Red - working on RF cloning
Green - working on new genes
Blue - working on yeast cells
Orange - working on Brett
Purple - working on improve BioBrick
27.8.17
-
S.cerevisiae 3095 with URA- mutation were obtained from Dr. Itay Onn (faculty of medicine of Bar Ilan University) and were isolated from YEPD plates.
-
Isolation streak of Brett on selection medium- specific YEPD media.
29.8.17
-
Colonies from Brett isolation appeared.
-
Colonies that appeared were tested using PCR with specific primers (from Prof. Martin Goldway lab) for Brett detection- PB2, RUX, DB, and NLS. We got negative results- no PCR product.
Fig.1- Dana having fun with Brett colonies in the lab
30.8.17
-
We got pRS306/316 from Dr. Itay Onn.
-
Transformation into TOP-10 competent cells:
-
Preparation of competent TOP10 e.coli bacteria for heat-shock transformation (we used this protocol)
-
Transformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.
Fig.2 - Plasmid map of pRS306 / pRS316 – with enzymes sites.
-
-
A new sample of Brett was tested:
-
Sample was sawn on YEPD selective Brett plates for colony isolation.
>
Fig.3 - Brett colonies, YEPD plates. The colonies grew over 3 days at 30℃Isolated colonies were analyzed by PCR with specific primers for Brett strains - PB2, RUX, DB, and NLS.
Table 1 - Brett primers, designed in Prof. Martin Goldway labPrimer name Sequence Product size Detection target Rux (specific for Brett) DBRUX F: ggatgggtgcacctggtttacac
DBRUX R: GAAGGGCCACATTCACGAACCCC96 bp 28S rRNA DB (specific for Brett) DB394 R: acgaggaacgggc
DB90 F: actagagagaggag300 bp 28S rRNA PB2 (specific for Brett) PB2: AGAGTGAGGGGATAATGA
ITS 4B: tcctccgcttattgatatgc132 bp 28S rRNA NLS (universal) NL1: GCCATATCAATAAGCGGAGGAAA
LS2: attcccaaacaatcaactcgactc250 bp large subunit ribosomal RNA gene 4.9.17
-
Further examination of Brett's presence - a positive result in the gel
Fig.4- 2% Gel electrophoresis, colony PCR with primers for Brett (NLS, PB2, DB, RUX). For the Brett the band is as expected. For negative control, we used S.Cerevisae, and no band appeared.
It indicates that the primers work as planned and do not respond to non-Brett strains -
Preparation of starter and streaking for Brett, for future work
5.9.17
-
Isolation streak of Brett on liquid YEPD media, temperature 37℃ and 30 ℃. (30℃ showed better growth with more colonies).
6.9.17
-
Miniprep for pRS306 + pRS316 continued by restriction digestion with NsiI and BamHI enzymes- to verify the plasmid. As seen in fig.5, after digestion we received 3.5 kb band and 0.8 kb band in uc and the c lanes, respectively.
Fig.5- 1% Gel electrophoresis. M1- GeneRuler 1 kb plus (Thermo Fisher), M2- GeneRuler 100 bp plus (Thermo Fisher). UC- uncut plasmid, C- cut plasmid with NsiI and BamHI. -
Preparation of starter and streaking for Brett, for future work
10.9.17
-
Preparation of liquid LB, preparation of LB agar plates + AMP
-
New genes received from IDT: KP6, STS, 4CL, TAL, Miraculin. We started RF cloning.
12.9.17
-
Continued RF cloning protocol. PCR product stroke at LB-AMP plates, O/N growth.
13.9.17
-
Colonies appeared, we did DNA extraction and purification, and checked them with restriction enzymes. Negative results- no band appeared.
14.9.17
-
Preparation of additional series DPNL from RF products, electroporation transformation and streaking to LB + AMP media. O/N
27.9.17
-
Promoters received from IDT- TDH3, PGK1 and HXT7. We did the RF-cloning protocol.
-
BBa_K1033121 received from iGEM, we transformed the plasmid into TOP-10 bacteria.
28.9.17
-
Improvement of existing part – after we got the miracullin gene and isolated it from the pSB1C3 plasmid we wanted to add our HXT7poromoter (induced by low glucose levels). We designed primers for this procedure, as you can see here
-
PCR for HXT7 promoter, electrophoresis and gel extraction.
-
PCR for miracullin and gel, electrophoresis and gel extraction
As we can see in Fig.7, we got the PCR product as expected. We save the products for ligation
Fig 6- agarose gel 1%, PCR products and gel extraction. 1 – PCR products, 2- Extraction from gel, 3- product after clean-up.
-
1.10.17
-
Colonies from RF cloning appeared (from 27.9.17). Negative results. Start again with all the genes and promoters.
-
New genes was ordered from IDT
-
Continue working on improving the biobrick. We took the products (HXT7+ Miraculin, from 28.9.17) and ligate O/N (first ligation- between promoter and gene).
2.10.17
-
Ligation products HXT7+Miraculin tested at agarose gel. As seem in Fig 8- ligation succeed, new band around 1300. Products transformed to TOP-10 bacteria.
Fig 7- ligation results, agarose gel 1%. Only 3+4 wells seems positive.
8.10.17
-
New construct (HXT7+Miraculin) ligated to pSB1C3 + pRS306, and transformed.
-
RF cloning failed again. We decided to stop working with this method.
9.10.17
-
No colonies detected from HXT7_MIRACULIN +pSB1C3. We did the procedure again.
11-14.10.17- Succoth Holiday! (Jewish holiday)
16.10.17
-
New genes received from IDT: KP6_protox, KP6_beta. We made restriction digest with EcoRI and SpeI (for yeast plasmid pRS306/pRS316) enzymes, followed by ligation.
-
Heat shock transformation into TOP10 and isolation on LB+amp plate.
17.10.17
-
Colonies detected only from plasmid pRS306 and tested using PCR with specific primers that we designed (table 2) and ordered from Sigma-Aldrich. As seen in fig.8, after PCR reaction we received 210 bp band and 130 bp band in protox and the beta lanes, respectively. That was the expected outcome.
Table 2 - specific primers for the genesPrimer name Sequence Product size ADH1 – protox Protox_f- AGACCGAGACCCGTTATGTG
Protox_r- GTGGGTCTGGCTGACAATTT210 bp ADH_PK6_beta Beta_F- GCAGCATCGACAGCTTCATA
Beta_R- GTGGGTCTGGCTGACAGTTT130 bp 
Fig.8- 1.5% Gel electrophoresis, colony PCR with specific primers for protox and beta. Positive results are shown.
18.10.17
-
We checked the primers with empty plasmid, to verify that they indeed specific and that they don’t make false positive response. We ran the empty plasmid (with no insert) with protox primers, the empty plasmid with beta primers, positive plasmid with protox, and positive plasmid with beta.
Fig.9 – 1.5% gel electrophoresis, 1- pRS306 + primes for protox, 2- pRS306 + primers for beta, 3- pRS306 + Insert (protox) + primes protox, 4- pRS306 + Insert (Beta) + primers beta. We got positive results, the protox around 210 bp and the beta around 130 bp. The plasmid does not react with the primers. -
Miniprep for the colonies that appeared, continued by restriction digestion with EcoRI and SpeI enzymes
Fig. 10- 1% gel electrophoresis, negative results except sample number 8 (protox) that we see band around 2000 bp, as we expected.
19.10.17
-
New genes received from IDT: KP6_alpha, miraculin . We made restriction digest with EcoRI and SpeI enzymes, followed by ligation.
-
Heat shock transformation into TOP10 and isolation on LB+amp plate.
-
Colonies detected only from plasmid pRS306 and tested using PCR with specific primers that we designed and ordered (table 3) from Sigma-Aldrich. As seen in fig.11, after PCR reaction we received 153 bp band in KP6_alpha. With the miraculin, we got negative result.
Table 3 - specific primers for the genesPrimer name Sequence Product size ADH1 – alpha Alpha_f- ATGGGACAGGGAACGAGTTA
Alpha_r- GCTAAGAGAACGGCAAGACA153 bp Miraculin Mir_F- CTTGACATTGATGGCGAGAA
Mir_R- GGGTCTGTCGTGGTCAACTT148 bp 
Fig.11- 1.5% Gel electrophoresis, colony PCR with primers for alpha and miraculin. For positive control for each gene, we took the gene itself to see that the primers respond to the gene. For negative control, we took the empty plasmid and made the reaction with the primers. We got the band is as expect in alpha and negative result in miraculin.
20.10.17
Cloning genes into yeast plasmid
-
We numbered the beta and protox colonies in order to conduct specific and universal primer on all of them. In addition, we made restriction digestion with EcoRI and SpeI enzymes. In every test, protox sample number 3 appears to have a positive result and the rest is negative - we took this sample and inoculum into bacteria.
Fig.12- 1% gel electrophoresis. a: 1-5 pRS306+protox with specific primers, (-) negative control pRS306 with specific primers, (+) positive control is original gene with specific primers. 14-18 pRS306+protox with universal primers (M13 f + M13 R).
b: 8-12 pRS306+beta with specific primers, (-)negative control pRS306 with specific primers, (+) positive control is original gene with specific primers. 19-23 pRS306+beta with universal primers (M13).
c: 40-44 pRS306+protox cut with EcoRI and SpeI enzymes, 45-50 pRS306+beta cut with EcoRI and SpeI enzymes.
21.10.17
-
With the positive plasmid (pRS306 + protox), we did transformation into S.cerevisiae 3095 with URA- mutation and isolation on URA- plates, one plate for control with pRS316.
23.10.17
-
Yeast colonies appeared and tested by using PCR with universal primers (M13 F + M13 R). As seen in fig.13, after PCR reaction we received band around 2000 bp in plate number 1+2 with pRS306+KP6_protox. Just as we expected because the gene is 1900bp and the primers add another 100/200 bases.
Fig.13- 1% gel electrophoresis, M1- GeneRuler 1 kb plus (Thermo Fisher), 1- plate number one, 2- plate number 2, 3- plate number 3, 4- control with pRS316 (empty plasmid).
