Red - working on RF cloning
Green - working on new genes
Blue - working on yeast cells
Orange - working on Brett
Purple - working on improve BioBrick
27.8.17
-
S.cerevisiae 3095 with URA- mutation were obtained from Dr. Itay Onn (faculty of medicine of Bar Ilan University) and were isolated from YEPD plates.
-
Isolation streak of Brett on selection medium- specific YEPD media.
29.8.17
-
Colonies from Brett isolation appeared.
-
Colonies that appeared were tested using PCR with specific primers (from Prof. Martin Goldway lab) for Brett detection- PB2, RUX, DB, and NLS. We got negative results- no PCR product.
Fig.1- Dana having fun with Brett colonies in the lab
30.8.17
-
We got pRS306/316 from Dr. Itay Onn.
-
Transformation into TOP-10 competent cells:
-
Preparation of competent TOP10 e.coli bacteria for heat-shock transformation (we used this protocol)
-
Transformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.
Fig.2 - Plasmid map of pRS306 / pRS316 – with enzymes sites.
-
-
A new sample of Brett was tested:
-
Sample was sawn on YEPD selective Brett plates for colony isolation.
Fig.3 - Brett colonies, YEPD plates. The colonies grew over 3 days at 30℃
-
Isolated colonies were analyzed by PCR with specific primers for Brett strains - PB2, RUX, DB, and NLS.
Table 1 - Brett primers, designed in Prof. Martin Goldway labPrimer name Sequence Product size Detection target Rux (specific for Brett) DBRUX F: ggatgggtgcacctggtttacac
DBRUX R: GAAGGGCCACATTCACGAACCCC96 bp 28S rRNA DB (specific for Brett) DB394 R: acgaggaacgggc
DB90 F: actagagagaggag300 bp 28S rRNA PB2 (specific for Brett) PB2: AGAGTGAGGGGATAATGA
ITS 4B: tcctccgcttattgatatgc132 bp 28S rRNA NLS (universal) NL1: GCCATATCAATAAGCGGAGGAAA
LS2: attcccaaacaatcaactcgactc250 bp large subunit ribosomal RNA gene
4.9.17
-
Further examination of Brett's presence - a positive result in the gel
Fig.4- 2% Gel electrophoresis, colony PCR with primers for Brett (NLS, PB2, DB, RUX). For the Brett the band is as expected. For negative control, we used S.Cerevisae, and no band appeared.
It indicates that the primers work as planned and do not respond to non-Brett strains -
Preparation of starter and streaking for Brett, for future work
5.9.17
-
Isolation streak of Brett on liquid YEPD media, temperature 37℃ and 30 ℃. (30℃ showed better growth with more colonies).
6.9.17
-
Miniprep for pRS306 + pRS316 continued by restriction digestion with NsiI and BamHI enzymes- to verify the plasmid. As seen in fig.5, after digestion we received 3.5 kb band and 0.8 kb band in uc and the c lanes, respectively.
Fig.5- 1% Gel electrophoresis. M1- GeneRuler 1 kb plus (Thermo Fisher), M2- GeneRuler 100 bp plus (Thermo Fisher). UC- uncut plasmid, C- cut plasmid with NsiI and BamHI.
-
Preparation of starter and streaking for Brett, for future work
10.9.17
-
Preparation of liquid LB, preparation of LB agar plates + AMP
-
New genes received from IDT: KP6, STS, 4CL, TAL, Miraculin. We started RF cloning.
12.9.17
-
Continued RF cloning protocol. PCR product stroke at LB-AMP plates, O/N growth.
13.9.17
-
Colonies appeared, we did DNA extraction and purification, and checked them with restriction enzymes. Negative results- no band appeared.
14.9.17
-
Preparation of additional series DPNL from RF products, electroporation transformation and streaking to LB + AMP media. O/N