Difference between revisions of "Template:Team:Utrecht/MainBody"

Line 966: Line 966:
 
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Fw primer 5’-3’: TCATCGAGGAGGACAAGGCCC<br>
 
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Fw primer 5’-3’: TCATCGAGGAGGACAAGGCCC<br>
 
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rv primer 5’-3’: GCCGCTTACTTGTACTTAATGATGATGATGATGATGGCCG CCGCCGTTGCGCAGCTCCTGGATGTAG<br>
 
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rv primer 5’-3’: GCCGCTTACTTGTACTTAATGATGATGATGATGATGGCCG CCGCCGTTGCGCAGCTCCTGGATGTAG<br>
−
Protocol: Experimental\Protocols\Wiki ready\Cpf1 PCR protocol.pdf
+
Protocol: <a target=_BLANK href="" class="pdf"></a> Experimental\Protocols\Wiki ready\Cpf1 PCR protocol.pdf
 
</li>
 
</li>
 
<li>gBlock containing a kozak sequence, signal sequence and overlap regions with the backbone and Cpf1 was ordered from IDT. See snapgene file below for sequence</li>
 
<li>gBlock containing a kozak sequence, signal sequence and overlap regions with the backbone and Cpf1 was ordered from IDT. See snapgene file below for sequence</li>
Line 1,207: Line 1,207:
 
<br><br>
 
<br><br>
 
<h2 class="subhead" id="subhead-2">Introduction</h2>
 
<h2 class="subhead" id="subhead-2">Introduction</h2>
−
To produce the OUTCASST system, catalytically inactive Cas9 and Cpf1 need to be expressed on the extracellular domain of the MESA construct instead of the original extracellular VEGF binding domain. The first step in this process is to make dead versions of Cas9 and Cpf1 (dCas9 and dCpf1) by introducing mutations. This way the two proteins won’t be able to cut the DNA strands in separate pieces and are only able to bind the DNA. When our target DNA remains in one pieces it makes co-localization of the two transmembrane proteins possible. For the OUTCASST system, we substituted dCas9 for the extracellular domain of the MESA chain with the Tobacco Etch Virus (TEV) protease and we substituted dCpf1 to the MESA chain with the tetracycline-controlled transactivator (tTA). Lastly, we wanted to test the OUTCASST system for functionality and optimize it. However, we ran into problems while substituting the extracellulair domains of MESA for dCas9 and dCpf1 and therefore we did not test the functionality of the OUTCASST system, unfortunately.
+
To produce the OUTCASST system, catalytically inactive Cas9 and Cpf1 need to be expressed on the extracellular domain of the MESA construct instead of the original extracellular VEGF binding domain. The first step in this process is to make dead versions of Cas9 and Cpf1, from here on out designated as dCas9 and dCpf1 respectively, by introducing mutations. This way, the two proteins won’t be able to cut the DNA strands in separate pieces and are only able to bind the DNA. When our target DNA remains in one piece it makes co-localization of the two transmembrane proteins possible. For the OUTCASST system, we substituted dCas9 for the extracellular domain of the MESA chain with the Tobacco Etch Virus (TEV) protease and we substituted dCpf1 to the MESA chain with the tetracycline-controlled transactivator (tTA). Lastly, we wanted to test the OUTCASST system for functionality and optimize it. However, we ran into difficulties while substituting the extracellulair domains of MESA for dCas9 and dCpf1 and therefore did not manage to test the functionality of the OUTCASST system.
  
 
<br><br>
 
<br><br>
−
<h2 class="subhead" id="subhead-3">Materials</h2>
+
<h2 class="subhead" id="subhead-2">Methods</h2>
  
−
Plasmids
+
<b>Mutagenesis of Cas9 and Cpf1</b>
−
<ul>
+
−
<li />lenti-Cas9-Blast (https://www.addgene.org/52962/)
+
−
<li />lenti-AsCpf1-Blast (https://www.addgene.org/84750/)
+
−
<li />V2-MESA-35F-M-tTA (https://www.addgene.org/84502/)
+
−
<li />V2-MESA-35F-TEV (https://www.addgene.org/84503/)
+
−
<li />pL3-TRE-LucGFP-2L (https://www.addgene.org/11685/)
+
−
<li />Cre reporter (https://www.addgene.org/62732/)
+
−
</ul>
+
 
<br>
 
<br>
−
Primers for mutagenisis
 
−
<ul>
 
−
<li />dCAS9 D10A fw: tacagcatcggcctggcaatcggcaccaactctg
 
−
<li />dCAS9 D10A rv: cagagttggtgccgattgccaggccgatgctgta
 
−
<li />dCAS9 H840A fw: cgactacgatgtggacgctatcgtgcctcagagc
 
−
<li />dCAs9 H840A rv: gctctgaggcacgatagcgtccacatcgtagtcg
 
−
<li />dCpf1 D908A fw: ctatcatcggcatcgctcggggcgagagaaa
 
−
<li />dCpf1 D908A rv: tttctctcgccccgagcgatgccgatgatag
 
−
</ul>
 
  
 +
Lenti-Cas9-Blast and lenti-AsCpf1-Blast were ordered from Addgene. The mutations that needed to be introduced in the gene coding for Cas9 were D10A and H840A and in the gene coding for Cpf1 was D908A. This was done using the QuickChange II XL-Site-Directed Mutagenesis Kit with the following mutagenesis protocol. The primers used to introduce these mutations are shown below.
 
<br><br>
 
<br><br>
−
<h2 class="subhead" id="subhead-4">Methods</h2>
+
dCAS9 D10A fw 5’-3’: tacagcatcggcctggcaatcggcaccaactctg
 +
dCAS9 D10A rv 5’-3’: cagagttggtgccgattgccaggccgatgctgta
 +
 
 +
dCAS9 H840A fw 5’-3’: cgactacgatgtggacgctatcgtgcctcagagc
 +
dCAs9 H840A rv 5’-3’: gctctgaggcacgatagcgtccacatcgtagtcg
 +
 
 +
dCpf1 D908A fw 5’-3’: ctatcatcggcatcgctcggggcgagagaaa
 +
dCpf1 D908A rv 5’-3’: tttctctcgccccgagcgatgccgatgatag
 +
 
 +
<br><br>
 +
<b>In-Fusion of dCas9 and dCpf1 into the MESA constructs</b>
 +
<br>
 +
 
 +
The In-Fusion of each chain was performed with three PCR fragments; dCas9 or dCpf1 and two backbone fragments. The MESA backbone of each chain was split into two fragments because the backbones proved to be too large for a single PCR experiment. The used fragments were made according to the following PCR protocols.
 +
 
 +
In-Fusion was then performed according to the In-Fusion cloning procedure for spin-column purified PCR fragments of the In-Fusion HD cloning Kit User Manual protocol.
 +
 
 +
<br><br>
 +
<b>Transformation of OUTCASST into Top 10 E. coli</b>
 +
<br>
 +
 
 +
Products of the InFusion cloning reaction were transformed into Top 10 E.coli cells. The colonies with the right sequence were put into a larger culture and midiprepped to use for transfection later on.
 +
 
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-2">Results</h2>
 +
 
 +
<b>Cpf1 Mutagenesis</b>
 +
<br>
 +
 
 +
The midiprepped sample was nanodropped and had a concentration of 149,1 ng/uL. The sequence results showed the D908A mutation had successfully been introduced into the Cpf1 plasmid, rendering it a catalytically inactive dCpf1 variant. This miniprepped sample was used for further assembly.
 +
 
 +
<br><br>
 +
 
 +
<b>Cas9 Mutagenesis</b>
 +
<br>
 +
The miniprepped sample sent for sequencing and the results of the sequencing showed that the D10A mutation was successfully introduced to Cas9. The sequenced sample was used as a template to create the second mutation. Transformation for this product failed several times. Even with successful transformation, the concentration after miniprep was too low to send for sequencing. For the sake of time, we was decided that the DNA sequence for dCas9 would be ordered from addgene as a whole. The following plasmid, including the mutations of our design, was ordered: https://www.addgene.org/46911/.
 +
 
 +
<br><br>
 +
<b>dCpf1-tTa Assembly</b>
 +
<br>
 +
 
 +
After InFusion and transformation, plasmids were miniprepped and clone 2, 3, 4, 5 and 8 were sent for sequencing. Unfortunately, the sequence data looked chaotic and none of the clones were completely correct. It could have been that the DNA quality was not good enough for sequencing. Of these results, clone 8 looked the most promising and so this one was re-transformed, maxiprepped and examined with restriction digestion.
 +
 
 +
<br><br>
 +
 
 +
The digestion yielded no results and so we were faced with a dilemma. We decided it would be more feasible to attempt to fix one of the clones than to repeat the InFusion. We re-transformed clones 2, 3, 4 and 8, performed midiprep and another restriction digest. Clone 2 and 8 appeared to be the best clones to use. It was decided to send these two clones for sequencing.
 +
 
 +
<br><br>
 +
 
 +
Sequencing results showed that there was likely to be a mistake in the backbones of these clones that could be fixed through a PCR treatment for the backbone section with the error. This fragment could then be replaced in the construct through restriction and InFusion.
 +
 
 +
<br><br>
 +
<b>dCas9-Tev</b>
 +
<br>
 +
 
 +
After InFusion and transformation, the samples were midi-prepped and clones 1, 2 and 4 were sent for sequencing after nanodropping. Sequencing results were very chaotic and none of the clones were found to be correct.
 +
 
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-2">Discussion</h2>
 +
 
 +
Due to a lack of lab-time, the functionality and specificity of the OUTCASST system could not be assessed. Our aim was to test the functionality of our fusion protein constructs in HEK293T cells and to assess specificity in order to give an indication of the possible false-positive and false-negative rates of the system and eventual toolkit. Specificity is particularly important for OUTCASST since we aim for a system that can be used as a diagnostics tool. Altogether, it is very unfortunate that we could not finish this section of the project.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-2">Supplementary</h2>
 +
 
 +
Plasmid nanodrop results can be found in a downloadable <a href="">document</a>.
 
</script>
 
</script>
  
Line 1,608: Line 1,659:
  
 
#modal-content>h2 { border-bottom: 1px solid #dedede; padding-bottom: 10px; }
 
#modal-content>h2 { border-bottom: 1px solid #dedede; padding-bottom: 10px; }
 +
 +
.pdf { display: inline-block; width: 24px; height: 24px; background: url(https://static.igem.org/mediawiki/2017/6/6a/Uupdf.png) no-repeat; vertical-align: bottom; }
 
</style>
 
</style>
  
Line 1,831: Line 1,884:
  
 
<div style="clear: both;"></div>
 
<div style="clear: both;"></div>
 +
 +
<style type="text/css">
 +
.team-expand
 +
{
 +
font-size: 20px;
 +
line-height: 5px;
 +
cursor: pointer;
 +
width: 30px;
 +
height: 15px;
 +
margin: 10px auto;
 +
text-align: center;
 +
background: #ececec;
 +
color: #0069b3;
 +
border-radius: 5px;
 +
}
 +
 +
.team-expand:hover
 +
{
 +
background: #0069b3;
 +
color: white;
 +
}
 +
 +
.team-bio
 +
{
 +
position: relative; font-size: 12px; line-height: 20px; height: 37px; overflow: hidden;
 +
}
 +
 +
.team-bio-grad
 +
{
 +
position: absolute; bottom: 0; left: 0; width: 100%; height: 25px; background: -moz-linear-gradient(top, rgba(255,255,255,0) 0%, rgba(255,255,255,1) 100%); /* FF3.6-15 */
 +
background: -webkit-linear-gradient(top, rgba(255,255,255,0) 0%,rgba(255,255,255,1) 100%); /* Chrome10-25,Safari5.1-6 */
 +
background: linear-gradient(to bottom, rgba(255,255,255,0) 0%,rgba(255,255,255,1) 100%); /* W3C, IE10+, FF16+, Chrome26+, Opera12+, Safari7+ */
 +
filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#00ffffff', endColorstr='#ffffff',GradientType=0 ); /* IE6-9 */
 +
}
 +
</style>
  
 
<div class="team_members">
 
<div class="team_members">
Line 1,841: Line 1,929:
 
         </div>
 
         </div>
 
<div class="date">Team captain</div>
 
<div class="date">Team captain</div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Bio Inspired Innovation<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
&rsaquo; Experimental - Secreted Cas9 and Cpf1<br>
 +
&rsaquo; Human Practices - Application
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio" style="height: 85px;">
 +
Hey, I'm Giel (22), a second-year Bio Inspired Innovation master student and one of the two team captains of this iGEM team.
 +
<br><br>
 +
I did my bachelor Molecular Life Sciences in Groningen, where I first heard about the iGEM competition. However when I arrived in Utrecht, I learned that they never participated before. So this makes me extra proud to be a member of this first ever iGEM team!
 +
<br><br>
 +
What I like about iGEM is that it's completely our own project and that we tackle a real-world problem... So if we work hard enough, we might actually make the world a little better!
 +
<br><br>
 +
When I'm not busy with iGEM, or while we're waiting for our experiments, I like to read, draw, paint or, when the weather is nice, to go for a run!
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,854: Line 1,959:
 
         </div>
 
         </div>
 
<div class="date">Team captain</div>
 
<div class="date">Team captain</div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Biofabrication<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
&rsaquo; Experimental - MESA replication/Secreted Cas9 and Cpf1<br>
 +
&rsaquo; Funding & Sponsoring<br>
 +
&rsaquo; Biobricks
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hello, my name is Ouafa (23) and I’m a second-year master student in Biofabrication.  
 +
 
 +
I have the honour of being one of the team captains of Utrecht’s first iGEM team ever. For me, iGEM keeps science fun since we can apply our own skills and ideas in a completely original concept. Every day together with our diverse team has been such an amazing experience. I am super proud of the personal growth of each individual team member and I’m looking forward to see where our project will bring us!
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,866: Line 1,985:
 
           <h2>Lishi Lin</h2>
 
           <h2>Lishi Lin</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Pharmacy<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Human Practices - Application/Safety/Design<br>
 +
2. Experimental - Assembly/InterLab Study<br>
 +
3. Funding & Sponsoring
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hi! I'm Lishi (21), a first year master student in Pharmacy at Utrecht University. After that, I want to become a hospital pharmacist.
 +
I joined the Utrecht iGEM team because it is a unique opportunity to learn new things. One of these things is that I get to work in the lab and do those things that I’ve only learned the theoretical parts of. I’m also part of the human practices group along with Stefan, Pam and Dorien. Human practices is the part where we have to figure out how our work affects the world and how the world affects our work. For example, we have interviewed many people to figure out what they think of our project and how we can use their knowledge to improve it. This makes the project very diverse and with this amazing team, we had a great time!
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,878: Line 2,010:
 
           <h2>Sam Hariri</h2>
 
           <h2>Sam Hariri</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Pharmaceutical Sciences<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Wiki - design & coding<br>
 +
2. Experimental - Assembly<br>
 +
3. Biobricks<br>
 +
4. Public Relations
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hey, I am Sam (24) and currently in my final year of the Drug Innovation master's program. Quite a switch from my original path to become a pharmacist but I quickly found out that spending the rest of my days in pharmacy would drive me crazy. Instead, I went to pursue research. I love creating (profitable) things and science gives me an outlet to go wild with ideas. And let’s be honest, what’s more exciting than creating new therapies for diseases?
 +
Since science to me is synonymous to creating, I found participating in iGEM to be a no-brainer. The idea is that you start from scratch and try to have something tangible in the end. So far, it has been a really fun journey!
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,890: Line 2,036:
 
           <h2>Merel Janssen</h2>
 
           <h2>Merel Janssen</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> ?<br>
+
<b>Background</b> Regenerative Medicine and Technology<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
&rsaquo; Experimental - Assembly<br>
 +
&rsaquo; Biobricks<br>
 +
&rsaquo; Public Relations
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hey, my name is Merel (22) and I am a master student Regenerative Medicine and Technology in Utrecht.
 +
 +
I joined the iGEM Utrecht team because I am very excited about working on a solution to a real problem, with an awesome diverse team. For our project, I have brought my enthusiasm and mad pipetting skills with me to the lab. In my free time, I like to go horse riding, play “korfball” (it’s a Dutch thing) or bake cakes.
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,902: Line 2,062:
 
           <h2>Pamela Capendale</h2>
 
           <h2>Pamela Capendale</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> ?<br>
+
<b>Background</b> Biofabrication<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
&rsaquo; Human Practices - Design/Safety/Application<br>
 +
&rsaquo; InterLab study
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio" style="height: 61px;">
 +
Hi everyone! My name is Pamela (22) and I am a master student Biofabrication in Utrecht! I am proud to call myself member of the first iGEM team Utrecht has ever had! To experience a project from the first mind-twisting brainstorm sessions to the final presentations in Boston is, in my eyes, a once in a life-time opportunity!: During the meetings, it is fun to see how the creativity and knowledge of such a diverse group results in really cool ideas!
 +
 
 +
Facts you should know about me: In my free time I like to be sporty (yoga/running) and have drinks with friends! I love to travel and experience new cultures and for me the best holiday is an outdoor hike/canoeing/trekking trip! Cakes and desserts are the best food in this world, especially Tompouchen!
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,914: Line 2,087:
 
           <h2>Ali Amghar</h2>
 
           <h2>Ali Amghar</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Pharmacy<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Experimental - Cas9 & Cpf1 secreti&hellip;<br>
 +
2. Funding & Sponsoring
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hi! My name is Ali (23) and I am a third year graduate student Pharmacy. I'm currently finishing my last internships and hope to kick off a great career being an industrial pharmacist next year.
 +
I think freshman-year-me would never have guessed I’d be part of an interdisciplinary team of students competing in an international synthetic biology competition. But forget about him. For me, iGEM is a great way to learn new things. The aspects that really appeal to me are the novelty of the field, the integration of engineering and biology and the interdisciplinarity. It has been a pleasure being part of Utrecht's very first iGEM team and I am proud of the great things we have accomplished.
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,926: Line 2,111:
 
           <h2>Dorien Vinke</h2>
 
           <h2>Dorien Vinke</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Regenerative Medicine and Technology<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Experimental - MESA replication<br>
 +
2. Human Practices - Application/Safety/Design
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hi, I am Dorien (21), a master student in Regenerative Medicine and Technology. This is an inspiring master which shows me all aspects of this interdisciplinary field. Aside from lab skills, I am taught how to communicate, present and cooperate with others. Skills that have improved during iGEM.
 +
During my time at the university, I discovered that we need a more efficient way to use the knowledge that is discovered in the lab. Knowledge should be translated in order for it to be used in the wider world. This way, actual patients benefit from the knowledge obtained in the lab. I think it is important that what is researched is of use to society and that is why I joined iGEM. Here, we apply fundamental research by developing a DNA biosensor while considering how our biosensor affects society. We hope our sensor can be used as an easy tool to detect serious diseases in an early stage. It is awesome to join this multidisciplinary team of very passionate students and supervisors, all with creative minds, and I believe this will bring us closer to reaching our final goal.
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,938: Line 2,135:
 
           <h2>Leander Goldbach</h2>
 
           <h2>Leander Goldbach</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Molecular and Cellular Life Sciences<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Experimental - Modeling<br>
 +
2. Public Relations<br>
 +
3. Design & Art
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hey, I am Leander (21), first-year Molecular and Cellular Life Sciences Master-student and one of the two non-dutchies in the team. My scientific journey began in Berlin where I studied everything from molecular biology to the mating sounds of tree frogs as part of my bachelors. After that, I decided to follow my passion for molecular biology and biochemistry by doing two internships in synthetic biology and enzyme design. I discovered that molecules are just my thing but at the same time realized that lab work is more tedious than my chemistry books suggested, which is why I currently spend my days studying protein-peptide interactions using nothing but a computer and highly concentrated coffee.
 +
For me, iGEM is a unique opportunity to break the cycle of doing research and a simulation to test my own research skills in a fun environment. Finally, at the risk of sounding sappy, I am super happy to be part of this large and truly diverse team and I am amazed by the effort everybody puts into this. To be fair, the Dutch weather is lousy so there is no incentive whatsoever to go outside.
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,950: Line 2,160:
 
           <h2>Quincy Holzapfel</h2>
 
           <h2>Quincy Holzapfel</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Molecular and Cellular Life Sciences<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Experimental - Secreted Cpf1 and Cas9<br>
 +
2. Design & Art<br>
 +
3. Wiki - vector art
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hey! My name is Quincy (23) and I am currently doing the master programme “Molecular and Cellular Life Sciences” to further my career in the fields of cell biology, molecular biology, and microbiology.
 +
I have an uncanny fascination for mushrooms and fungi and I spend much time with identifying these beautiful life-forms. So, if you are in Utrecht and you see a guy randomly crawling on the forest floor to hunt for mushrooms, then that’ll probably be me. Because of that, some tend to call me “funguy”. I love drawing and doing creative or artsy projects.
 +
Participating in the iGEM competition is a unique opportunity to participate in an interdisciplinary and international collaboration of motivated students. Although my primary focus is fundamental research, it’s really nice to also be involved in the implementation and human practices side of research. Also, I’m really proud to be part of the funniest and quirkiest iGEM team of 2017. Really, it’s true, it’s a fact. Period.
 +
<br><br>
 +
PS: Bananas are actually berries
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,962: Line 2,188:
 
           <h2>Stefan Zaharievski</h2>
 
           <h2>Stefan Zaharievski</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Biofabrication<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Human Practices - Design/Safety/Application
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hey there. My name is Stefan (24) and I am in the second year of my Biofabrication MSc study – along with our team captain Ouafa. I am the second non-Dutchie of the Utrecht iGEM team.
 +
 +
Working on iGEM has been quite a unique and wonderful experience. What I really enjoy about the project is that it pushes you to think about far more than just the science side of your project. For a great project it is important that the team has thought about the real societal and human impacts such a project would have. This means that it is important to have public outreach and dialogue with people that would be affected by your genetically engineered machine! This aspect of iGEM is what makes the iGEM project far bigger than just another research project, and for me, very fascinating.
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,974: Line 2,212:
 
           <h2>Kewin Ogink</h2>
 
           <h2>Kewin Ogink</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Biology<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Experimental - Secreted cas9 and cpf1<br>
 +
2. Public Relations
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hey, my name is Kewin (21) and I’m a third-year student of the Biology bachelor in Utrecht. To be fair, I find it pretty hard to find a direction to follow within the broadness of biology, but iGEM gave me a spark and a chance to not only meet the field of synthetic biology, but also to actually apply it. It’s really cool to start from the bottom up, to get together and discuss what we are going to do, how we will do it and then also actually achieve it, hopefully.
 +
 
 +
Having an awesome group of mixed backgrounds shows me how you can tackle the same idea from different viewpoints and I think we complement each other very well. This experience is completely different from normal coursework, because it matters what and why you do the things you do. Not only for the successful outcome of the experiments, but you also need to consider societal implications, something I didn’t really learn in my bachelor.
 +
 +
And the best part is: They sent us buttons and stickers!
 +
So yeah, hurray for iGEM, woohoo!</div>
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,986: Line 2,240:
 
           <h2>Theun de Kort</h2>
 
           <h2>Theun de Kort</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Molecular and Cellular Life Sciences<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Experimental - MESA replication/Assembly/Secreted Cpf1 and Cas9<br>
 +
2. Public Relations<br>
 +
3. Funding & Sponsoring<br>
 +
4. Biobricks
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hey, I’m Theun (23). I am a first year master student Molecular and Cellular Life Sciences. I’ve always been interested in biology, but where my interest started as an obsession with animals, I am now more interested in cells and how I can make them do something useful and/or cool. That’s why I was instantly sold when I first heard about iGEM. It gave me the opportunity to start a project from scratch that, maybe, will actually be useful someday. As a bonus, it also allows me to satiate my inner Dr Frankenstein!
 +
 
 +
When I’m not looking up protocols and articles, I like to read, watch way too much Netflix, attempt to play guitar, practice jiu jitsu and I can make the best tiramisu you’ll ever taste.
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 1,998: Line 2,267:
 
           <h2>Rawan Shekhani</h2>
 
           <h2>Rawan Shekhani</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Pharmacy<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Experimental - MESA replication/Secreted Cpf1 and Cas9<br>
 +
2. Funding & Sponsoring<br>
 +
3. Public Relations
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
I am Rawan, and currently in the final year of my master’s in pharmacy. The field of synthetic biology is partly new ground for me, but that does not make it any less fun. What struck me immediately about iGEM was the collaborative effort with people from multiple disciplines. Since this is very limited in my program, I thought it was an awesome opportunity to be part of the first iGEM team in Utrecht.
 +
Being able to work on both science as well as other activities, such as funding and human practices, completes the experience and is very useful in the future. Doing new things is very inspiring to me, and I feel like we are doing exactly that with iGEM. Having the opportunity to work on this project with a group of like-minded students and inspiring supervisors is an exciting experience.
 +
Outside of the iGEM, I like to read, do sports, travel, listen to music and hang out with friends. Looking forward to see what the project brings!
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 2,010: Line 2,293:
 
           <h2>Glenn Mulder</h2>
 
           <h2>Glenn Mulder</h2>
 
         </div>
 
         </div>
−
         <p>
+
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> &hellip;<br>
+
<b>Background</b> Molecular and Cellular Life Sciences<br>
−
<b>Responsibilities</b> &hellip;<br>
+
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
−
<b>Bio</b><br>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Morbi vestibulum egestas turpis vel pulvinar.<br>
+
<span style="font-size: 12px;">
−
</p>
+
1. Human Practices - Design/Safety<br>
 +
2. Wiki - content editor<br>
 +
3. Experimental - Modeling<br>
 +
4. Biobricks<br>
 +
5. Lab management
 +
</span>
 +
 +
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 +
<div class="team-bio">
 +
Hi, I am Glenn. I'm a student of Utrecht's Molecular & Cellular Life Science master-programme, currently doing a project at the Theoretical Biology group. I work on temperate phage decision-making by constructing an individual based model. Yes, most of my time is spent staring at a computer screen, wondering why code doesn't work. Small surprise; the group has me working on the wiki.
 +
 +
I did my BSc in Groningen and, honestly, I occasionally miss working in a lab, a void easily filled by participating in the iGEM. In the team, I tend to be the cynic who takes notes. Outside of work, I often find myself writing. I like stories, particularly short SF and heroic fantasy, but I read far less than I'd like.
 +
 +
All in all, I had a wonderful summer and look forward to meeting everyone in Boston. So, I hope to see everyone there!
 +
<div class="team-bio-grad"></div>
 +
</div>
 +
<div class="team-expand">&hellip;</div>
 +
<br>
 +
</span>
 
       </div>
 
       </div>
 
   
 
   
Line 2,144: Line 2,445:
 
<style type="text/css">
 
<style type="text/css">
 
.team_members { width: 100%; margin-top: 20px; }
 
.team_members { width: 100%; margin-top: 20px; }
−
.team_members .timeline-content { position: relative; width: 30.8%; margin-right: 2.5%; margin-bottom: 6%; float: left; text-align: left; }
+
.team_members .timeline-content { position: relative; width: 30.8%; margin-right: 2.5%; margin-bottom: 1.5%; float: left; text-align: left; }
 
.team_members .timeline-img-header { height: 175px; overflow: hidden; }
 
.team_members .timeline-img-header { height: 175px; overflow: hidden; }
 
.team_members .timeline-item h2 { font-size: 18px;width: 100%;left: 0;padding-left: 20px;padding-top: 7px;bottom: 0;padding-bottom: 7px;background: rgba(0,0,0,0.5);margin-bottom: 0; }
 
.team_members .timeline-item h2 { font-size: 18px;width: 100%;left: 0;padding-left: 20px;padding-top: 7px;bottom: 0;padding-bottom: 7px;background: rgba(0,0,0,0.5);margin-bottom: 0; }

Revision as of 22:03, 30 October 2017

<!DOCTYPE html>

  • Home
  • Experimental
  • Human practices
  • Team & Sponsors
Cas9 & Cpf1 secretion
and activity
Comparison of endonuclease activity for Cas9 and Cpf1 that has been produced in, and excreted by, HEK293 cells.
MESA two-component system replication
Details on the MESA two-component system, explanation of its relation to our design and the results of its reproduction.
OUTCASST system production
Detailed explanation of the OUTCASST mechanism, experimental progress and technical prospects.
Modeling and
mathematics
Ordinary differential equations, cellular automaton and an object based model for optimal linker-length estimation.
InterLab study participation
Results and details of our measurements for the iGEM 2017 InterLab Study.
Stakeholders & opinions
Interviews and dialogues with stakeholders, potential users, third parties and experts relating to pathogen detection or DNA-based diagnostics.
Risks & safety-issues
Implications and design considerations relating to safety in the usage and implementation of OUTCASST as a diagnostics tool.
Design & integration
OUTCASST toolkit and product design with factors such as bio-safety and user-friendliness taken into account.
Outreach
.
Meet our team
About us, our interests and roles in the team and our supervisors.
Sponsors
A listing of our sponsors, how they assisted us and our gratitude for their assistance.
Collaborations
.
Achievements
A short description of all that we have achieved during our participation in the iGEM.
Intro
The problem
The system