td>20</td><td>61</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proteinF-2</td><td>TGGAGGGTGATCTCGTCCAT</td><td>20</td><td>62</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proteinT7R-2</td><td>TAATACGACTCACTATAGGG CAAGGGGGATGGTT<br>GGTCTC</td><td>41</td><td>78</td><td>49</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proteinT7F-2</td><td>TAATACGACTCACTATAGGG TGGAGGGTGATCTC<br>GTCCAT</td><td>41</td><td>76</td><td>46</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proteinR-2</td><td>CAAGGGGGATGGTTGGTCTC</td><td>20</td><td>65</td><td>60</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>actinF</td><td>AATGGCTCCGGTATGTGCAA</td><td>20</td><td>65</td><td>50</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>actinR</td><td>TGGTGGTGAAAGAGTAGCCG</td><td>20</td><td>62</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3zetaF</td><td>CCTACAAGAACGTGGTCGGT</td><td>20</td><td>61</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3zetaT7R</td><td>TAATACGACTCACTATAGGGTGTGAGTGCTCGCAA<br>ACTGT</td><td>40</td><td>75</td><td>45</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3zetaT7F</td><td>TAATACGACTCACTATAGGGCCTACAAGAACGTGG<br>TCGGT</td><td>40</td><td>76</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3zetaR</td><td>TGTGAGTGCTCGCAAACTGT</td><td>20</td><td>60</td><td>50</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proF</td><td>TCTCGGTCGCCTACAAGAAC</td><td>20</td><td>61</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proT7R</td><td>TAATACGACTCACTATAGGGCCAGTCTCTCCCGTC<br>TCGTT</td><td>40</td><td>77</td><td>50</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proT7F</td><td>TAATACGACTCACTATAGGGTCTCGGTCGCCTACA<br>AGAAC</td><td>40</td><td>75</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proR</td><td>CCAGTCTCTCCCGTCTCGTT</td><td>20</td><td>62</td><td>60</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>AK1F</td><td>TCGGAGACGGTTGTGTGAAGATG</td><td>23</td><td>66</td><td>52</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>AK1T7R</td><td> TAATACGACTCACTATAGGGCAAGCACGGGTTGA<br>ATGGGT</td><td>41</td><td>79</td><td>46</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>AK1T7F</td><td>TAATACGACTCACTATAGGGTCGGAGACGGTTGTG<br>TGAAGATG</td><td>43</td><td>77</td><td>47</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>AK1R</td><td>CAAGCACGGGTTGAATGGGT</td><td>20</td><td>66</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>longAK2F</td><td>TCCGAATCATGGCGAGAACC</td><td>20</td><td>66</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>longAK2T7R</td><td>TAATACGACTCACTATAGGGCATGCCGGTCAACGG<br>ATAGT</td><td>40</td><td>78</td><td>48</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>longAK2T7F</td><td>TAATACGACTCACTATAGGGTCCGAATCATGGCGA<br>GAACC</td><td>40</td><td>78</td><td>48</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>longAK2R</td><td>CATGCCGGTCAACGGATAGT</td><td>20</td><td>64</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>shortAK2F</td><td>CCGTTTTGGATTTGTCGCGT</td><td>20</td><td>67</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>shortAK2T7R</td><td>TAATACGACTCACTATAGGGTCGATCTTCTTGACC<br>GTCGC</td><td>40</td><td>77</td><td>48</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>shortAK2T7F</td><td>TAATACGACTCACTATAGGGCCGTTTTGGATTTGT<br>CGCGT</td><td>40</td><td>79</td><td>45</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>shortAK2R</td><td>TCGATCTTCTTGACCGTCGC</td><td>20</td><td>64</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-1F</td><td>cccCGAATTCccccattatctt</td><td>22</td><td>68</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-1R</td><td>CTCCCACACCAGCATCCAA</td><td>19</td><td>63</td><td>58</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-2F</td><td>AAGCTGGGCGCCACTTT</td><td>17</td><td>64</td><td>59</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-2R</td><td>CAAGTCGTTGCTGAAGAAACATTTCAC</td><td>27</td><td>66</td><td>41</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-3F</td><td>ACTCGGCGTCCGGAG</td><td>15</td><td>61</td><td>73</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-3R</td><td>tacccTGCAGgggagc</td><td>16</td><td>59</td><td>69</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-1F</td><td>tctagaggatccccCGAATTC</td><td>21</td><td>63</td><td>52</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-1R</td><td>CCGTTGACCGGCATGct</td><td>17</td><td>65</td><td>65</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-2F</td><td>AATCCGCTGTGGCCGC</td><td>16</td><td>66</td><td>69</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-2R</td><td>AACCACCTTCTTCGCACAGAAC</td><td>22</td><td>63</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-3F</td><td>GACGTCCTTGGTGAAATGTTTC</td><td>22</td><td>61</td><td>45</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-3R</td><td>gggaaaaccctggcgttac</td><td>19</td><td>64</td><td>58</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK21</td><td>CCTCCACAAAGGCCTCTCCT</td><td>20</td><td>64</td><td>60</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK22</td><td>CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG</td><td>35</td><td>70</td><td>34</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK23</td><td>ATTTATTGGAGAAAGATAACATATCATACTTTCCC</td><td>35</td><td>66</td><td>29</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK24</td><td>AACCTTTATTGTGTGCACACTCAAAC</td><td>26</td><td>63</td><td>38</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK25</td><td>GATAATATAAAGATGGGCAGCAGCCATCAT</td><td>30</td><td>69</td><td>40</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK26</td><td>CCAATAAATCTATTCTTTAGCTCCTGACTCCAATA<br>TTGTA</td><td>40</td><td>70</td><td>32</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK27</td><td>ACTAGTGGATCCCCCCCTCCACAAAGGCCTCTCCT</td><td>35</td><td>81</td><td>60</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK28</td><td>GAATTCCTGCAGCCCAACCTTTATTGTGTGCACAC<br>TCAAAC</td><td>41</td><td>80</td><td>46</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK60</td><td>GTGTAGGCCTCGGCATCCG</td><td>19</td><td>67</td><td>68</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK61</td><td>TAATACGACTCACTATAGGGGTGGAGAGGGTGAAG<br>GTGATG</td><td>41</td><td>77</td><td>49</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK62</td><td>TAATACGACTCACTATAGGGTGCCATGTGTAATCC<br>CAGCAG</td><td>41</td><td>77</td><td>46</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK81</td><td>atgtatTCTAGAcTCCTCCACAAAGGCCTCTCCTG<br>G</td><td>36</td><td>75</td><td>50</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK82</td><td>GCCCCCTGCAtGCCCTCC</td><td>18</td><td>72</td><td>78</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK83</td><td>GCGCAGGAGGGCaTGCAGG</td><td>19</td><td>73</td><td>74</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK84</td><td>gtACTAGTgCTTTATATTATCAATATTTGTGTTTG<br>TGGAGGGGGGGG</td><td>47</td><td>77</td><td>40</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK85</td><td>GGGTCGCGGATCCgaaCtcATGG</td><td>23</td><td>75</td><td>65</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK86</td><td>CGCTTCTTCCTGCCATgaGttcGGA</td><td>25</td><td>74</td><td>56</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK87</td><td>atgtatTCTAGAcaatgggcagcagccatc</td><td>30</td><td>71</td><td>47</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK88</td><td>gtACTAGTgCTATTCTTTAGCTCCTGACTCCA</td><td>32</td><td>66</td><td>44</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK89</td><td>AAT CTA GAA GCG GCC GCA CAC GCT TT<br>TTC</td><td>38</td><td>77</td><td>39</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK90</td><td>GAACTAGTCAGAGATCTGAGTCCGGACTTGTACAG<br>CTC</td><td>38</td><td>73</td><td>50</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK91</td><td>ccgcaaaatcaggtgtgttg</td><td>20</td><td>63</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK92</td><td>tatctttaccaattagtttcaatgtttagtaagg</td><td>34</td><td>63</td><td>26</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK93</td><td>AATGACGCTGACGGTACAGG</td><td>20</td><td>61</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK94</td><td>ATGCCCCAGACTGTGAGTTG</td><td>20</td><td>61</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK95</td><td>ggttgtgtgaagatgaccgc</td><td>20</td><td>61</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK96</td><td>tcttcagcagggacttgcag</td><td>20</td><td>62</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK97</td><td>agcgttcaactagcagacca</td><td>20</td><td>59</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK98</td><td>agggcagattgtgtggacag</td><td>20</td><td>61</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK99</td><td>TGGCGAGAACCACCTTCTTC</td><td>20</td><td>63</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK100</td><td> GCTCCCTGGTTGAACGTGTA</td><td>21</td><td>61</td><td>52</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK21-2</td><td>CCTCCACAAAGGCCTCTCCT</td><td>20</td><td>64</td><td>60</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK22-2</td><td>CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG</td><td>35</td><td>70</td><td>34</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK121</td><td>GCCTCTCCTGGGGTTTGAG</td><td>19</td><td>63</td><td>63</td><td>Ohara</td><td>Macrogen Japan Corp</td></tr><tr><td>IK122</td><td>CTCCACAAACACAAATATTGATAATATAAAGatgg<br>gcagc</td><td>40</td><td>73</td><td>35</td><td>Ohara</td><td>Macrogen Japan Corp</td></tr><tr><td>IK129</td><td>CCTCCACAAACACAAATATTGATAATATAAAGatg<br>ggcagcagccatcat</td><td>50</td><td>80</td><td>38</td><td>Ohara</td><td>Macrogen Japan Corp</td></tr><tr><td>IK130</td><td>GGAAAGTATGATATGTTATCTTTCTCCAATAAATC<br>TATTCTTTAGCTCCTGACTCCAATATTGTA</td><td>65</td><td>77</td><td>31</td><td>Ohara</td><td>Macrogen Japan Corp</td></tr><tr><td>IK101</td><td>atgtcttctagagcggtaggt</td><td>21</td><td>56</td><td>48</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK102</td><td>cctgattttgcggccgcatccgtcgaaactaagttctgg</td><td>39</td><td>85</td><td>54</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK103</td><td>aacttagtttcgacggat gcggccgcaaaatcag<br>g</td><td>36</td><td>83</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK104</td><td>gcACTAGTtgaagcttctctatct</td><td>24</td><td>56</td><td>42</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK105</td><td>atgtcttctagagccccattatcttagcctaaaaaaacc</td><td>39</td><td>73</td><td>38</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK106</td><td>cctgattttgcggccgcctccatggtggcggc</td><td>32</td><td>90</td><td>69</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK107</td><td>cccgccgccaccatggaggcggccgcaaaatcagg</td><td>35</td><td>94</td><td>71</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr></table> | |
</div> <!-- Table end --> | </div> <!-- Table end --> | ||
Revision as of 13:40, 30 October 2017
Material&Methods
- 1) Parts
- 2) Primer list
- 3) Materials
- 3-1 Kit
- 3-2 Restriction Enzyme
- 3-3 Polymerase
- 3-4 DNA ligase
- 3-5 Marker
- 3-6 Organism
- 3-7 Antibiotics
- 3-8 Equipment
- 3-9 Backbone
- 3-10 Buffer
- 3-11 SDSPAGE&Westernblotting
- 3-12 B.xylophilus Experiment
- 4) Methods
- 4-1 Miniprep
- 4-2 Gel Extraction and PCR purification
- 4-3 Restriction Enzyme Digestion
- 4-4 Ligation
- 4-5 Transformation
- 4-6 PCR
- 4-7 Sequencing
- 4-8 RT-PCR
- 4-9 RTqPCR
- 4-10 Western blotting (Sample preparation of S. cerevisiae)
- 4-11 Western blotting (Basic protocol)
- 4-12 Culture using yeasts and measurement
- 4-13 The way of taking photos
- 4-14 Methods of taking movies
- 4-15 Way of making agar pad
- 4-16 Synthesis of dsRNA
- 4-17 Soaking
- Thaw competent cells on ice
- Add DNA sample (2.5μl) to competent cells. leave them on ice for 15 minutes
- Keep them in heating block for 45 seconds, then cool on ice for 2 minutes
- Add 90μl SOC liquid culture medium, then incubate for 45 minutes at 37°C
- Seed cells onto LB+antibiotics agar plate. Incubate for 24 hours at 37°C
- Cultivate 1ml of S. cerevisiae culture whose OD600 values are 1.0
- Pour 1ml of the S. cerevisiae cell culture into 1.5ml tubes
- Centrifuge 5000rpm for 1min and remove the supernatant
- Resuspend with 30ul of SDS sample buffer
- Heat samples for 10min at 100°C using block incubater
- Vortex well
- Apply sample to SDS-PAGE minigel (BIOCRAFT 15%)
- Soak the gel in transfer buffer
- Soak PVDF membrane in 100% methanol for 30 sec
- Soak PVDF membrane and filter paper in transfer buffer, leave for 5 min
- Set filter paper, membrane, gels, filter paper in this order to semidry transfer from anode to cathode
- Transfer the proteins from the gel to the membrane with 100 mA for 1 h
- Soak membrane in blocking buffer (dilution of 5 g ECL Blocking reagent by 100ml of TBST) for 1 h
- Wash for 5 min 3 times with TBST
- Apply 1' antibody (dilution of 10 μl of 1’antibody by 10ml of Blocking buffer) and shake for 1 h
- Wash for 5 min 3 times with TBST
- Apply 2' antibody (dilution of 4μl of 2’antibody by 10ml of Blocking buffer) and shake for 1 h
- Wash for 5 min 3 times with TBST
- Drain excess wash buffer from the washed membrane and place on flat surface, protein side up
- Add detection reagent onto the membrane, covering all of the membrane
- Incubate for 5 minutes at room temperature
- Drain off excess detection reagent by dabbing with Kimwipe
- Place the sample in the CCD camera compartment and record the images
- Prepare medium put on 3.5 cm plate.
- Drop liquid-cultured yeasts on the center of medium.
- Disperse them by bacteria spreader and dry for 30min to 1 hour. Or leave them as they are.
- Pipette suspension including nematodes on the medium.
- Culture it at 25 ℃
- Culture yeasts expressing GFP over night and dilute them three times with DW or SD liquid medium.
- Drop 200-300μl of water on the medium after one or two days, and pipette it in order to spread over the medium.
- Suck out 12ul of water on the medium and drop it on microscope slide.
- Cover it with cover glass and observe whether nematodes feed yeasts expressing GFP by fluorescence microscope.
- Make agar pad.
- Extract nematodes from PDA medium, collect them into 1.5ml tube and centrifuge it.
- Remove supernatant and put 1.5ul of suspension with nematodes into gap of cover glasses.
- Snap microscope slide with the finger and reach suspension to the center of agarose medium.
- Observe whether nematodes feed yeast expressing GFP by microscope and take videos of it.
- Make medium of 2% agar and sterlize by autoclave.
- Put sterlized slide glass between two of slide glasses covered with "Kimwipes", drop agar medium, then rapidly cover agar medium with another slide glass.
- After the medium sodifies, reveal slowly covered slide glass.
- Pipette yeasts on the medium, cover the medium on cover glass, and culture it for 1-2days.
1) Parts
Basic Parts
Composite Parts
2) Primer List
| primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
|---|---|---|---|---|---|---|
| tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
| tropomyosinT7R | TAATACGACTCACTATAGGGCTTGTTTTCTCCGGC TTCGG | 40 | 79 | 48 | Fukuda | Macrogen Japan Corp |
| tropomyosinT7F | TAATACGACTCACTATAGGGGATCGAGAAGGACAA CGCCC | 40 | 79 | 50 | Fukuda | Macrogen Japan Corp |
| tropomyosinR | CTTGTTTTCTCCGGCTTCGG | 20 | 66 | 55 | Fukuda | Macrogen Japan Corp |
| top-1F | GACTTTTCGTGCGTCTTCGG | 20 | 64 | 55 | Fukuda | Macrogen Japan Corp |
| top-1T7R | TAATACGACTCACTATAGGGCCCGGTTGAAAAGCA AGTGT | 40 | 78 | 45 | Fukuda | Macrogen Japan Corp |
| top-1T7F | TAATACGACTCACTATAGGGGACTTTTCGTGCGTC TTCGG | 40 | 78 | 48 | Fukuda | Macrogen Japan Corp |
| top-1R | CCCGGTTGAAAAGCAAGTGT | 20 | 64 | 50 | Fukuda | Macrogen Japan Corp |
| eef-1gF | GCAAAGGTTGCCGGTAAGAC | 20 | 64 | 55 | Fukuda | Macrogen Japan Corp |
| eef-1gT7R | TAATACGACTCACTATAGGGGACGGCAGAGGCCAA CTTTA | 40 | 78 | 48 | Fukuda | Macrogen Japan Corp |
| eef-1gT7F | TAA TACGACTCACTATAGGGGCAAAGGTTGCCGGT AAGAC | 40 | 77 | 48 | Fukuda | Macrogen Japan Corp |
| eef-1gR | GACGGCAGAGGCCAACTTTA | 20 | 64 | 55 | Fukuda | Macrogen Japan Corp |
| asbF | GGACTTTGGTCGTTGTCCCA | 20 | 63 | 55 | Fukuda | Macrogen Japan Corp |
| asbT7R | TAATACGACTCACTATAGGGTCCACAGCGTCCTTC AAGTC | 40 | 75 | 48 | Fukuda | Macrogen Japan Corp |
| asbT7F | TAATACGACTCACTATAGGGGGACTTTGGTCGTTG TCCCA | 40 | 78 | 48 | Fukuda | Macrogen Japan Corp |
| asbR | TCCACAGCGTCCTTCAAGTC | 20 | 61 | 55 | Fukuda | Macrogen Japan Corp |
| 14-3-3proteinF-2 | TGGAGGGTGATCTCGTCCAT | 20 | 62 | 55 | Fukuda | Macrogen Japan Corp |
| 14-3-3proteinT7R-2 | TAATACGACTCACTATAGGG CAAGGGGGATGGTT GGTCTC | 41 | 78 | 49 | Fukuda | Macrogen Japan Corp |
| 14-3-3proteinT7F-2 | TAATACGACTCACTATAGGG TGGAGGGTGATCTC GTCCAT | 41 | 76 | 46 | Fukuda | Macrogen Japan Corp |
| 14-3-3proteinR-2 | CAAGGGGGATGGTTGGTCTC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
| actinF | AATGGCTCCGGTATGTGCAA | 20 | 65 | 50 | Fukuda | Macrogen Japan Corp |
| actinR | TGGTGGTGAAAGAGTAGCCG | 20 | 62 | 55 | Fukuda | Macrogen Japan Corp |
| 14-3-3zetaF | CCTACAAGAACGTGGTCGGT | 20 | 61 | 55 | Fukuda | Macrogen Japan Corp |
| 14-3-3zetaT7R | TAATACGACTCACTATAGGGTGTGAGTGCTCGCAA ACTGT | 40 | 75 | 45 | Fukuda | Macrogen Japan Corp |
| 14-3-3zetaT7F | TAATACGACTCACTATAGGGCCTACAAGAACGTGG TCGGT | 40 | 76 | 48 | Fukuda | Macrogen Japan Corp |
| 14-3-3zetaR | TGTGAGTGCTCGCAAACTGT | 20 | 60 | 50 | Fukuda | Macrogen Japan Corp |
| 14-3-3proF | TCTCGGTCGCCTACAAGAAC | 20 | 61 | 55 | Fukuda | Macrogen Japan Corp |
| 14-3-3proT7R | TAATACGACTCACTATAGGGCCAGTCTCTCCCGTC TCGTT | 40 | 77 | 50 | Fukuda | Macrogen Japan Corp |
| 14-3-3proT7F | TAATACGACTCACTATAGGGTCTCGGTCGCCTACA AGAAC | 40 | 75 | 48 | Fukuda | Macrogen Japan Corp |
| 14-3-3proR | CCAGTCTCTCCCGTCTCGTT | 20 | 62 | 60 | Fukuda | Macrogen Japan Corp |
| AK1F | TCGGAGACGGTTGTGTGAAGATG | 23 | 66 | 52 | Yoshimoto | Macrogen Japan Corp |
| AK1T7R | TAATACGACTCACTATAGGGCAAGCACGGGTTGA ATGGGT | 41 | 79 | 46 | Yoshimoto | Macrogen Japan Corp |
| AK1T7F | TAATACGACTCACTATAGGGTCGGAGACGGTTGTG TGAAGATG | 43 | 77 | 47 | Yoshimoto | Macrogen Japan Corp |
| AK1R | CAAGCACGGGTTGAATGGGT | 20 | 66 | 55 | Yoshimoto | Macrogen Japan Corp |
| longAK2F | TCCGAATCATGGCGAGAACC | 20 | 66 | 55 | Yoshimoto | Macrogen Japan Corp |
| longAK2T7R | TAATACGACTCACTATAGGGCATGCCGGTCAACGG ATAGT | 40 | 78 | 48 | Yoshimoto | Macrogen Japan Corp |
| longAK2T7F | TAATACGACTCACTATAGGGTCCGAATCATGGCGA GAACC | 40 | 78 | 48 | Yoshimoto | Macrogen Japan Corp |
| longAK2R | CATGCCGGTCAACGGATAGT | 20 | 64 | 55 | Yoshimoto | Macrogen Japan Corp |
| shortAK2F | CCGTTTTGGATTTGTCGCGT | 20 | 67 | 50 | Yoshimoto | Macrogen Japan Corp |
| shortAK2T7R | TAATACGACTCACTATAGGGTCGATCTTCTTGACC GTCGC | 40 | 77 | 48 | Yoshimoto | Macrogen Japan Corp |
| shortAK2T7F | TAATACGACTCACTATAGGGCCGTTTTGGATTTGT CGCGT | 40 | 79 | 45 | Yoshimoto | Macrogen Japan Corp |
| shortAK2R | TCGATCTTCTTGACCGTCGC | 20 | 64 | 55 | Yoshimoto | Macrogen Japan Corp |
| gal1-1F | cccCGAATTCccccattatctt | 22 | 68 | 50 | Yoshimoto | Macrogen Japan Corp |
| gal1-1R | CTCCCACACCAGCATCCAA | 19 | 63 | 58 | Yoshimoto | Macrogen Japan Corp |
| gal1-2F | AAGCTGGGCGCCACTTT | 17 | 64 | 59 | Yoshimoto | Macrogen Japan Corp |
| gal1-2R | CAAGTCGTTGCTGAAGAAACATTTCAC | 27 | 66 | 41 | Yoshimoto | Macrogen Japan Corp |
| gal1-3F | ACTCGGCGTCCGGAG | 15 | 61 | 73 | Yoshimoto | Macrogen Japan Corp |
| gal1-3R | tacccTGCAGgggagc | 16 | 59 | 69 | Yoshimoto | Macrogen Japan Corp |
| gpd-1F | tctagaggatccccCGAATTC | 21 | 63 | 52 | Yoshimoto | Macrogen Japan Corp |
| gpd-1R | CCGTTGACCGGCATGct | 17 | 65 | 65 | Yoshimoto | Macrogen Japan Corp |
| gpd-2F | AATCCGCTGTGGCCGC | 16 | 66 | 69 | Yoshimoto | Macrogen Japan Corp |
| gpd-2R | AACCACCTTCTTCGCACAGAAC | 22 | 63 | 50 | Yoshimoto | Macrogen Japan Corp |
| gpd-3F | GACGTCCTTGGTGAAATGTTTC | 22 | 61 | 45 | Yoshimoto | Macrogen Japan Corp |
| gpd-3R | gggaaaaccctggcgttac | 19 | 64 | 58 | Yoshimoto | Macrogen Japan Corp |
| IK21 | CCTCCACAAAGGCCTCTCCT | 20 | 64 | 60 | Yoshimoto | Macrogen Japan Corp |
| IK22 | CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG | 35 | 70 | 34 | Yoshimoto | Macrogen Japan Corp |
| IK23 | ATTTATTGGAGAAAGATAACATATCATACTTTCCC | 35 | 66 | 29 | Yoshimoto | Macrogen Japan Corp |
| IK24 | AACCTTTATTGTGTGCACACTCAAAC | 26 | 63 | 38 | Yoshimoto | Macrogen Japan Corp |
| IK25 | GATAATATAAAGATGGGCAGCAGCCATCAT | 30 | 69 | 40 | Yoshimoto | Macrogen Japan Corp |
| IK26 | CCAATAAATCTATTCTTTAGCTCCTGACTCCAATA TTGTA | 40 | 70 | 32 | Yoshimoto | Macrogen Japan Corp |
| IK27 | ACTAGTGGATCCCCCCCTCCACAAAGGCCTCTCCT | 35 | 81 | 60 | Yoshimoto | Macrogen Japan Corp |
| IK28 | GAATTCCTGCAGCCCAACCTTTATTGTGTGCACAC TCAAAC | 41 | 80 | 46 | Yoshimoto | Macrogen Japan Corp |
| IK60 | GTGTAGGCCTCGGCATCCG | 19 | 67 | 68 | Yoshimoto | Macrogen Japan Corp |
| IK61 | TAATACGACTCACTATAGGGGTGGAGAGGGTGAAG GTGATG | 41 | 77 | 49 | Yoshimoto | Macrogen Japan Corp |
| IK62 | TAATACGACTCACTATAGGGTGCCATGTGTAATCC CAGCAG | 41 | 77 | 46 | Yoshimoto | Macrogen Japan Corp |
| IK81 | atgtatTCTAGAcTCCTCCACAAAGGCCTCTCCTG G | 36 | 75 | 50 | Dou | Macrogen Japan Corp |
| IK82 | GCCCCCTGCAtGCCCTCC | 18 | 72 | 78 | Dou | Macrogen Japan Corp |
| IK83 | GCGCAGGAGGGCaTGCAGG | 19 | 73 | 74 | Dou | Macrogen Japan Corp |
| IK84 | gtACTAGTgCTTTATATTATCAATATTTGTGTTTG TGGAGGGGGGGG | 47 | 77 | 40 | Dou | Macrogen Japan Corp |
| IK85 | GGGTCGCGGATCCgaaCtcATGG | 23 | 75 | 65 | Dou | Macrogen Japan Corp |
| IK86 | CGCTTCTTCCTGCCATgaGttcGGA | 25 | 74 | 56 | Dou | Macrogen Japan Corp |
| IK87 | atgtatTCTAGAcaatgggcagcagccatc | 30 | 71 | 47 | Dou | Macrogen Japan Corp |
| IK88 | gtACTAGTgCTATTCTTTAGCTCCTGACTCCA | 32 | 66 | 44 | Dou | Macrogen Japan Corp |
| IK89 | AAT CTA GAA GCG GCC GCA CAC GCT TT TTC | 38 | 77 | 39 | Dou | Macrogen Japan Corp |
| IK90 | GAACTAGTCAGAGATCTGAGTCCGGACTTGTACAG CTC | 38 | 73 | 50 | Dou | Macrogen Japan Corp |
| IK91 | ccgcaaaatcaggtgtgttg | 20 | 63 | 50 | Yoshimoto | Macrogen Japan Corp |
| IK92 | tatctttaccaattagtttcaatgtttagtaagg | 34 | 63 | 26 | Yoshimoto | Macrogen Japan Corp |
| IK93 | AATGACGCTGACGGTACAGG | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK94 | ATGCCCCAGACTGTGAGTTG | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK95 | ggttgtgtgaagatgaccgc | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK96 | tcttcagcagggacttgcag | 20 | 62 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK97 | agcgttcaactagcagacca | 20 | 59 | 50 | Yoshimoto | Macrogen Japan Corp |
| IK98 | agggcagattgtgtggacag | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK99 | TGGCGAGAACCACCTTCTTC | 20 | 63 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK100 | GCTCCCTGGTTGAACGTGTA | 21 | 61 | 52 | Yoshimoto | Macrogen Japan Corp |
| IK21-2 | CCTCCACAAAGGCCTCTCCT | 20 | 64 | 60 | Yoshimoto | Macrogen Japan Corp |
| IK22-2 | CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG | 35 | 70 | 34 | Yoshimoto | Macrogen Japan Corp |
| IK121 | GCCTCTCCTGGGGTTTGAG | 19 | 63 | 63 | Ohara | Macrogen Japan Corp |
| IK122 | CTCCACAAACACAAATATTGATAATATAAAGatgg gcagc | 40 | 73 | 35 | Ohara | Macrogen Japan Corp |
| IK129 | CCTCCACAAACACAAATATTGATAATATAAAGatg ggcagcagccatcat | 50 | 80 | 38 | Ohara | Macrogen Japan Corp |
| IK130 | GGAAAGTATGATATGTTATCTTTCTCCAATAAATC TATTCTTTAGCTCCTGACTCCAATATTGTA | 65 | 77 | 31 | Ohara | Macrogen Japan Corp |
| IK101 | atgtcttctagagcggtaggt | 21 | 56 | 48 | Yoshimoto | Macrogen Japan Corp |
| IK102 | cctgattttgcggccgcatccgtcgaaactaagttctgg | 39 | 85 | 54 | Yoshimoto | Macrogen Japan Corp |
| IK103 | aacttagtttcgacggat gcggccgcaaaatcag g | 36 | 83 | 50 | Yoshimoto | Macrogen Japan Corp |
| IK104 | gcACTAGTtgaagcttctctatct | 24 | 56 | 42 | Yoshimoto | Macrogen Japan Corp |
| IK105 | atgtcttctagagccccattatcttagcctaaaaaaacc | 39 | 73 | 38 | Yoshimoto | Macrogen Japan Corp |
| IK106 | cctgattttgcggccgcctccatggtggcggc | 32 | 90 | 69 | Yoshimoto | Macrogen Japan Corp |
| IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Materials
3-1 Kit
| Name | Supplier |
|---|---|
| Wizard® SV Gel and PCR | Promega |
| FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
3-2 Restriction Enzyme
| Name | Supplier |
|---|---|
| EcoRI | TaKaRa, Promega |
| PstI | TaKaRa, Promega |
| SpeI | TaKaRa, Promega |
3-3 Polymerase
| Name | Supplier |
|---|---|
| KAPA™HiFi HotStart ReadyMix (2x) | KAPABIOSYSTEMS |
| KAPA2G™ Fast HotStart ReadyMix with dye (2x) | KAPABIOSYSTEMS |
| KAPATaq™EXtra HotStart ReadyMix with dye | KAPABIOSYSTEMS |
3-4 DNA ligase
| Name | Supplier |
|---|
3-5 Marker
| Name | Supplier |
|---|---|
| 1kb DNA Ladder | TaKaRa |
3-6 Organism
| Name | Supplier |
|---|---|
| E.coli DH5α Genotype | TaKaRa |
| E.coli BL21(DE3)pLysS Competent Cells | Promega |
3-7 Antibiotics
| Name | Supplier |
|---|
3-8 Equipment
| Name | Supplier |
|---|---|
| BioPhotometer | eppendorf |
| LABO SHAKER | BIO CRAFT |
| CO2 INCUBATOR | SANYO |
| Pipette Controller | Biohit Midi Plus |
| MiniCentrifuge Model GMC-060 | LMS CO.,LTD. |
| HIGH-SPEED REFRIGERATED CENTRIFUGE | TOMY |
| HIGH-PRESSURE STEAM STERILIZER | TOMY |
| VOTEX-GENE2 | Scientific Industryes |
| Scanning Electron Miniscope TM1000s | HITACHI |
| Fluorescence Microscope BX61N-34-FL-1-D | OLYMPUS |
| SCIECE IMAGING SYSTEM LAS-3000 | Fuji film |
3-9 Backbone
| Name | Supplier |
|---|---|
| pSB1C3 | iGEM registry |
| pSB1A2 | iGEM registry |
| pSB3C5 | iGEM registry |
3-10 Buffer
| Name | Supplier |
|---|---|
| Sodium Carbonate | Wako |
| Sodium Bicarbonate | Wako |
| Methanol(99.5%) | Wako |
| Sodium Chloride | Wako |
| SDS | nacalai tesque |
| Trisaminomethane | nacalai tesque |
| Potassium dihydrogenphosphste | SIGAMA-ALDRICH |
| Potassium Chloride | Wako |
| Glycine | Wako |
| Agar, Powder | Wako |
| Agarose XP | Wako |
| 10% Hydrochloric Acid | Wako |
3-11 SDSPAGE&Westernblotting
| IMMOBILON - P Blotting Sandwiches | Immobilon |
|---|---|
| REAL GEL PLATE (10%) | BIO CRAFT |
| BE-210(SDSPAGE) | BIO CRAFT |
| BE-330 | BIO CRAFT |
| Amersham ECL Anti-Mouse IgG | GE healthcare |
| Amersham ECL Anti-rabbit IgG | GE healthcare |
| Amersham ECL Prime Blocking Reagent | GE healthcare |
| Amersham ECL Prime WB Detection Reagent | GE healthcare |
3-12 B. xylophilus Experiment
4) Methods
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-2 Gel Extraction and PCR purification
Gel Extraction was performed using Wizard® SV Gel and PCR Clean-Up System according to the manufacturer's protocols.
4-3 Restriction Enzyme Digestion
Restriction enzyme treatment was performed using Takara Bio's or NEB's restriction enzymes according to the respective manufacturer's protocols.
4-4 Ligation
Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's
4-5 Transformation
4-6 PCR
PCR was performed using KAPA™HiFi HotStart ReadyMix (2x), KAPA™ 2G Robust HotStart ReadyMix (2x), PrimeSTAR® Max DNA Polymerase, GoTaq®, Takara Ex Taq, and Quick Taq® HS DyeMix according to the manufacturer's protocols
4-7 Sequencing
We outsourced the sequencing to Macrogen
http://www.macrogen-japan.co.jp/cap_seq_0203.php
4-8 RT-PCR
We extracted B. Xylophilus whole mRNA using Sepazol®-RNA Ⅰ Super G according to the manufacturer's protocol.
RT-PCR was performed using ~~~ according to the manufacturer's protocol.
4-9 RTqPCR
????????
4-10 Western blotting (Sample preparation of S. cerevisiae)
4-11 Western blotting (Basic protocol)
4-12 Culture using yeasts and measurement
4-13 The way of taking photos
4-14 Methods of taking movies
4-15 Way of making agar pad
4-16 Synthesis of dsRNA
We synthesyzed dsRNA by "MEGAscript™ T7 Transcription Kit."
https://www.thermofisher.com/order/catalog/product/AM1334
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf
