Difference between revisions of "Team:Tel-Hai/Notebook"

Line 49: Line 49:
 
<p class="c-blue">T--Tel-Hai--dana-in-the-labTransformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.</p>
 
<p class="c-blue">T--Tel-Hai--dana-in-the-labTransformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.</p>
 
<p>
 
<p>
<img src="" alt="">
+
<img src="https://static.igem.org/mediawiki/2017/6/65/T--Tel-Hai--Fig2.JPG" alt="Plasmid map of pRS306 / pRS316 – with enzymes sites">
<small>Fig.2- Plasmid map of pRS306 / pRS316 – with enzymes sites.</small>
+
<small>Fig.2 - Plasmid map of pRS306 / pRS316 – with enzymes sites.</small>
 
</p>
 
</p>
 
</li>
 
</li>
Line 61: Line 61:
 
<p class="c-orange">Sample was sawn on YEPD selective Brett plates for colony isolation.</p>
 
<p class="c-orange">Sample was sawn on YEPD selective Brett plates for colony isolation.</p>
 
<p>
 
<p>
<img src="" alt="">
+
<img src="https://static.igem.org/mediawiki/2017/6/60/T--Tel-Hai--Fig3.JPG" alt="Brett colonies, YEPD plates. The colonies grew over 3 days at 30 celsius">
<small>Fig.3-Brett colonies, YEPD plates. The colonies grew over 3 days at 30℃</small>
+
<small>Fig.3 - Brett colonies, YEPD plates. The colonies grew over 3 days at 30&#8451;</small>
 
</p>
 
</p>
 
</li>
 
</li>

Revision as of 15:29, 31 October 2017

Notebook & Result

Red - working on RF cloning

Green - working on new genes

Blue - working on yeast cells

Orange - working on Brett

Purple - working on improve BioBrick

27.8.17

  • S.cerevisiae 3095 with URA- mutation were obtained from Dr. Itay Onn (faculty of medicine of Bar Ilan University) and were isolated from YEPD plates.

  • Isolation streak of Brett on selection medium- specific YEPD media.

29.8.17

  • Colonies from Brett isolation appeared.

  • Colonies that appeared were tested using PCR with specific primers (from Prof. Martin Goldway lab) for Brett detection- PB2, RUX, DB, and NLS. We got negative results- no PCR product.

    dana in the lab Fig.1- Dana having fun with Brett colonies in the lab

30.8.17

  • We got pRS306/316 from Dr. Itay Onn.

  • Transformation into TOP-10 competent cells:

    • Preparation of competent TOP10 e.coli bacteria for heat-shock transformation (we used this protocol – לתת לינק לדף פרוטוקול מספר 9)

    • T--Tel-Hai--dana-in-the-labTransformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.

      Plasmid map of pRS306 / pRS316 – with enzymes sites Fig.2 - Plasmid map of pRS306 / pRS316 – with enzymes sites.

  • A new sample of Brett was tested:

  • Sample was sawn on YEPD selective Brett plates for colony isolation.

    Brett colonies, YEPD plates. The colonies grew over 3 days at 30 celsius Fig.3 - Brett colonies, YEPD plates. The colonies grew over 3 days at 30℃

  • Isolated colonies were analyzed by PCR with specific primers for Brett strains - PB2, RUX, DB, and NLS.

    Table 1 - Brett primers, designed in Prof. Martin Goldway lab
    Primer name Sequence Product size Detection target
    Rux (specific for Brett) DBRUX F: ggatgggtgcacctggtttacac
    DBRUX R: GAAGGGCCACATTCACGAACCCC
    96 bp 28S rRNA
    DB (specific for Brett) DB394 R: acgaggaacgggc
    DB90 F: actagagagaggag
    300 bp 28S rRNA
    PB2 (specific for Brett) PB2: AGAGTGAGGGGATAATGA
    ITS 4B: tcctccgcttattgatatgc
    132 bp 28S rRNA
    NLS (universal) NL1: GCCATATCAATAAGCGGAGGAAA
    LS2: attcccaaacaatcaactcgactc
    250 bp large subunit ribosomal RNA gene

10.9.17