Difference between revisions of "Team:Tel-Hai/Notebook"

Line 48: Line 48:
 
<li>
 
<li>
 
<p class="c-blue">T--Tel-Hai--dana-in-the-labTransformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.</p>
 
<p class="c-blue">T--Tel-Hai--dana-in-the-labTransformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.</p>
 +
<p>
 +
<img src="" alt="">
 +
<small>Fig.2- Plasmid map of pRS306 / pRS316 – with enzymes sites.</small>
 +
</p>
 
</li>
 
</li>
 
</ul>
 
</ul>
 +
</li>
 +
<li>
 +
<p class="c-orange">A new sample of Brett was tested:</p>
 +
</li>
 +
<li>
 +
<p class="c-orange">Sample was sawn on YEPD selective Brett plates for colony isolation.</p>
 +
<p>
 +
<img src="" alt="">
 +
<small>Fig.3-Brett colonies, YEPD plates. The colonies grew over 3 days at 30℃</small>
 +
</p>
 +
</li>
 +
<li>
 +
<p class="c-orange">Isolated colonies were analyzed by PCR with specific primers for Brett strains - PB2, RUX, DB, and NLS.</p>
 +
<small class="text-center">Table 1 - Brett primers, designed in Prof. Martin Goldway lab</small>
 +
<table>
 +
<thead>
 +
<tr>
 +
<th>Primer name</th>
 +
<th>Sequence</th>
 +
<th>Product size</th>
 +
<th>Detection target</th>
 +
</tr>
 +
</thead>
 +
<tbody>
 +
<tr>
 +
<td>Rux (specific for Brett)</td>
 +
<td>DBRUX F: ggatgggtgcacctggtttacac<br>DBRUX R: GAAGGGCCACATTCACGAACCCC</td>
 +
<td>96 bp</td>
 +
<td>28S rRNA</td>
 +
</tr>
 +
<tr>
 +
<td>DB  (specific for Brett)</td>
 +
<td>DB394 R: acgaggaacgggc<br>DB90 F: actagagagaggag</td>
 +
<td>300 bp</td>
 +
<td>28S rRNA</td>
 +
</tr>
 +
<tr>
 +
<td>PB2 (specific for Brett)</td>
 +
<td>PB2: AGAGTGAGGGGATAATGA<br>ITS 4B: tcctccgcttattgatatgc</td>
 +
<td>132 bp</td>
 +
<td>28S rRNA</td>
 +
</tr>
 +
<tr>
 +
<td>NLS (universal)</td>
 +
<td>NL1: GCCATATCAATAAGCGGAGGAAA<br>LS2: attcccaaacaatcaactcgactc</td>
 +
<td>250 bp</td>
 +
<td>large subunit ribosomal RNA gene</td>
 +
</tr>
 +
</tbody>
 +
</table>
 
</li>
 
</li>
 
</ul>
 
</ul>
 +
<h4>10.9.17</h4>
 
</div>
 
</div>
 
</div>
 
</div>
 
</html>
 
</html>
 
{{Tel-Hai/footer}}
 
{{Tel-Hai/footer}}

Revision as of 15:22, 31 October 2017

Notebook & Result

Red - working on RF cloning

Green - working on new genes

Blue - working on yeast cells

Orange - working on Brett

Purple - working on improve BioBrick

27.8.17

  • S.cerevisiae 3095 with URA- mutation were obtained from Dr. Itay Onn (faculty of medicine of Bar Ilan University) and were isolated from YEPD plates.

  • Isolation streak of Brett on selection medium- specific YEPD media.

29.8.17

  • Colonies from Brett isolation appeared.

  • Colonies that appeared were tested using PCR with specific primers (from Prof. Martin Goldway lab) for Brett detection- PB2, RUX, DB, and NLS. We got negative results- no PCR product.

    dana in the lab Fig.1- Dana having fun with Brett colonies in the lab

30.8.17

  • We got pRS306/316 from Dr. Itay Onn.

  • Transformation into TOP-10 competent cells:

    • Preparation of competent TOP10 e.coli bacteria for heat-shock transformation (we used this protocol – לתת לינק לדף פרוטוקול מספר 9)

    • T--Tel-Hai--dana-in-the-labTransformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.

      Fig.2- Plasmid map of pRS306 / pRS316 – with enzymes sites.

  • A new sample of Brett was tested:

  • Sample was sawn on YEPD selective Brett plates for colony isolation.

    Fig.3-Brett colonies, YEPD plates. The colonies grew over 3 days at 30℃

  • Isolated colonies were analyzed by PCR with specific primers for Brett strains - PB2, RUX, DB, and NLS.

    Table 1 - Brett primers, designed in Prof. Martin Goldway lab
    Primer name Sequence Product size Detection target
    Rux (specific for Brett) DBRUX F: ggatgggtgcacctggtttacac
    DBRUX R: GAAGGGCCACATTCACGAACCCC    		 96 bp 28S rRNA
    DB (specific for Brett) DB394 R: acgaggaacgggc
    DB90 F: actagagagaggag    		 300 bp 28S rRNA
    PB2 (specific for Brett) PB2: AGAGTGAGGGGATAATGA
    ITS 4B: tcctccgcttattgatatgc    		 132 bp 28S rRNA
    NLS (universal) NL1: GCCATATCAATAAGCGGAGGAAA
    LS2: attcccaaacaatcaactcgactc    		 250 bp large subunit ribosomal RNA gene

10.9.17

Tel-Hai