Difference between revisions of "Team:CSU Fort Collins/NoteBook/June"

6.4.16 We picked E. Coli “Stellar” cells from an LB/amp plate. The cells had been transformed with pLC71. We put the cells into test tubes with 5 mL of LB and 5 µL of ampicillin and then put those in the shaker at 37℃ overnight. Protocol for picking cells from plate to test tube: Materials Autoclaved test tubes 100mL LB 100mg/mL ampicillin Test tube rack Bunsen Burner P10 or P20 pipette Latex gloves Procedure Place test tubes into the rack, label, date, initial. Light bunsen burner for flame umbrella. In each test tube: add 5mL of LB first, then, add 5 µL of AMP. Be sure that your pipette tip is submerged in the LB when adding the AMP. Remove lid from LB/AMP plate. Use a pipette tip, gently pick a colony. Eject pipet tip into test tube. Flame the opening of the tube and recap. Incubate tubes in 37℃ for approx. 16 hours. This protocol is from the HOP (Hallie’s operating procedures) binder.

6.5.16 We performed plasmid purification according to steps outlined in the S.O.P. in Tom’s lab. After purification we had ≈120 µL of plasmid solution. Fluorimetry determined the concentration of DNA was 317 ng/µL. Plasmid stored in iGEM box in fourth floor “VWR” fridge. Now it’s in the 3rd floor fridge (igem limonene box) 8.30.16 Mini-Prep Protocol (Zymo Research): Materials P1 buffer P2 buffer P3 buffer (refrigerated) (3) 1.7mL eppes. Procedure Pour test tube contents (no more than 5mL) into (3) 1.7mL eppes. Centrifuge the eppes for 3 minutes at max speed. Discard supernatant, pour carefully into waste. Centrifuge 1 minute. Pipette and discard supernatant. Add 200µL P1 buffer to 1st eppe. Pipette up and down until the pellet is dissolved. Pipette the buffer w/ dissolved pellet into 2nd eppe. Pipette up and down until the pellet is dissolved. Pipette the buffer w/ dissolved pellets into 3rd eppe. Pipette up and down until the pellet is dissolved. Eppe’s 1 & 2 should be empty. Discard. Add 200µL P2 by shooting in. Add to all of your tubes quickly. Snap all closed. Inversion mix. Leave tubes with only P1 & P2 for no more than 5 minutes or DNA will be damaged. Be ready to add P3. Add 400µL P3 (refrigerated) Inversion mix until no pink remains. Let sit for 1-2 minutes Centrifuge full speed for 10 minutes. Setup plasmid filter columns over large Zymo collection tubes. Pipette supernatant into filter column. Discard pellet Spin column 1 minute. Discard flowthrough Add 200µL Endo Wash Buffer to filter Spin 1 minute Discard flowthrough Add 400µL Plasmid DNA Wash Buffer Spin 1 minute Discard flowthrough Spin 2 more minutes to dry (very important). Move filter to labeled 1.7 mL eppes Label Add 16µL 10mM Tris HCl pH 8.0 to filter column Let sit 2 minutes Spin 1 minute The flowthrough contains the DNA. Don’t throw it out. (Repeat) Add 16µL 10mM Tris HCl pH 8.0 to filter column Let sit 2 minutes Spin 1 minute The flowthrough contains the DNA. Don’t throw it out. Throw away filter. Keep flowthrough in labeled eppe. This protocol is from the HOP (Hallie’s operating procedures) binder.

6.6.16 60 µL of plasmid were removed from our stock and digested with SAL1 and CutSmart buffer.

6.7.16 We ran a gel purification of our cut plasmid, stained and imaged it on the third floor. File name: limonene plasmid 1 2016-06-07 George cut our plasmid out of the gel (the largest band on the gel). Our cut gel weighed 0.48g We then used a kit to dissolve the gel and purify the plasmid. Fluorimetry showed the concentration to be 220 ng/µL

6.8.16 first try at Infusion cloning. 35 µL Stellar E.coli and 2.5 µL of post infusion pLC71 Cells plated and left to incubate around noon. gene block: 100ng (μL/25ng) = 4μL pLC71: 100 ng (μL/220ng) = 0.45μL In-Fusion pre-mix: 2μL Distilled water: 3.55μL 50°C for 15 minutes

6.9.16 Took transformed cells out of 4th floor incubator at 11:00 AM. No growth on either plate. Re-transforming with the same infusion mix that we made yesterday Stellar cells - 1501846A Cell & DNA mixed at 12:08 The cells were kept on an ice/water miss the whole time. The tubes where cells & DNA were mixed were also on ice before the mix. The infusion mix was stored in the eppe block for about 5 minutes. LB/amp plates by RZ 5/20/16 Heat shock at 12:34 at 44 celsius for 45s then directly back on ice. Plated at 12:40 Incubate 4th floor 49°C at 12:47

6.10.16 Took stellar cells transformed w/ infusion mix out of the incubator at 11:40 No growth, only bubbles. Second try at infusion mix Everything on ice for 10 minutes Diluted plasmid w/ distilled water from sink. 0.9uL 220ng/uL + 1.1uL dH2O Transformation: E. Coli was pulled out of the freezer at 1:50. 1:55, infusion mix was put in heat block w/ water at 50°C Infusion mix was then put on ice and then mixed with E. Coli 2 minutes later. We also transformed the same cells with a control of cut pLC71 Incubate all 3 tubes on ice for 30 minutes Heat shock at 43°C for 45s Plated after a 5 minutes back on ice (2:45) LB/amp plates - AS 5/26/16 Incubated on 4th floor at 37°C overnight

6.11.16 No growth on any plates except for 2 colonies on the control (disgested pLC71)

6.20.16 Ordered primers from IDT IDT login to view spec sheet Username: csu igem synbio2016 LS P1 This primer will anneal to the 1st gBlock. Should work for both genes. Sequence: 5’- ATGCGCGTTGCGGCAGTCGACCGGCAAAAGG-3’ ( GC%= 64.5%, Tm=77.8°C, length:31 bp) LS P2 This primer will anneal to the 2nd gBlock. Should work for both genes. Sequence: 5’- GATTTTTTTTGTCGACTTTTTTGCGGCCGCT -3’ 3’- AGCGGCCGCAAAAAAGTCGACAAAAAAAATC-5’(GC%=41.9%, Tm=70.2°C, length:31bp) (GC%=65.5%, Tm=73.8°C, length: 29 bp)

6.21.16 Resuspending primers Gloves Uncap LS p1, p1000 to add 292 μL distilled autoclaved H2O from Hallies lab. A little bit of water would fall out of the pipet tip. Tip was not full. Still, only a very small amount missing. Recap.