Red - working on RF cloning
Green - working on new genes
Blue - working on yeast cells
Orange - working on Brett
Purple - working on improve BioBrick
27.8.17
-
S.cerevisiae 3095 with URA- mutation were obtained from Dr. Itay Onn (faculty of medicine of Bar Ilan University) and were isolated from YEPD plates.
-
Isolation streak of Brett on selection medium- specific YEPD media.
29.8.17
-
Colonies from Brett isolation appeared.
-
Colonies that appeared were tested using PCR with specific primers (from Prof. Martin Goldway lab) for Brett detection- PB2, RUX, DB, and NLS. We got negative results- no PCR product.
Fig.1- Dana having fun with Brett colonies in the lab
30.8.17
-
We got pRS306/316 from Dr. Itay Onn.
-
Transformation into TOP-10 competent cells:
-
Preparation of competent TOP10 e.coli bacteria for heat-shock transformation (we used this protocol – לתת לינק לדף פרוטוקול מספר 9)
-
T--Tel-Hai--dana-in-the-labTransformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.
Fig.2- Plasmid map of pRS306 / pRS316 – with enzymes sites.
-
-
A new sample of Brett was tested:
-
Sample was sawn on YEPD selective Brett plates for colony isolation.
Fig.3-Brett colonies, YEPD plates. The colonies grew over 3 days at 30℃
-
Isolated colonies were analyzed by PCR with specific primers for Brett strains - PB2, RUX, DB, and NLS.
Table 1 - Brett primers, designed in Prof. Martin Goldway labPrimer name Sequence Product size Detection target Rux (specific for Brett) DBRUX F: ggatgggtgcacctggtttacac
DBRUX R: GAAGGGCCACATTCACGAACCCC96 bp 28S rRNA DB (specific for Brett) DB394 R: acgaggaacgggc
DB90 F: actagagagaggag300 bp 28S rRNA PB2 (specific for Brett) PB2: AGAGTGAGGGGATAATGA
ITS 4B: tcctccgcttattgatatgc132 bp 28S rRNA NLS (universal) NL1: GCCATATCAATAAGCGGAGGAAA
LS2: attcccaaacaatcaactcgactc250 bp large subunit ribosomal RNA gene