Difference between revisions of "Template:Team:Utrecht/MainBody"

Line 703: Line 703:
 
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/2/23/Uuoutreach.png"></div>
 
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/2/23/Uuoutreach.png"></div>
 
<div class="text">Outreach</div>
 
<div class="text">Outreach</div>
−
<div class="desc">.</div>
+
<div class="desc">Videos we made for the dutch public, together with 'de Kennis van Nu'.</div>
 
</div>
 
</div>
 
</div>
 
</div>
Line 721: Line 721:
 
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/1/19/Uucollab2.png"></div>
 
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/1/19/Uucollab2.png"></div>
 
<div class="text">Collaborations</div>
 
<div class="text">Collaborations</div>
−
<div class="desc">.</div>
+
<div class="desc">Read about our exchanges with other iGEM teams and government agencies.</div>
 
</div>
 
</div>
 
<div class="section" data-url="achievements">
 
<div class="section" data-url="achievements">
Line 727: Line 727:
 
<div class="text">Achievements</div>
 
<div class="text">Achievements</div>
 
<div class="desc">A short description of all that we have achieved during our participation in the iGEM.</div>
 
<div class="desc">A short description of all that we have achieved during our participation in the iGEM.</div>
 +
</div>
 +
<div class="section" data-url="attributions">
 +
<div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/6/64/Achievements.png"></div>
 +
<div class="text">Attributions</div>
 +
<div class="desc">A thank-you for everyone that assited us, both in and outside the lab.</div>
 
</div>
 
</div>
 
</div>
 
</div>
Line 1,210: Line 1,215:
  
 
<br><br>
 
<br><br>
−
<h2 class="subhead" id="subhead-2">Methods</h2>
+
<h2 class="subhead" id="subhead-3">Methods</h2>
  
 
<b>Mutagenesis of Cas9 and Cpf1</b>
 
<b>Mutagenesis of Cas9 and Cpf1</b>
Line 1,217: Line 1,222:
 
Lenti-Cas9-Blast and lenti-AsCpf1-Blast were ordered from Addgene. The mutations that needed to be introduced in the gene coding for Cas9 were D10A and H840A and in the gene coding for Cpf1 was D908A. This was done using the QuickChange II XL-Site-Directed Mutagenesis Kit with the following mutagenesis protocol. The primers used to introduce these mutations are shown below.
 
Lenti-Cas9-Blast and lenti-AsCpf1-Blast were ordered from Addgene. The mutations that needed to be introduced in the gene coding for Cas9 were D10A and H840A and in the gene coding for Cpf1 was D908A. This was done using the QuickChange II XL-Site-Directed Mutagenesis Kit with the following mutagenesis protocol. The primers used to introduce these mutations are shown below.
 
<br><br>
 
<br><br>
 +
<pre>
 
dCAS9 D10A fw 5’-3’: tacagcatcggcctggcaatcggcaccaactctg
 
dCAS9 D10A fw 5’-3’: tacagcatcggcctggcaatcggcaccaactctg
 
dCAS9 D10A rv 5’-3’: cagagttggtgccgattgccaggccgatgctgta
 
dCAS9 D10A rv 5’-3’: cagagttggtgccgattgccaggccgatgctgta
Line 1,225: Line 1,231:
 
dCpf1 D908A fw 5’-3’: ctatcatcggcatcgctcggggcgagagaaa
 
dCpf1 D908A fw 5’-3’: ctatcatcggcatcgctcggggcgagagaaa
 
dCpf1 D908A rv 5’-3’: tttctctcgccccgagcgatgccgatgatag
 
dCpf1 D908A rv 5’-3’: tttctctcgccccgagcgatgccgatgatag
−
 
+
</pre>
 
<br><br>
 
<br><br>
 
<b>In-Fusion of dCas9 and dCpf1 into the MESA constructs</b>
 
<b>In-Fusion of dCas9 and dCpf1 into the MESA constructs</b>
Line 1,242: Line 1,248:
  
 
<br><br>
 
<br><br>
−
<h2 class="subhead" id="subhead-2">Results</h2>
+
<h2 class="subhead" id="subhead-4">Results</h2>
  
 
<b>Cpf1 Mutagenesis</b>
 
<b>Cpf1 Mutagenesis</b>
Line 1,277: Line 1,283:
  
 
<br><br>
 
<br><br>
−
<h2 class="subhead" id="subhead-2">Discussion</h2>
+
<h2 class="subhead" id="subhead-5">Discussion</h2>
  
 
Due to a lack of lab-time, the functionality and specificity of the OUTCASST system could not be assessed. Our aim was to test the functionality of our fusion protein constructs in HEK293T cells and to assess specificity in order to give an indication of the possible false-positive and false-negative rates of the system and eventual toolkit. Specificity is particularly important for OUTCASST since we aim for a system that can be used as a diagnostics tool. Altogether, it is very unfortunate that we could not finish this section of the project.
 
Due to a lack of lab-time, the functionality and specificity of the OUTCASST system could not be assessed. Our aim was to test the functionality of our fusion protein constructs in HEK293T cells and to assess specificity in order to give an indication of the possible false-positive and false-negative rates of the system and eventual toolkit. Specificity is particularly important for OUTCASST since we aim for a system that can be used as a diagnostics tool. Altogether, it is very unfortunate that we could not finish this section of the project.
  
 
<br><br>
 
<br><br>
−
<h2 class="subhead" id="subhead-2">Supplementary</h2>
+
<h2 class="subhead" id="subhead-6">Supplementary</h2>
  
 
Plasmid nanodrop results can be found in a downloadable <a href="">document</a>.
 
Plasmid nanodrop results can be found in a downloadable <a href="">document</a>.
Line 2,653: Line 2,659:
 
<div style="clear: both;"></div>
 
<div style="clear: both;"></div>
  
 +
</script>
 +
 +
<script id="page-attributions" type="text/template">
 +
<div class="page-heading">Attribution and acknowledgement</div>
 +
 +
The Utrecht iGEM team performed most of the experiments, funding, PR and human practices on their own. All additional help is acknowledged here:
 +
 +
<br><br>
 +
<h2 class="subhead" id="subhead-2">Geijsen Laboratory</h2>
 +
<b>Prof Dr Niels Geijsen</b>, supervisor. Niels allowed us to use his lab and its facilities, gave feedback on nearly all aspects of our project and occasionally helped out in the lab. He also provided us with Clara, who became an invaluable part of our lab work.
 +
<br><b>Clara Martinez Mir</b>, BSc. Clara has been involved in almost all of the experimental components of our research. She advised us and helped with nearly all of the experiments in the Geijsen Lab, functioning as a lab technician for the team. Aside from from this, Clara refined the protocols we used and checked most of the primers before they were ordered. Without her, we would not have been able to do much of the work we’ve done.
 +
<br><b>Dr Peng Shang</b>, PhD. Peng helped us design the more complicated primers and gBlocks and helped us solve numerous technical problems.
 +
<br><b>Sonja Weterings</b>, Lab technician. Sonja helped us gather the right materials from the lab and helped us when Clara wasn’t available.
 +
 +
<br><br>
 +
<h2 class="subhead" id="subhead-3">Kruyt Laboratories</h2>
 +
<b>Prof Dr Guido van den Ackerveken</b>, supervisor. Guido helped us form our idea and gave us a workplace in his lab, even outside the summer months, when we most desperately needed it. Without this labspace we wouldn’t have been able to finish any of the things we have.
 +
<br><b>Assistant Prof Dr Margot Koster</b>, supervisor. Like Niels and Guido, Margot helped us form our idea. She was also involved as iGEM course coordinator and handled a lot of the educational administrative issues, forming a bridge between the first Utrecht team and the board of examiners.
 +
<br><b>Kim Baremans & Tijmen van Butselaar</b>. Kim and Tijmen have helped us find materials within Guido’s lab and have prepared some bacterial cultures for us. In addition, they helped us with tips and tricks to save time and money.
 +
<br><b>Esther Keizer, Msc & Assistant Prof Dr Robin Ohm</b>. Esther and Robin were always available to help us find materials and to answer questions.
 +
 +
<br><br>
 +
<h2 class="subhead" id="subhead-4">Koningsberger Laboratory</h2>
 +
<b>Prof Dr Roos Masereeuw</b>, supervisor. Like the other supervisors, Roos has been of invaluable help shaping our project. She also reserved a labspace for us in the Koningsberger building and helped us set it up with the correct supplies and equipment. In addition, she helped us with feedback on modeling parts.
 +
<br><b>Gerdien Korte-Bouws & Dr Anita van Oyen</b>. Gerdien and Anita were (co-)responsible for our lab in the Koningsberger building, handled the requisition of materials and equipment and made sure we could always enter our labspace.
 +
 +
<br><br>
 +
<h2 class="subhead" id="subhead-5">Human practices</h2>
 +
<b>Zoë Robaey</b>. Zoë guided our team on topics like innovation in terms of safety, applicability, ethics and social impact. This also with the help of “the iGEMmers guide to the future”, a Human Practices webguide she designed for iGEM.
 +
<br><b>Cecile van der Vlugt & Korienke Smit</b>. Cecile and Korienke gave input on the “Think before doing” proposal on safety issues in the lab, presented on a parade hosted by the Netherlands National Institute for Public Health and the Environment (RIVM).
 +
<br><b>Jessie van den Broek, Itam van Teeseling & Karin Wijkmans</b>. Jessie, Itam and Karin kept us informed, helped with filming, editing and brainstorming for our collaboration through our iGEM special on “Kennis van Nu”, a program hosted by the Dutch public-service broadcaster NTR.
 +
<br><b>Fridolin van der Lecq</b>. Fridolin helped us with the technical parts of filming and editing of the whiteboard movies.
 +
 +
<br><br>
 +
<h2 class="subhead" id="subhead-6">Administrative assistance</h2>
 +
<b>Dr Ton Peeters</b>, supervisor. Ton reserved a lab for us and helped us with all kinds of administration.
 +
<br><b>Drs Fraukje Bitter-van Asma</b>, Occupational Health and Safety & Environment Expert. Fraukje assisted our team by providing us with the right forms to fill in, who to send them to and what clauses would apply. She helped us navigate the maze of government regulations and required permits and, without her, we would probably not have known where to start.
 +
 +
<br><br>
 +
<h2 class="subhead" id="subhead-7">Final word</h2>
 +
As a team, we would like to express our gratitude to everyone who have helped, but express exceptional gratitude to our supervisors, who’ve been very active in shaping our project and were always prepared to help us, to Clara, without whom we wouldn’t have been able to do nearly as much work, and Zoë, who shaped our human practices component and went above and beyond in helping us.
 +
<br><br>
 +
Thank you!
 
</script>
 
</script>
 
 
Line 2,798: Line 2,847:
 
1: "OUTCASST system production",
 
1: "OUTCASST system production",
 
2: "Introduction",
 
2: "Introduction",
−
3: "Materials",
+
3: "Methods",
−
4: "Methods",
+
4: "Results",
−
5: "Results",
+
5: "Discussion",
−
6: "Discussion"
+
6: "Supplementary"
 
},
 
},
 
"modeling-and-mathematics" : {
 
"modeling-and-mathematics" : {

Revision as of 22:15, 30 October 2017

<!DOCTYPE html>

  • Home
  • Experimental
  • Human practices
  • Team & Sponsors
Cas9 & Cpf1 secretion
and activity
Comparison of endonuclease activity for Cas9 and Cpf1 that has been produced in, and excreted by, HEK293 cells.
MESA two-component system replication
Details on the MESA two-component system, explanation of its relation to our design and the results of its reproduction.
OUTCASST system production
Detailed explanation of the OUTCASST mechanism, experimental progress and technical prospects.
Modeling and
mathematics
Ordinary differential equations, cellular automaton and an object based model for optimal linker-length estimation.
InterLab study participation
Results and details of our measurements for the iGEM 2017 InterLab Study.
Stakeholders & opinions
Interviews and dialogues with stakeholders, potential users, third parties and experts relating to pathogen detection or DNA-based diagnostics.
Risks & safety-issues
Implications and design considerations relating to safety in the usage and implementation of OUTCASST as a diagnostics tool.
Design & integration
OUTCASST toolkit and product design with factors such as bio-safety and user-friendliness taken into account.
Outreach
Videos we made for the dutch public, together with 'de Kennis van Nu'.
Meet our team
About us, our interests and roles in the team and our supervisors.
Sponsors
A listing of our sponsors, how they assisted us and our gratitude for their assistance.
Collaborations
Read about our exchanges with other iGEM teams and government agencies.
Achievements
A short description of all that we have achieved during our participation in the iGEM.
Attributions
A thank-you for everyone that assited us, both in and outside the lab.
Intro
The problem
The system