Difference between revisions of "Template:Team:Utrecht/MainBody"

<li>PCR was performed using the following plasmid and primers, to create a fragment containing Cpf1 with a C-terminal Histag and overlap region for the final backbone plasmid.<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Plasmid: Lenti-AsCpf1-Blast (from Addgene, nr: 84750)<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Fw primer 5’-3’: TCATCGAGGAGGACAAGGCCC<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rv primer 5’-3’: GCCGCTTACTTGTACTTAATGATGATGATGATGATGGCCG CCGCCGTTGCGCAGCTCCTGGATGTAG<br>

Protocol: <a target=_BLANK href="" class="pdf"></a> Experimental\Protocols\Wiki ready\Cpf1 PCR protocol.pdf

<li>gBlock containing a kozak sequence, signal sequence and overlap regions with the backbone and Cpf1 was ordered from IDT. See snapgene file below for sequence</li>

<li>In-Fusion Cloning was then performed using AgeI and BsrGI to linearize the backbone plasmid and the two previously created fragments.<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Plasmid: pCAGGS_eGFP

<li>PCR was performed using the following plasmid and primers, to create a fragment containing Cas9 with a C-terminal Histag and overlap region for the final backbone plasmid.<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Plasmid: Lenti-Cas9-Blast (from Addgene, nr: 52962)<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Fw primer 5’-3’: ATTCAAGGTGCTGGGCAACAC<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rv primer 5’-3’: GCCGCTTACTTGTACTTAATGATGATGATGATGATGGCCG CCGCCGTCGCCTCCCAGCTGAGACA<br>

<li>PCR was performed to create a second fragment containing a kozak region, the signal sequence and the first part of Cas9 (without its methionine).<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Plasmid: Lenti-Cas9-Blast (from Addgene)<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Fw primer 5’-3’: CCCGGGATCCACCGGTGCCGCCACCATGGCGTGG ACCAGCCTGATTCTGAGCCTGCTGGCGCTGTGCAGCGGCGCGAGCAGCG ACAAGAAGTACAGCATCGGCCTG<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rv primer 5’-3’: CCCAGCACCTTGAATTTCTTGCTG<br>

<li>In-Fusion Cloning was then performed using AgeI and BsrGI to linearize the backbone plasmid and the two previously created fragments.<br>

&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Plasmid: pCAGGS_eGFP<br>

HEK293t cells were cultured according to cell culture protocol [Experimental\Protocols\Wiki ready\Cell culture protocol.pdf]. We transfected the cells with the midiprepped plasmids according to the Lipofectamine 2000 transfection protocol [Experimental\Protocols\Wiki ready\Lipofectamine 2000 transfection protocol.pdf].  

Secreted and His-tagged Cas9 and Cpf1, which will be referred to as sCas9 and sCpf1, respectively, were purified from the medium using Ni-bead purification, according to protocol [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\Purification of cells and medium secreted cpf1 and cas9.pdf]. Also, whole-cell lysates were made, following the same protocol, to check for possible accumulation of sCas9 or sCpf1 in HEK293t cells.

The presence of sCas9 and sCpf1 was verified using SDS-PAGE and Western Blots. Proteins were separated using SDS-PAGE using the following protocol [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\General Protocol_ SDS-PAGE & Western Blot.pdf].  

10% acrylamide running gels, and stacking gels were made according to the following protocol [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\Preparing SDS-PAGE gels.pdf]. Western Blots were carried out according to the same protocol as for the SDS-PAGE.  

The secreted proteins were incubated with mouse anti-His6x (using dilutions of 1:2000 and 1:5000) and rabbit anti-Cas9 or rabbit anti-Cpf1 (using dilutions of 1:2000). The secondary antibody wa      s a goat anti-mouse for the Histag and goat anti-rabbit for both Cas9 and Cpf1, with a horseradish peroxidase (HRP) conjugate to verify the presence of secreted proteins.  

Proteins were purified using Ni-NTA superflow columns, according to the following protocol   [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\Ni-NTA superflow colums protocol]. No imidazole in the pre- and washing buffers was used. Additionally, 50 ul samples were taken of the pellet, supernatant, filtered supernatant, and the runthrough.

Whole cell lysates were made using protocol [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\Purification of cells and medium secreted cpf1 and cas9.pdf] to check for possible accumulation of sCas9 or sCpf1 in Hek293t cells.  

After successful purification of sCas9-His6x and sCpf1-His6x and subsequent verification of the presence of the aforementioned proteins, an in vitro endonuclease activity assay was carried out. The in vitro endonuclease activity assay was used to assess whether or not our secreted and, in all likelihood, glycosylated sCas9-His6x and sCpf1-His6x would still exhibit sgRNA-binding- and endonuclease activity. The assay was executed according to the protocol [Google Drive\iGEM 2017\Experimental\Protocols\Wiki ready\Nuclease activity assay.pdf]. Linearized plasmid 51-dPAM (823 bp) [Google Drive\iGEM 2017\Experimental\SnapGene\Secreted Cas  or Cpf\Endonuclease Activity Assay\1_8_2017\51_dPAM 800bp.dna] was used as the target for sCas9-His6x and His6x-Cpf1. Two sgRNAs were used that were tailored to be bound by either Cas9 or Cpf1: [iGEM 2017\Experimental\SnapGene\Secreted Cas  or Cpf\Endonuclease Activity Assay\SpCas9_gRNA1_Tet-luc.dna] and [iGEM 2017\Experimental\SnapGene\Secreted Cas  or Cpf\Endonuclease Activity Assay\AsCpf1_sgRNA.dna] , respectively. Both sgRNAs were complementary to roughly the same region of the aforementioned linearized plasmid, which would result in two cut fragments of ~260 bp and ~560 bp for both His6x-Cas9 and His6x-Cpf1. The efficacy of these sgRNAs, both in binding to the target region in the linearized plasmid, and binding to either Cas9 or Cpf1 were also assessed. As positive controls we used unmodified Cas9 and Cpf1 produced by Escherichia coli, coupled with their respective sgRNAs and the linearized target plasmid. The negative controls consisted of the linearized plasmid with either Cas9 or Cpf1 without sgRNA, and a third negative control with the linearized plasmid only. Subsequently, the samples were separated by DNA gel  

dCAS9 D10A rv 5’-3’: cagagttggtgccgattgccaggccgatgctgta

dCAs9 H840A rv 5’-3’: gctctgaggcacgatagcgtccacatcgtagtcg

dCpf1 D908A fw 5’-3’: ctatcatcggcatcgctcggggcgagagaaa

dCpf1 D908A rv 5’-3’: tttctctcgccccgagcgatgccgatgatag

.pdf { display: inline-block; width: 24px; height: 24px; background: url(https://static.igem.org/mediawiki/2017/6/6a/Uupdf.png) no-repeat; vertical-align: bottom; }

.timeline a:hover, a:active, a:focus {