(Prototype team page) |
|||
Line 1: | Line 1: | ||
{{Oxford}} | {{Oxford}} | ||
<html> | <html> | ||
− | + | <style> | |
− | + | hr { | |
− | < | + | display: block; |
− | < | + | height: 1px; |
− | < | + | border: 0; |
− | < | + | border-top: 1px solid black; |
− | </ | + | margin: 1em 0; |
− | <div class=" | + | padding: 0; |
− | + | } | |
− | + | </style> | |
− | < | + | <head> |
− | < | + | <meta charset = "utf-8"> |
− | < | + | <title>jQuery UI Autocomplete functionality</title> |
− | < | + | <link href = "https://code.jquery.com/ui/1.10.4/themes/ui-lightness/jquery-ui.css" rel = "stylesheet"> |
− | + | <script src = "https://code.jquery.com/jquery-1.10.2.js"></script> | |
− | + | <script src = "https://code.jquery.com/ui/1.10.4/jquery-ui.js"></script> | |
− | < | + | <script> |
− | + | $( function() { | |
− | < | + | var suggestions = [ |
− | + | ||
− | </ | + | { |
− | + | label:"Congenital Chagas disease", | |
− | + | value:"item1", | |
− | </ | + | }, |
− | + | { | |
− | < | + | label:"Trypanosoma Cruzi", |
− | < | + | value:"item1", |
− | < | + | }, |
− | + | { | |
− | </ | + | label:"Cruzipain", |
− | < | + | value:"item1", |
− | < | + | }, |
− | < | + | { |
− | < | + | label:"Sepsis", |
− | < | + | value:"item2", |
− | </ | + | }, |
− | + | { | |
+ | label:"Pseudomonas aeruginosa", | ||
+ | value:"item2", | ||
+ | }, | ||
+ | { | ||
+ | label:"LasA", | ||
+ | value:"item2", | ||
+ | }, | ||
+ | { | ||
+ | label:"African Sleeping sickness", | ||
+ | value:"item3", | ||
+ | }, | ||
+ | { | ||
+ | label:"Trypanosoma brucei", | ||
+ | value:"item3", | ||
+ | }, | ||
+ | { | ||
+ | label:"Rhodesain", | ||
+ | value:"item3", | ||
+ | }, | ||
+ | { | ||
+ | label:"Brucepain", | ||
+ | value:"item3", | ||
+ | }, | ||
+ | { | ||
+ | label:"Schistosomiasis", | ||
+ | value:"item4", | ||
+ | }, | ||
+ | { | ||
+ | label:"Schistosoma mansoni", | ||
+ | value:"item4", | ||
+ | }, | ||
+ | { | ||
+ | label:"Cercarial elastase", | ||
+ | value:"item4", | ||
+ | }, | ||
+ | { | ||
+ | label:"Congenital toxoplasmosis", | ||
+ | value:"item5", | ||
+ | }, | ||
+ | { | ||
+ | label:"Toxoplasma gondii", | ||
+ | value:"item5", | ||
+ | }, | ||
+ | { | ||
+ | label:"Cathepsin L", | ||
+ | value:"item5", | ||
+ | } | ||
+ | ]; | ||
+ | $("#myInput" ).autocomplete({ | ||
+ | source: function( request, response ) { // function to start the terms with the letter typed. If need wildcard anywhere, use the suggestions directly. | ||
+ | var matcher = new RegExp( "^" + $.ui.autocomplete.escapeRegex( request.term ), "i" ); | ||
+ | response( $.grep(suggestions, function( item ){ | ||
+ | return matcher.test( item.label ); | ||
+ | }) ); | ||
+ | }, | ||
+ | minLength: 1, // requires that the user enters at least one character | ||
+ | select: function( event, ui ) { // Once the term is selected from the list | ||
+ | $("tr[class^='item']").hide(); // hide all rows with class name starts with "item" | ||
+ | $("#myInput").val( ui.item.label ); // populate the selected term in the input box | ||
+ | |||
+ | $("#id_tbl tr.item0").show(); // show the header row and the selected item value. | ||
+ | $("#id_tbl tr."+ui.item.value).show(); | ||
+ | return false; | ||
+ | } | ||
+ | }); | ||
+ | } ); | ||
+ | </script> | ||
+ | </head> | ||
+ | <body> | ||
+ | <div class="container"> | ||
+ | <div style="margin-top: 100px"></div> | ||
+ | <h1 class="text-center">Software Tool</h1> | ||
+ | <input type="text" id="myInput" placeholder="Search"> | ||
+ | <table id="id_tbl" class="table table-hover"> | ||
+ | <thead> | ||
+ | <tr class="item0" style="display:none"> | ||
+ | <th width="8%" align="left">Disease</th> | ||
+ | <th width="8%" align="left">Parasite</th> | ||
+ | <th width="8%" align="left">Specific Protease</th> | ||
+ | <th width="16%" align="left">DNA Sequence of Cleavage Site</th> | ||
+ | <th width="20%" align="left">Protease Cleavage Sequence</th> | ||
+ | <th width="8%" align="left">Medium of Test</th> | ||
+ | <th width="8%" align="left">Final Output</th> | ||
+ | <th width="8%" align="left">Positive Result</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr class="item1" style="display:none"> | ||
+ | <td><span>Congenital Chagas Disease</span></td> | ||
+ | <td><span><i>Trypanosoma Cruzi</i></span></td> | ||
+ | <td><span>Cruzipain</span></td> | ||
+ | <td><span>AAAAAAGTTAAAGCTAAAAAA</span></td> | ||
+ | <td><span>K/K/L/KR-A/KS/K/RQ</span></td> | ||
+ | <td><span>Blood</span></td> | ||
+ | <td><span>Hirudin</span></td> | ||
+ | <td><span>No blood clotting</span></td> | ||
+ | </tr> | ||
+ | <tr class="item2" style="display:none"> | ||
+ | <td><span>Sepsis</span></td> | ||
+ | <td><span><i>Pseudomonas aeruginosa</i></span></td> | ||
+ | <td><span>LasA</span></td> | ||
+ | <td><span></span></td> | ||
+ | <td><span>After Gly-Gly (e.g. PGVGG - elastin) or between Lys-Ile (e.g. NKKIEKFQ(S-P) - beta=casein)</span></td> | ||
+ | <td><span>Blood</span></td> | ||
+ | <td><span>Hirudin</span></td> | ||
+ | <td><span>No blood clotting</span></td> | ||
+ | </tr> | ||
+ | <tr class="item3" style="display:none"> | ||
+ | <td><span>African Sleeping sickness</span></td> | ||
+ | <td><span><i>Trypanosoma brucei</i></span></td> | ||
+ | <td><span>Rhodesain/Brucepain</span></td> | ||
+ | <td><span>TCCGCGCCGAAATCCCTGATTGGC/ TCCGCGCCGCGTTCCCTGATTGGC</span></td> | ||
+ | <td><span>S/A/P/R-K/S/L/I/G</span></td> | ||
+ | <td><span>Blood</span></td> | ||
+ | <td><span>Hirudin</span></td> | ||
+ | <td><span>No blood clotting</span></td> | ||
+ | </tr> | ||
+ | <tr class="item4" style="display:none"> | ||
+ | <td><span>Schistosomiasis</span></td> | ||
+ | <td><span><i>Schistosoma mansoni</i></span></td> | ||
+ | <td><span>Cercarial elastase</span></td> | ||
+ | <td><span>AGCTGGCCGCTG</span></td> | ||
+ | <td><span>SWPL</span></td> | ||
+ | <td><span>Blood</span></td> | ||
+ | <td><span>Hirudin</span></td> | ||
+ | <td><span>No blood clotting</span></td> | ||
+ | </tr> | ||
+ | <tr class="item5" style="display:none"> | ||
+ | <td><span>Congenital toxoplasmosis</span></td> | ||
+ | <td><span><i>Toxoplasma gondii</i></span></td> | ||
+ | <td><span>Cathepsin L</span></td> | ||
+ | <td><span></span></td> | ||
+ | <td><span>KQKLR</span></td> | ||
+ | <td><span>Amniotic fluid</span></td> | ||
+ | <td><span></span></td> | ||
+ | <td><span></span></td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
</div> | </div> | ||
+ | </body> | ||
</html> | </html> |
Revision as of 05:59, 31 October 2017