Difference between revisions of "Team:CIEI-BJ/Results"

(Replaced content with "{{CIEI-BJ/nav}} <html> <div class="column full_size" > <h1>Data to be Filled</h1> </div> </html>")
Line 1: Line 1:
 
{{CIEI-BJ/nav}}
 
{{CIEI-BJ/nav}}
 
<html>
 
<html>
 +
<body>
 +
<div id="my-container">
 +
<div id="my-sidebar">
 +
<div class="sidebar__inner">
 +
<div class="side-top">
 +
<img src="https://static.igem.org/mediawiki/2017/8/88/T--CIEI-BJ--sidebar--top.jpg" alt="side_top">
 +
</div>
 +
<ul class="page-anchors">
 +
<li><a href="#a1"><i>PdGES</i></a>
 +
<ul>
 +
<li><a href="#a2">Optimization of PdGES</a>
 +
</li>
 +
<li><a href="#a3">Amplification of  <i> PdGES </i></a>
 +
</li>
 +
<li><a href="#a4">Construction of vectors</a>
 +
</li>
 +
</ul></li>
 +
<li><a href="#a5"><i> PcGES </i></a>
 +
<ul>
 +
<li><a href="#a6">Optimization of PcGES</a>
 +
</li>
 +
</ul></li>
 +
<li><a href="#a7">HbOYE</a>
 +
<ul>
 +
<li><a href="#a8">Sequence of HbOYE</a>
 +
</li>
 +
<li><a href="#a9">Amplification of HbOYE</a>
 +
</li>
 +
<li><a href="#a10">Ligation of HbOYE fragment to pET32a vector</a>
 +
</li>
 +
<li><a href="#a11">Ligation of <i>HbOYE</i> fragment to pPIC9K vector</a>
 +
</li>
 +
<li><a href="#a12">Ligation of HbOYE with 2A and GES to pPIC9K vector and pET32a vector</a>
 +
</li>
 +
</ul></li>
 +
<li><a href="#a13">ScOYE</a>
 +
<ul>
 +
<li><a href="#a14">nucleotide sequence of ScOYE</a>
 +
</li>
 +
<li><a href="#a15">Amplification of ScOYE</a>
 +
</li>
 +
<li><a href="#a16">Ligation of ScOYE in  <i> E.Coli </i></a>
 +
</li>
 +
<li><a href="#a17">Ligation of <i>ScOYE</i> in Yeast</a>
 +
</li>
 +
</ul>
 +
</ul>
 +
</div>
 +
</div>
 +
<div id="my-adjust-content">
 +
<div class="first-level" id="a1"  ><i>PdGES</i></div>
 +
<p class="my-content" >PdGES, Phyla dulcis geraniol synthase (GES), is an enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate(GPP)can be  produced by glucose. The function of <i>PdGES</i> is to convert GPP into geraniol. This enzyme is one of the essential proteins in our process, since it produces geraniol in the first place.</p>
 +
<div class="second-level" id="a2" >Optimization of PdGES</div>
 +
<div class="third-level" >The nucleotide sequence before optimization</div>
 +
<p class="my-content" ><b>(GenBank: GU136162.1)</b></p>
 +
<p class="my-content" >ATGGCGAGTGCAAGAAGCACCATATCTTTGTCCTCACAGTCATCTCATCATGGGTTCTCCAAAAACTCATTTCCATGGCAACTGAGGCATTCCCGCTTTGTTATGGGTTCTCGAGCACGTACCTGCGCATGCATGTCATCATCAGTATCACTGCCTACTGCAACGACGTCGTCCTCAGTCATTACAGGCAACGATGCCCTCCTCAAATACATACGTCAGCCTATGGTAATTCCTTTGAAAGAAAAGGAGGGCACGAAGAGACGAGAATATCTGCTGGAGAAAACTGCAAGGGAACTGCAGGGAACTACGGAGGCAGCGGAGAAACTGAAATTCATTGATACAATCCAACGGCTGGGAATCTCTTGCTATTTCGAGGATGAAATCAACGGCATACTGCAGGCGGAGTTATCCGATACTGACCAGCTTGAGGACGGCCTCTTCACAACGGCTCTACGCTTCCGTTTGCTCCGTCACTACGGCTACCAAATCGCTCCCGACGTCTTCCTAAAATTCACGGACCAAAATGGAAAATTCAAAGAATCCTTAGCGGATGACACACAAGGATTAGTCAGCTTATACGAAGCATCATATATGGGAGCAAACGGAGAAAACATATTAGAAGAAGCTATGAAATTCACCAAAACTCATCTCCAAGGAAGACAACATGCGATGAGAGAAGTGGCTGAAGCCTTGGAGCTTCCGAGGCATCTGAGAATGGCCAGGTTAGAAGCAAGAAGATACATCGAACAATATGGTACAATGATTGGACATGATAAAGACCTCTTGGAGCTAGTAATATTGGACTATAACAATGTCCAGGCTCAGCACCAAGCGGAACTCGCCGAAATTGCCAGATGGTGGAAGGAGCTTGGTCTAGTTGACAAGTTAACTTTCGCGCGAGATAGACCATTGGAGTGCTTTTTGTGGACTGTCGGTCTTCTACCTGAACCCAAATACTCTGCTTGCCGAATCGAGCTCGCAAAAACAATAGCCATTCTATTGGTAATCGATGATATCTTCGATACCTATGGGAAAATGGAAGAACTCGCTCTTTTCACGGAGGCAATTAGAAGATGGGATCTTGAAGCTATGGAAACCCTTCCCGAGTACATGAAAATATGCTATATGGCATTGTACAATACCACCAACGAGATATGCTACAAAGTCCTCAAGAAAAATGGATGGAGTGTTCTCCCATACCTAAGATATACGTGGATGGACATGATAGAAGGTTTTATGGTGGAGGCAAAGTGGTTCAATGGTGGAAGTGCTCCAAACTTGGAAGAGTACATAGAGAATGGAGTCTCAACGGCTGGGGCATACATGGCTTTGGTGCATCTCTTCTTTCTAATTGGGGAAGGTGTCAGTGCGCAAAATGCCCAAATATTACTGAAGAAACCCTATCCTAAGCTCTTCTCGGCTGCCGGTCGAATTCTTCGCCTTTGGGATGATCTTGGAACGGCTAAGGAGGAGGAAGGAAGAGGTGATCTTGCATCGAGCATACGTTTATTCATGAAAGAAAAGAACCTAACAACGGAAGAGGAAGGGAGAAATGGTATACAGGAGGAGATATATAGCTTATGGAAAGACCTAAACGGAGAGCTCATTTCTAAAGGTAGGATGCCATTGGCCATCATCAAAGTGGCACTTAACATGGCTAGAGCTTCTCAAGTGGTGTACAAGCATGACGAGGACTCTTATTTTTCATGTGTAGACAATTATGTGGAGGCCCTGTTCTTCACTCCTCTCCTTTGA</p>
 +
<div class="third-level" >Optimization</div>
 +
<p class="my-content" >In order to assure that <i> PdGES </i> ligate to the multiple cloning sites of the vector successfully, we avoid all the common restriction enzyme cutting sites (<i>Eco</i>R I, <i> Xba </i> I, <i> Spe </i> I, <i> Pst </i> I, <i>Bam</i>H I, <i> Bgl </i> II, <i>Hin</i>d III, <i> Kpn </i> I, <i> Nco </i> I, <i> Nde </i> I, <i> Not </i> I, <i> Sal </i> I, <i> Xho </i> I, Polymerase slippage site, Polymerase slippage site, Frameshift element, ribosome binding site)when the synthesis is being performed.</p>
 +
<p class="my-content" >To make the parts established by genes satisfy the need of constructing the vector pSBIC3, we avoid the restriction enzyme cutting sites, which are  <i>Eco</i>R Ⅰ, <i> Xba </i> I, <i> Spe </i> I, <i> Pst </i> I.</p>
 +
<p class="my-content" >To ligate genes directly to the standard vector, we add the restriction enzyme cutting sites of  <i > Xba </i> Ⅰ and  <i> Spe </i> Ⅰ to the upstream and downstream of target gene.</p>
 +
<div class="third-level" >The optimized sequence</div>
 +
<p class="my-content" >ATGGCGAGCGCGCGTAGCACCATCAGCCTGAGCAGCCAAAGCAGCCACCACGGTTTCAGCAAAAACAGCTTTCCGTGGCAGCTGCGTCACAGCCGTTTCGTTATGGGCAGCCGTGCGCGTACCTGCGCGTGCATGAGCAGCAGCGTGAGCCTGCCGACCGCGACCACCAGCAGCAGCGTGATTACCGGTAACGACGCGCTGCTGAAGTATATCCGTCAGCCGATGGTGATTCCGCTGAAGGAGAAAGAGGGCACCAAGCGTCGTGAATACCTGCTGGAGAAAACCGCGCGTGAGCTGCAAGGCACCACCGAGGCGGCGGAAAAGCTGAAATTCATCGACACCATTCAGCGTCTGGGTATCAGCTGCTACTTTGAGGATGAAATCAACGGCATTCTGCAAGCGGAACTGAGCGACACCGATCAGCTGGAGGATGGTCTGTTCACCACCGCGCTGCGTTTTCGTCTGCTGCGTCACTACGGCTATCAAATCGCGCCGGACGTTTTCCTGAAATTTACCGATCAGAACGGCAAGTTCAAAGAAAGCCTGGCGGACGATACCCAAGGCCTGGTGAGCCTGTACGAAGCGAGCTATATGGGTGCGAACGGCGAGAACATTCTGGAGGAAGCGATGAAGTTTACCAAAACCCACCTGCAAGGTCGTCAGCACGCGATGCGTGAGGTTGCGGAAGCGCTGGAGCTGCCGCGTCACCTGCGTATGGCGCGTCTGGAAGCGCGTCGTTACATCGAGCAGTATGGCACCATGATTGGCCACGACAAGGATCTGCTGGAGCTGGTGATCCTGGACTACAACAACGTTCAGGCGCAACACCAGGCGGAACTGGCGGAGATTGCGCGTTGGTGGAAGGAGCTGGGTCTGGTTGACAAACTGACCTTCGCGCGTGATCGTCCGCTGGAATGCTTTCTGTGGACCGTGGGTCTGCTGCCGGAACCGAAATATAGCGCGTGCCGTATCGAGCTGGCGAAGACCATCGCGATTCTGCTGGTTATCGACGATATTTTCGACACCTACGGTAAAATGGAGGAACTGGCGCTGTTTACCGAAGCGATTCGTCGTTGGGATCTGGAAGCGATGGAGACCCTGCCGGAGTATATGAAAATCTGCTACATGGCGCTGTATAACACCACCAACGAAATTTGCTACAAGGTGCTGAAGAAAAACGGTTGGAGCGTTCTGCCGTACCTGCGTTATACCTGGATGGATATGATCGAAGGCTTCATGGTGGAGGCGAAGTGGTTTAACGGTGGCAGCGCGCCGAACCTGGAGGAATATATTGAGAACGGTGTGAGCACCGCGGGCGCGTACATGGCGCTGGTTCACCTGTTCTTTCTGATCGGTGAAGGCGTGAGCGCGCAAAACGCGCAGATTCTGCTGAAGAAACCGTATCCGAAACTGTTCAGCGCGGCGGGTCGTATCCTGCGTCTGTGGGACGATCTGGGCACCGCGAAAGAGGAAGAGGGTCGTGGCGACCTGGCGAGCAGCATTCGTCTGTTTATGAAGGAGAAAAACCTGACCACCGAAGAGGAAGGTCGTAACGGCATCCAAGAGGAAATTTACAGCCTGTGGAAGGATCTGAACGGTGAACTGATCAGCAAAGGCCGTATGCCGCTGGCGATCATTAAGGTGGCGCTGAACATGGCGCGTGCGAGCCAGGTGGTTTACAAACACGACGAAGATAGCTATTTCAGCTGCGTGGACAACTACGTTGAGGCGCTGTTCTTTACCCCGCTGCTGTAA</p>
 +
<div class="third-level" >Codon Adaptation Index (CAI)</div>
 +
<p class="my-content" >PdGES</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/7/74/T--CIEI-BJ--Results--1.jpg" />
 +
<p class="my-content" >CAI: 0.97</p>
 +
<p class="my-content" >Fig. 1-1 The distribution of codon usage frequency along the length of the gene sequence. A CAI of 1.0 is considered to be perfect in the desired expression organism, and a CAI of > 0.8 is regarded as good, in terms of high gene expression level.</p>
 +
<div class="second-level" id="a3" >Amplification of  <i> PdGES </i></div>
 +
<div class="third-level" >carrier</div>
 +
<div class="forth-level" >pUC57 vector</div>
 +
<p class="my-content" >Introduction of pUC57:</p>
 +
<p class="my-content" >pUC57 is a carrier of E.Coli and s cloning vector of 2710 bp. The promoter of pUC57 is lac and the replicon is ColE1 origin and the resistance of pUC57 is the ampicillin in prokaryotic. In addition, the aerobic environment with 37 degree Celsius in LB medium is the most suitable for pUC57 cultivation. In our experiment, we get gene PdGES and PcGES from pUC57 as our initial materials.</p>
 +
<p class="my-content" >The sequences of common primer for pUC57:</p>
 +
<p class="my-content" >5' sequencing primer M13R: CAGGAAACAGCTATGACC</p>
 +
<p class="my-content" >3' sequencing primer M13F: TGTAAAACGACGGCCAGT</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/0/0b/T--CIEI-BJ--Results--12.jpg" />
 +
<p class="my-content" >Fig. 1-2 The plasmid portfolio of pUC57</p>
 +
<div class="third-level" >Amplification of  <i> PdGES </i></div>
 +
<p class="my-content" >To obtain the target gene  <i> PdGES </i>, using the specific primers to clone the targeted gene, our team amplify the template----vector pUC57 with  <i> PdGES </i> ---- through PCR.</p>
 +
<p class="my-content" >The sequence of forward primer is: AAAAACAACTAATTATTCGAAGATGGCGAGCGCGCGTAG</p>
 +
<p class="my-content" >The sequence of reverse primer is: AGGCGAATTAATTCGCGGCGCTTTACAGCAGCGGGGTAA</p>
 +
<p class="my-content" >As shown is figure 1-3, the size of PdGES shown on the picture matchs with the theoretical size of PdGES which is 1755 bp, we successfully  clone the gene  <i> PdGES </i>.</p>
 +
<p class="my-content" >Fig. 1-3 Electrophoresis of  <i> PdGES </i> PCR product.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/0/06/T--CIEI-BJ--Results--13.jpg" />
 +
<p class="my-content" >The left column is the marker, and the two strips on the right are PCR products of  <i> PdGES </i>.</p>
 +
<p class="my-content" >The sizes of the two strips are about 2000 bp.</p>
 +
<div class="second-level" id="a4" >Construction of vectors</div>
 +
<div class="third-level" >Construction of yeast expression vector pPIC9K</div>
 +
<p class="my-content" >pPIC9K is a carrier for the expression of protein in yeast of 9276bp. The promoter of pPIC9K is AOX1 and the resistance of pPIC9K is the Ampicillin.</p>
 +
<p class="my-content" >The sequences of common primer for pPIC9K:</p>
 +
<p class="my-content" >5' sequencing primer is 5´-GACTGGTTCCAATTGACAAGC-3´</p>
 +
<p class="my-content" >3' sequencing primer is 5´-GCAAATGGCATTCTGACATCC-3´</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/1/1f/T--CIEI-BJ--Results--14.jpg" />
 +
<p class="my-content" >Fig. 1-4 The plasmid portfolio of pPIC9K</p>
 +
<p class="my-content" >The vector pPIC9K used in our experiment doesn’t have the S part, because the S part is the secretion signal which can remove the protein we produce in the experiment. Since our purpose is to obtain the protein, we have to cut this part to make our experiment successful.</p>
 +
<p class="my-content" >As shown in the diagram below, PdGES has been ligated to the yeast vector pPIC9K successfully. The process is achieved by digestion and ligation to  <i>Bam</i>HI and  <i>Not</i>I. Finally, we transform the ligation product into competent cell yeast  <i> GS115</i>.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/a/aa/T--CIEI-BJ--Results--15.png" />
 +
<p class="my-content" >Fig. 1-5 Electrophoresis of  <i> PdGES </i> -contained pPIC9K vector.</p>
 +
<p class="my-content" >The left column is the marker and the strips on the right are the PCR products of ligation of PdGES.</p>
 +
<div class="third-level" >Construction of  <i> E. Coli </i> expression vector pET32a</div>
 +
<p class="my-content" >pET32a is a carrier for the expression of protein in  <i> E.Coli </i> of 5900bp. The promoter of pET32a is T7, which is a strong primer that can express at any time, any cell under any circumstance. The resistance of pET32a is the Ampicillin.</p>
 +
<p class="my-content" >The sequences of primer for pET32a:</p>
 +
<p class="my-content" >5' sequencing primer is 5´-TAATACGACTCACTATAGGG-3´</p>
 +
<p class="my-content" >3' sequencing primer is 5´-GCTAGTTATTGCTCAGCGG-3´</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/3/30/T--CIEI-BJ--Results--16.png" />
 +
<p class="my-content" >Fig. 1-6 The plasmid portfolio of pET32a</p>
 +
<p class="my-content" >We try to ligate  <i> SpTPS1</i> gene into pET32a vector, but after three trails, we failed to ligate the intracellular device in pET32a. The possible explanation is the condition of ligation is not suitable or the sequence of this gene.</p>
 +
<div class="first-level" id="a5"  ><i> PcGES </i></div>
 +
<p class="my-content" >PcGES, Pogostemon cablin geraniol synthase (GS1), is an also enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate(GPP)can be  produced. The fuction of  <i> PcGES </i> is to convert GPP to geraniol. PcGES functions the same as PdGES, the only difference is that they are from different species. By applying both GESs in our experiments, we can find out which one is more efficient by analyzing the efficiency of production.</p>
 +
<div class="second-level" id="a6" >Optimization of PcGES</div>
 +
<div class="third-level" >The nucleotide sequence before optimization</div>
 +
<p class="my-content" >(GenBank: KF926075.1)</p>
 +
<p class="my-content" >ATGTCTTGTGCTAGAAGCTACACCATTCCTTTGTCCTTCCCCAAAACCTCTAATTCACCATTGCAACTAAAGAATCTCCTCCCTTTCCCCGCCGCCCGGTCGCGTTTTTCCGTGCGCATGTCCACCTCGTCCCTTCCCGTTGGCAACGAAGCCCTACTAAAATACATTCGACAACCCGTGGTGTTGCCTACGGAAGAAGATGAGAGCATCAAGAGGAGAGATTATTTGCTCGAAAAAACTGCGAGGAGGTTAAGGACGAGTACGGGTAGTGTGGAGAAGCTTAAGCTTATCGATACGATCCAACGACTAGGAATCGATTATTATTTGGAGGACGATATAAACGTAGTACTTAGAAATGAGTACTATAATGGTAGGTCTAGTGAAGAAGACCTCTTCACTACAGCTCTAAGATTTCGTTTGCTTCGTCACAACGGCTTCCAAATTAGTTCTGATGTATTCATGAAATTCAAGGACAAAAATGGAAAATTCAAAAAATGGATAGCTGAGGATACAATAGGGTTACTGAGCTTATATGAGGCGTCGTATATGGGAGCTCATGGTGAAAAAATATTGGAAGAAGCGATGGAATTCTCGAGGTCACTCCTCAAGAGATCGCTTCCTCAGTTGCCTCCGAAGCTCCACGGGCAGGTGGCTCAAGCCTTGGAGCTTCCGAGACACCTGAGGATGGCTAGATTAGAAGCTCGACGGTTTGTCCAGCAATACGCTAAACAAAGTGACTGCGATCGTGACCTTTTGAACCTAGCAACATTGGATTATAACAAGGTTCAATTGCAGCACCAATTTGAACTTGCCGAAATTACAAGGTGGTGGCAACAGCTTGGTCTAGTAGAAAAGTTAACATTTGCACGAGATAGACCGTTGGAGTGTTTTTTGTGGACCGTTGGATTACTCCCAGAACCCAGATATTCCACGTGTCGAATTGAGATGGCCAAGACCATTGCTATTTTATTAGTCATTGACGATATTTTCGACACGTATGGCAAAATGGATGAACTCCTCCTCTTCACCCAAGCTATTAGAAGATGGGATCTTGAAGCAATGGATATCCTTCCGGAATACATGAAAATATGTTACATGGCATTATACAACACAACTAATGAAATATGCTACAAAGTGCTCAAACTCAATGGATGGAGTGTCCTTTCTTACCTTAAATCTACGTGGATAGATATGATAGAAGGTTTTATGGTGGAGGCAAAATGGTTGAATGGTGGTGGTGCACCAAACTTGGAAGAGTACCTTGAGAATGGAGTGTCTACGGCGGGTGCATACATGGCTCTGGTGCACCTCTTTTTCCTAATTGGAGAAGGCGTTAATGACCAAAATGCCCCACTCTTGACCAAAAAACCATACCCCAAGCTCTTCTCCGCCGCTGGCCGGATTCTTCGCCTCTGGGACGACCTCGGAACTGCCAAGGAGGAGCAAGAGCGAGGAGACGTAGCATCGAGCATCGAGTTTGTGATGAGAGAGAAAGAGGTGGAAAGTGAAGAAGAGGGAAGAAGATACATATTGGGAGAGATATATGAGTTATGGAAGGATTTGAATGGGGAGTTGATGTCCAAGAATGGAATGCCATTAGCGATTATTAAAGTCGCACTTAACATGGCACGAGCTTCCCAAGTGGTGTACAAGCATGAAGAGGACACTTATTTCTCCAGCGTGGATAATTACGTGGAAGCCCTCTTCTTCACTCCTCTTCCTTCATCCATCTAA</p>
 +
<div class="third-level" >Optimization</div>
 +
<p class="my-content" >In order to assure that PcGES ligate to the multiple clone sites of the vector successfully, we avoid all the common restriction enzyme cutting sites (EcoR I, Xba I, Spe I, Pst I, BamH I, Bgl II, Hind III, Kpn I, Nco I, Nde I,Not I,Sal I, Xho I, Polymerase slippage site, Polymerase slippage site, Frameshift element, ribosome binding site)when the synthesis is being performed.</p>
 +
<p class="my-content" >To make the parts established by genes satisfy the need of constructing the vector pSBIC3, we avoid the restriction enzyme cutting sites, which are  <i>Eco</i>R Ⅰ, <i> Xba </i> I, <i> Spe </i> I, <i> Pst </i> I.</p>
 +
<p class="my-content" >To lig ate genes directly to the standard vector, we add the restriction enzyme cutting sites of  <i> Xba </i> Ⅰ and  <i> Spe </i> Ⅰ to the upstream and downstream of target gene.</p>
 +
<div class="third-level" >The optimized sequence</div>
 +
<p class="my-content" >ATGTCTTGTGCTAGATCATACACTATCCCATTATCTTTTCCAAAGACATCTAATTCACCATTACAATTGAAAAATTTGTTACCATTTCCAGCTGCAAGATCAAGATTTTCTGTTAGAATGTCTACATCTTCATTACCAGTTGGTAACGAAGCATTGTTGAAGTACATCAGACAACCAGTTGTTTTGCCAACAGAAGAAGATGAATCAATTAAAAGAAGAGATTATTTGTTGGAAAAGACTGCAAGAAGATTAAGAACTTCTACAGGTTCAGTTGAAAAATTGAAATTGATCGATACTATCCAAAGATTAGGTATCGATTACTACTTGGAAGATGATATCAACGTTGTTTTGAGAAACGAATACTACAACGGTAGATCATCTGAAGAAGATTTGTTTACTACAGCTTTGAGATTCAGATTGTTGAGACATAACGGTTTCCAAATTTCTTCAGATGTTTTTATGAAGTTTAAAGATAAGAATGGTAAATTCAAGAAATGGATTGCTGAAGATACAATCGGTTTGTTATCTTTATACGAAGCATCTTACATGGGTGCACATGGTGAAAAGATTTTGGAAGAAGCTATGGAATTTTCAAGATCATTGTTGAAGAGATCATTGCCACAATTGCCACCAAAATTACATGGTCAAGTTGCTCAAGCATTAGAATTGCCAAGACATTTGAGAATGGCTAGATTGGAAGCAAGAAGATTTGTTCAACAATACGCTAAACAATCTGATTGTGATAGAGATTTGTTGAATTTGGCAACTTTGGATTACAATAAGGTTCAATTACAACATCAATTCGAATTGGCTGAAATCACTAGATGGTGGCAACAATTGGGTTTGGTTGAAAAATTGACATTTGCAAGAGATAGACCATTGGAATGTTTCTTGTGGACTGTTGGTTTGTTACCAGAACCAAGATACTCTACTTGTAGAATCGAAATGGCTAAGACAATTGCAATCTTGTTAGTTATTGATGATATCTTCGATACTTATGGTAAAATGGATGAATTGTTGTTGTTTACACAAGCTATCAGAAGATGGGATTTGGAAGCAATGGATATCTTGCCAGAATACATGAAAATTTGTTATATGGCTTTATACAATACTACAAACGAAATTTGTTACAAGGTTTTGAAATTGAACGGTTGGTCTGTTTTGTCATATTTGAAATCTACATGGATCGATATGATCGAAGGTTTTATGGTTGAAGCTAAATGGTTGAATGGTGGTGGTGCTCCAAATTTGGAAGAATACTTAGAAAACGGTGTTTCAACTGCTGGTGCATACATGGCTTTAGTTCATTTGTTTTTCTTGATCGGTGAAGGTGTTAACGATCAAAACGCACCATTATTGACTAAGAAACCATACCCAAAATTGTTTTCTGCTGCTGGTAGAATTTTAAGATTGTGGGATGATTTGGGTACTGCTAAAGAAGAACAAGAAAGAGGTGACGTTGCATCTTCAATCGAATTTGTTATGAGAGAAAAAGAAGTTGAATCAGAAGAAGAAGGTAGAAGATACATCTTGGGTGAAATATATGAATTGTGGAAAGATTTGAACGGTGAATTGATGTCTAAAAATGGTATGCCATTGGCTATTATTAAGGTTGCATTGAACATGGCTAGAGCATCACAAGTTGTTTACAAGCATGAAGAAGATACATACTTTTCTTCAGTTGATAACTACGTTGAAGCATTGTTTTTCACTCCATTGCCATCTTCTATTTGA</p>
 +
<div class="third-level" >Codon Adaptation Index (CAI)</div>
 +
<p class="my-content" >PcGES</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/9/9d/T--CIEI-BJ--Results--21.png" />
 +
<p class="my-content" >CAI: 0.93</p>
 +
<p class="my-content" >Fig. 2-1 The distribution of codon usage frequency along the length of the gene sequence. A CAI of 1.0 is considered to be perfect in the desired expression organism, and a CAI of > 0.8 is regarded as good, in terms of high gene expression level.</p>
 +
<div class="third-level" >Amplification of  <i> PcGES </i></div>
 +
<div class="third-level" >carrier-pUC57 vector</div>
 +
<p class="my-content" > The information of this vector is the same as  <i> PdGES </i> (above 1.2.1.1)</p>
 +
<div class="third-level" >verification of  <i> PcGES </i> product</div>
 +
<p class="my-content" >To obtain the target gene  <i> PcGES </i>, using the specific primers to clone the target gene, we amplify the template is the vector pUC57 with PcGES through PCR.</p>
 +
<p class="my-content" >The sequence of forward primer is: AAAAACAACTAATTATTCGAAGATGTCTTGTGCTAGATCAT</p>
 +
<p class="my-content" >The sequence of reverse primer is: AGGCGAATTAATTCGCGGCGCTTTCAAATAGAAGATGGCAAT</p>
 +
<p class="my-content" >As shown is figure 1-3, we successfully cloned gene  <i> PcGES </i>, because the size of PcGES shown on the picture matches with the theoretical size of PcGES which is 1734 bp.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/9/95/T--CIEI-BJ--Results--22.png" />
 +
<p class="my-content" >Fig. 2-2 Electrophoresis of  <i> PcGES </i> PCR product.</p>
 +
<p class="my-content" >The left column is the marker, and the two strips on the right are PCR products of PcGES.</p>
 +
<p class="my-content" >The sizes of the two strips are about 2000 bp.</p>
 +
<p class="my-content" >The We try to ligate  <i> SpTPS1</i> gene into pPIC9K and pET32a vector, but after three trails, we failed to ligate the vector. The possible explanation is the condition of ligation is not suitable or the sequence of this gene. But we successfully ligated <i> SpTPS1</i> gene with OYE and 2A in pPIC9K and pET32a vector, the specific information will be show the following text.(3.)</p>
 +
<div class="first-level" id="a7"  >HbOYE</div>
 +
<div class="second-level" id="a8" >Sequence of HbOYE</div>
 +
<p class="my-content" >ATCTCTCTAATAATCATCTTCGTCAGCAGCAGCACAGCAGCAGCAGAAGAAAGTCATATATATATATATATCTTAGATTCATTTCAGTTCTAGATAAGAAGCAACAATGGCTGAAACTGGAACAGAAGGGACCGGGATCACCACCCTATTTTCTCCTTACAAAATGGGCAAGTTCAGCCTCTCCCACAGGGTGGTGCTGGCTCCCATGACTAGATGCAGAGCGTTGAACGGGATACCAAACGCAGCGCTGGTGGATTACTACACGCAGAGATCAACTCCCGGCGGATTTCTCATCACGGAAGGCACTCTGGTTTCCCCTACTGCCCCTGGGTTTCCTCATGTCCCTGGAATTTATACAGAAGAACAAGCGGAGGCATGGAAGAGGGTGGTGGATGCAGTTCATGCCAAAGGGAGCATCATATTCTGTCAATTATGGCATGTTGGCCGCGCATCTCATCAGGTTTATCAACCTAATGGAGCGCACCAATATCATCGACGGGCAAGGCCATCTCAAACAGATGGAGAATTCTCATGCCAGATGGATCATATGGGAAATACCCAACACCTAGGCCCTTGGAAACACCTGAAATACTAGAGGTAGTGAAGAATTATCGCCAGTCAGCCTTGAATGCCATTCGAGCAGGCTTTGATGGAATTGAGGTCCACGGGGCTCATGGTTACCTTATTGATCAATTCTTAAAAGACGGGATCAATGACCGAACAGATGAGTATGGTGGATCAATCAACAATCGATGCAGATTCCTAATGCAGGTGATTCAGGCAGTAGTTGCAGCTATTGGTGCTGATCGAGTTGGTTTCAGAATGTCACCGGCAATTGATCACCTAGATGCCATAGATTCTGATCCGCTCAACTTGGGTCTTGCTGTAATCGAGAGACTTAACAAACTTCAGTTGAACCTTGGATCAAAACTCACTTATCTCCATGTCACTCAGCCTCGCTACACAGCTTATGGCCAAACAGAATCAGGCAGACATGGTACTGAAGAAGAGGAAGCTAGATTAATGAGAACTTGGAGAAGGGCTTATAAGGGAACTTTCATCTGTAGCGGTGGGTTCACGAGGGAGCTAGGAATGGAAGCTATAGCTCAAGATGATGCAGATTTGGTATCTTATGGCCGACTTTTTATTTCAAACCCAGACTTAGTCTTGAGATTTAAGCTCAATGCGCCCTTGAATAAGTATGTCAGGAAAACATTCTACACCCAAGATCCTGTTGTTGGGTACACAGACTACCCATTTTTCAGAAAAGTAGACGGGAGCCAGGAGCCACGATCACGCCTTTGAATCTGTAGTCTTTGGAATAATTATACATGTATTTAAACATATGATATTTTGTTTGAACTTTATTATATCAGTGAACATCTTGATTAAAAGACAACATCCTCTAAGAAGAGGATTTTTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA</p>
 +
<div class="second-level" id="a9" >Amplification of HbOYE</div>
 +
<div class="third-level" >carrier-pUC57 vector</div>
 +
<p class="my-content" >The information of this vector is the same as  <i> PdGES </i> (above 1.2.1.1)</p>
 +
<div class="third-level" >verification of HbOYE product</div>
 +
<p class="my-content" >To obtain the target gene HbOYE, using the specific primers to clone the targeted gene,our team amplify the template is the vector pUC57 with HbOYE through PCR.</p>
 +
<p class="my-content" >The sequence of forward primer is: TTTTATTTCAAACCCAGAC</p>
 +
<p class="my-content" >The sequence of reverse primer is: GGTGGTGGTGCTCGAGTCTTTTAATTGATTCATCT</p>
 +
<p class="my-content" >As shown is figure 1-3, we successfully cloned gene HbOYE, because the size of HbOYE shown on the picture matches with the theoretical size of HbOYE which is 1455 bp.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/3/3c/T--CIEI-BJ--Results--31.png" />
 +
<p class="my-content" >Fig. 3-1 Electrophoresis of  <i> HbOYE </i> PCR products.</p>
 +
<p class="my-content" >The left column is the marker, and the two strips on the right are PCR products of HbOYE.</p>
 +
<p class="my-content" >The sizes of the two strips are about 1200 bp.</p>
 +
<div class="second-level" id="a10" >Ligation of HbOYE fragment to pET32a vector</div>
 +
<div class="third-level" >pET32a vector</div>
 +
<p class="my-content" >pET32a is a carrier of <i> E.Coli </i> of 5900bp. The promoter of pET32a is T7 and the resistance of pET32a is the Ampicillin. The information of this vector is the same as  <i> PdGES </i> (above 1.3.2)</p>
 +
<p class="my-content" >3.3.2 Ligation of HbOYE fragment to pET32a vector</p>
 +
<p class="my-content" >we use the restriction endonuclease <i>Bam</i>H I and <i>Xho</i> I to cut the  <i> E. Coli </i> expression vector pET32a and make it ligated with HbOYE (1.2 kb), and the result has been shown positive through PCR.</p>
 +
<p class="my-content" >Then we ligate the product with T4 vector for sequencing. Eventually, the product has been transformed into the competent cell  <i> E. Coli </i> complement cell  <i> DH5α</i>, and the result of sequencing is 100% matched.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/e/ef/T--CIEI-BJ--Results--32.png" />
 +
<p class="my-content" >Fig. 3-2 Electrophoresis of  <i> HbOYE </i> -contained pET32a vector.</p>
 +
<p class="my-content" >The left column is the marker and the strips on the right are all the samples of combination of HbOYE and pFT32a. According to the graph, the size is between 1000 bp and 750 bp, so the result is positive.</p>
 +
<div class="second-level" id="a11" >Ligation of <i>HbOYE</i> fragment to pPIC9K vector</div>
 +
<div class="third-level" >pPIC9K vector</div>
 +
<p class="my-content" >pPIC9K is a carrier for the expression of protein in yeast of 9276bp. The promoter of pPIC9K is AOX1 and the resistance of pPIC9K is the Ampicillin. The information of this vector is the same as  <i> PdGES </i> (above 1.3.1)</p>
 +
<p class="my-content" >3.4.2 Ligation of  <i> HbOYE </i> fragment to pPIC9K vector</p>
 +
<p class="my-content" >We utilize restriction endonuclease <i> Bam </i>H I and  <i>Not</i>I to cut the yeast expression vector PIC9K and make it ligated with HbOYE (about 1.2 kb), and the result has been shown positive through PCR.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/a/a6/T--CIEI-BJ--Results--33.png" />
 +
<p class="my-content" >Fig. 3-3 Electrophoresis of  <i> HbOYE </i> -contained pPIC9K vector.</p>
 +
<p class="my-content" >The left column is the marker and the strips on the right are all the samples of combination of  <i> HbOYE </i> and pPIC9K. According to the graph, the size is between 1000 bp and 2000 bp, so the result is positive.</p>
 +
<div class="second-level" id="a12" >Ligation of HbOYE with 2A and GES to pPIC9K vector and pET32a vector</div>
 +
<p class="my-content" >To improve the efficiency of production while keeping the two proteins independent at the same time, we decide to combine  <i> OYE </i> and  <i> GES </i> together. It turns out that we choose 2A as a ‘bridge’ to link the two genes because the protein translated by 2A can be cut by certain enzymes automatically. 2A, known as CHYSEL polypeptides, contains the peptide bond to grow the peptide chain which helps to link two genes. The presence of the conserved CHYSEL residues in the peptides contributes to form a torsion which causes the peptide chain to be released later, and then the two genes can express in a cell separately. Furthermore, we employ two kinds of 2A, which are F2A and P2A. By doing so, we can compare the efficiencies of them and choose one which is more efficient.</p>
 +
<p class="my-content" >F2A sequence:</p>
 +
<p class="my-content" >CAGCTGTTGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTCGAGTCCAACCCTGGGCCC</p>
 +
<p class="my-content" >P2A sequence:</p>
 +
<p class="my-content" >GGAAGCGGAGCGACGAATTTTAGTCTACTGAAACAAGCGGGAGACGTGGAGGAAAACCCTGGACCT</p>
 +
<div class="third-level" >HbOYE+2A</div>
 +
<p class="my-content" > By using Net-PCR, we combine the HbOYE with 2A. 2A is a piece of peptide which can combine two genes together and be cut at 3’ prime end when the DNA is translated into mRNA. After being cut, the two genes can still perform their functions correctly in the latter steps. The picture of electrophoresis following shows the positive result of the combination. This product will be used in the final step of our experiment. Because of the function domain of  <i> GES </i> is on the 3’ end,the 2A which can express 20 amino acids which may influence the function of GES protein, so we ligated OYE with 2A first, the ligate GES after 2A.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/a/a8/T--CIEI-BJ--Results--34.png" />
 +
<p class="my-content" >Fig. 3-4 Eelectrophoresis of  <i> HbOYE +2A </i> -contained pPIC9K vector. The left column is the marker and the strips on the right are all the samples of combination of HbOYE and 2A. According to the graph, the size of <i> HbOYE +2A </i>  is between 1000 bp and 2000 bp, so the result is positive.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/7/79/T--CIEI-BJ--Results--35.png" />
 +
<p class="my-content" >Fig. 3-5 Eelectrophoresis of HbOYE+2A-contained pET32a  vector. The M stands for  the marker and the 1,2,3 stand for samples of combination of HbOYE and 2A. lane 1 and 2 is the HbOYE + F2A,3 stands for HbOYE + P2A. According to the graph, we use a part of sequence to measure, so the result is positive.</p>
 +
<div class="third-level" >HbOYE+2A+PcGES</div>
 +
<p class="my-content" >By using Net-PCR, we combine the previous product (HbOYE with 2A) and PcGES. The picture of electrophoresis following shows the positive result of the combination. This product is our final product of the whole experiments.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/3/3d/T--CIEI-BJ--Results--36.png" />
 +
<p class="my-content" >Fig. 3-6 Electrophoresis of <i>HbOYE+2A+PcGES</i>-contained  pET32a vector.</p>
 +
<p class="my-content" >The M stands for  the marker and the 1,2,3 stand for samples of combination of <i>HbOYE +2A</i> and <i>PcGES</i>. 1 and 2 is the  <i>HbOYE+2A+PcGES</i>, 3 and 4 stands for <i>HbOYE + P2A+ PcGES</i>. According to the graph, we use a part of sequence to measure, so the result is positive.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/8/8a/T--CIEI-BJ--Results--37.png" />
 +
<p class="my-content" >Fig. 3-7 Electrophoresis of HbOYE+F2A+PcGES-contained  pPIC9K vector.</p>
 +
<p class="my-content" >The M stands for  the marker and the 1,2,3 stand for samples of combination of HbOYE +2A and PcGES. 1 and 2 is the HbOYE + F2A+PcGES, According to the graph, we use a part of sequence to measure, so the result is positive.</p>
 +
<div class="first-level" id="a13"  >ScOYE</div>
 +
<div class="second-level" id="a14" >nucleotide sequence of ScOYE</div>
 +
<p class="my-content" >ATGCCATTTGTTAAGGACTTTAAGCCACAAGCTTTGGGTGACACCAACTTATTCAAACCAATCAAAATTGGTAACAATGAACTTCTACACCGTGCTGTCATTCCTCCATTGACTAGAATGAGAGCCCAACATCCAGGTAATATTCCAAACAGAGACTGGGCCGTTGAATACTACGCTCAACGTGCTCAAAGACCAGGAACCTTGATTATCACTGAAGGTACCTTTCCCTCTCCACAATCTGGGGGTTACGACAATGCTCCAGGTATCTGGTCCGAAGAACAAATTAAAGAATGGACCAAGATTTTCAAGGCTATTCATGAGAATAAATCGTTCGCATGGGTCCAATTATGGGTTCTAGGTTGGGCTGCTTTCCCAGACACCCTTGCTAGGGATGGTTTGCGTTACGACTCCGCTTCTGACAACGTGTATATGAATGCAGAACAAGAAGAAAAGGCTAAGAAGGCTAACAACCCACAACACAGTATAACAAAGGATGAAATTAAGCAATACGTCAAAGAATACGTCCAAGCTGCCAAAAACTCCATTGCTGCTGGTGCCGATGGTGTTGAAATCCACAGCGCTAACGGTTACTTGTTGAACCAGTTCTTGGACCCACACTCCAATAACAGAACCGATGAGTATGGTGGATCCATCGAAAACAGAGCCCGTTTCACCTTGGAAGTGGTTGATGCAGTTGTCGATGCTATTGGCCCTGAAAAAGTCGGTTTGAGATTGTCTCCATATGGTGTCTTCAACAGTATGTCTGGTGGTGCTGAAACCGGTATTGTTGCTCAATATGCTTATGTCTTAGGTGAACTAGAAAGAAGAGCTAAAGCTGGCAAGCGTTTGGCTTTCGTCCATCTAGTTGAACCTCGTGTCACCAACCCATTTTTAACTGAAGGTGAAGGTGAATACAATGGAGGTAGCAACAAATTTGCTTATTCTATCTGGAAGGGCCCAATTATTAGAGCTGGTAACTTTGCTCTGCACCCAGAAGTTGTCAGAGAAGAGGTGAAGGATCCTAGAACATTGATCGGTTACGGTAGATTTTTTATCTCTAATCCAGATTTGGTTGATCGTTTGGAAAAAGGGTTACCATTAAACAAATATGACAGAGACACTTTCTACAAAATGTCAGCTGAGGGATACATTGACTACCCTACGTACGAAGAAGCTCTAAAACTCGGTTGGGACAAAAATTAA</p>
 +
<div class="second-level" id="a15" >Amplification of ScOYE</div>
 +
<div class="third-level" >carrier-pUC57</div>
 +
<p class="my-content" >The information of this vector is the same as  <i> PdGES </i> (above 1.2.1.1)</p>
 +
<div class="third-level" >verification of ScOYE product</div>
 +
<p class="my-content" >To obtain the target gene  <i> ScOYE </i>, using the specific primers to clone the targeted gene,we amplify the template is the vector pUC57 with HbOYE through PCR.</p>
 +
<p class="my-content" >The sequence of forward primer is:AAAAACAACTAATTATTCGAAGATGCCATTTGTTAAGGACT</p>
 +
<p class="my-content" >The sequence of reverse primer is: AGGCGAATTAATTCGCGGCGCTTTTTTGTCCCAACCG</p>
 +
<p class="my-content" >As shown is figure 1-3, we successfully cloned gene  <i> ScOYE </i>, because the size of  <i> ScOYE </i> shown on the picture matches with the theoretical size of  <i> ScOYE </i> which is 1203 bp.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/a/a7/T--CIEI-BJ--Results--41.png" />
 +
<p class="my-content" >Fig. 4-1 The picture of electrophoresis of ScOYE.</p>
 +
<p class="my-content" >The left column is the marker, and the two strips on the right are PCR products of ScOYE.</p>
 +
<p class="my-content" >The sizes of the two strips are more than 1000 bp.</p>
 +
<div class="second-level" id="a16" >Ligation of ScOYE in  <i> E.Coli </i></div>
 +
<div class="third-level" >Ligation of  <i> ScOYE </i> fragment to pET32a vector</div>
 +
<p class="my-content" >We uses the restriction endonuclease  <i>Bam</i>H I and  <i> Xho </i> I to cut the  <i> E. Coli </i> expression vector pET32a and make it ligated with ScOYE, and the result has been shown positive through PCR.</p>
 +
<p class="my-content" >Then we ligate the product with T4 vector for sequencing. Eventually, the product has been transformed into the E. Coli competent cell DH5α, and the result of sequencing is 100% matched.</p>
 +
<img class="my-img" src="https://static.igem.org/mediawiki/2017/e/ed/T--CIEI-BJ--Results--42.png" />
 +
<p class="my-content" >Fig. 4-2 Electrophoresis of  <i> ScOYE </i> -contained pET32a vector. The left column is the marker and the strips on the right are all the samples of combination of  <i> ScOYE </i> and pET32a. According to the graph, the size is between 1000 bp and 2000 bp, so the result is positive.</p>
 +
<div class="second-level" id="a17" >Ligation of <i>ScOYE</i> in Yeast</div>
 +
<p class="my-content" >We plan to striction endonuclease <i>BamH I and NotI to cut the yeast expression vector PIC9K and make it ligated with ScOYE. Then combine the previous product (ScOYE with 2A) and PcGES. but the time is limitated.</p>
 +
</div>
 +
</div>
  
 +
<script type="text/javascript">var a = new StickySidebar('#my-sidebar', { topSpacing: 50, containerSelector: '#my-container', innerWrapperSelector: '.sidebar__inner'});</script>
  
<div class="column full_size" >
+
</body>
 
+
<h1>Data to be Filled</h1>
+
 
+
</div>
+
 
</html>
 
</html>

Revision as of 08:59, 1 November 2017

PdGES

PdGES, Phyla dulcis geraniol synthase (GES), is an enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate(GPP)can be produced by glucose. The function of PdGES is to convert GPP into geraniol. This enzyme is one of the essential proteins in our process, since it produces geraniol in the first place.

Optimization of PdGES
The nucleotide sequence before optimization

(GenBank: GU136162.1)

ATGGCGAGTGCAAGAAGCACCATATCTTTGTCCTCACAGTCATCTCATCATGGGTTCTCCAAAAACTCATTTCCATGGCAACTGAGGCATTCCCGCTTTGTTATGGGTTCTCGAGCACGTACCTGCGCATGCATGTCATCATCAGTATCACTGCCTACTGCAACGACGTCGTCCTCAGTCATTACAGGCAACGATGCCCTCCTCAAATACATACGTCAGCCTATGGTAATTCCTTTGAAAGAAAAGGAGGGCACGAAGAGACGAGAATATCTGCTGGAGAAAACTGCAAGGGAACTGCAGGGAACTACGGAGGCAGCGGAGAAACTGAAATTCATTGATACAATCCAACGGCTGGGAATCTCTTGCTATTTCGAGGATGAAATCAACGGCATACTGCAGGCGGAGTTATCCGATACTGACCAGCTTGAGGACGGCCTCTTCACAACGGCTCTACGCTTCCGTTTGCTCCGTCACTACGGCTACCAAATCGCTCCCGACGTCTTCCTAAAATTCACGGACCAAAATGGAAAATTCAAAGAATCCTTAGCGGATGACACACAAGGATTAGTCAGCTTATACGAAGCATCATATATGGGAGCAAACGGAGAAAACATATTAGAAGAAGCTATGAAATTCACCAAAACTCATCTCCAAGGAAGACAACATGCGATGAGAGAAGTGGCTGAAGCCTTGGAGCTTCCGAGGCATCTGAGAATGGCCAGGTTAGAAGCAAGAAGATACATCGAACAATATGGTACAATGATTGGACATGATAAAGACCTCTTGGAGCTAGTAATATTGGACTATAACAATGTCCAGGCTCAGCACCAAGCGGAACTCGCCGAAATTGCCAGATGGTGGAAGGAGCTTGGTCTAGTTGACAAGTTAACTTTCGCGCGAGATAGACCATTGGAGTGCTTTTTGTGGACTGTCGGTCTTCTACCTGAACCCAAATACTCTGCTTGCCGAATCGAGCTCGCAAAAACAATAGCCATTCTATTGGTAATCGATGATATCTTCGATACCTATGGGAAAATGGAAGAACTCGCTCTTTTCACGGAGGCAATTAGAAGATGGGATCTTGAAGCTATGGAAACCCTTCCCGAGTACATGAAAATATGCTATATGGCATTGTACAATACCACCAACGAGATATGCTACAAAGTCCTCAAGAAAAATGGATGGAGTGTTCTCCCATACCTAAGATATACGTGGATGGACATGATAGAAGGTTTTATGGTGGAGGCAAAGTGGTTCAATGGTGGAAGTGCTCCAAACTTGGAAGAGTACATAGAGAATGGAGTCTCAACGGCTGGGGCATACATGGCTTTGGTGCATCTCTTCTTTCTAATTGGGGAAGGTGTCAGTGCGCAAAATGCCCAAATATTACTGAAGAAACCCTATCCTAAGCTCTTCTCGGCTGCCGGTCGAATTCTTCGCCTTTGGGATGATCTTGGAACGGCTAAGGAGGAGGAAGGAAGAGGTGATCTTGCATCGAGCATACGTTTATTCATGAAAGAAAAGAACCTAACAACGGAAGAGGAAGGGAGAAATGGTATACAGGAGGAGATATATAGCTTATGGAAAGACCTAAACGGAGAGCTCATTTCTAAAGGTAGGATGCCATTGGCCATCATCAAAGTGGCACTTAACATGGCTAGAGCTTCTCAAGTGGTGTACAAGCATGACGAGGACTCTTATTTTTCATGTGTAGACAATTATGTGGAGGCCCTGTTCTTCACTCCTCTCCTTTGA

Optimization

In order to assure that PdGES ligate to the multiple cloning sites of the vector successfully, we avoid all the common restriction enzyme cutting sites (EcoR I, Xba I, Spe I, Pst I, BamH I, Bgl II, Hind III, Kpn I, Nco I, Nde I, Not I, Sal I, Xho I, Polymerase slippage site, Polymerase slippage site, Frameshift element, ribosome binding site)when the synthesis is being performed.

To make the parts established by genes satisfy the need of constructing the vector pSBIC3, we avoid the restriction enzyme cutting sites, which are EcoR Ⅰ, Xba I, Spe I, Pst I.

To ligate genes directly to the standard vector, we add the restriction enzyme cutting sites of Xba Ⅰ and Spe Ⅰ to the upstream and downstream of target gene.

The optimized sequence

ATGGCGAGCGCGCGTAGCACCATCAGCCTGAGCAGCCAAAGCAGCCACCACGGTTTCAGCAAAAACAGCTTTCCGTGGCAGCTGCGTCACAGCCGTTTCGTTATGGGCAGCCGTGCGCGTACCTGCGCGTGCATGAGCAGCAGCGTGAGCCTGCCGACCGCGACCACCAGCAGCAGCGTGATTACCGGTAACGACGCGCTGCTGAAGTATATCCGTCAGCCGATGGTGATTCCGCTGAAGGAGAAAGAGGGCACCAAGCGTCGTGAATACCTGCTGGAGAAAACCGCGCGTGAGCTGCAAGGCACCACCGAGGCGGCGGAAAAGCTGAAATTCATCGACACCATTCAGCGTCTGGGTATCAGCTGCTACTTTGAGGATGAAATCAACGGCATTCTGCAAGCGGAACTGAGCGACACCGATCAGCTGGAGGATGGTCTGTTCACCACCGCGCTGCGTTTTCGTCTGCTGCGTCACTACGGCTATCAAATCGCGCCGGACGTTTTCCTGAAATTTACCGATCAGAACGGCAAGTTCAAAGAAAGCCTGGCGGACGATACCCAAGGCCTGGTGAGCCTGTACGAAGCGAGCTATATGGGTGCGAACGGCGAGAACATTCTGGAGGAAGCGATGAAGTTTACCAAAACCCACCTGCAAGGTCGTCAGCACGCGATGCGTGAGGTTGCGGAAGCGCTGGAGCTGCCGCGTCACCTGCGTATGGCGCGTCTGGAAGCGCGTCGTTACATCGAGCAGTATGGCACCATGATTGGCCACGACAAGGATCTGCTGGAGCTGGTGATCCTGGACTACAACAACGTTCAGGCGCAACACCAGGCGGAACTGGCGGAGATTGCGCGTTGGTGGAAGGAGCTGGGTCTGGTTGACAAACTGACCTTCGCGCGTGATCGTCCGCTGGAATGCTTTCTGTGGACCGTGGGTCTGCTGCCGGAACCGAAATATAGCGCGTGCCGTATCGAGCTGGCGAAGACCATCGCGATTCTGCTGGTTATCGACGATATTTTCGACACCTACGGTAAAATGGAGGAACTGGCGCTGTTTACCGAAGCGATTCGTCGTTGGGATCTGGAAGCGATGGAGACCCTGCCGGAGTATATGAAAATCTGCTACATGGCGCTGTATAACACCACCAACGAAATTTGCTACAAGGTGCTGAAGAAAAACGGTTGGAGCGTTCTGCCGTACCTGCGTTATACCTGGATGGATATGATCGAAGGCTTCATGGTGGAGGCGAAGTGGTTTAACGGTGGCAGCGCGCCGAACCTGGAGGAATATATTGAGAACGGTGTGAGCACCGCGGGCGCGTACATGGCGCTGGTTCACCTGTTCTTTCTGATCGGTGAAGGCGTGAGCGCGCAAAACGCGCAGATTCTGCTGAAGAAACCGTATCCGAAACTGTTCAGCGCGGCGGGTCGTATCCTGCGTCTGTGGGACGATCTGGGCACCGCGAAAGAGGAAGAGGGTCGTGGCGACCTGGCGAGCAGCATTCGTCTGTTTATGAAGGAGAAAAACCTGACCACCGAAGAGGAAGGTCGTAACGGCATCCAAGAGGAAATTTACAGCCTGTGGAAGGATCTGAACGGTGAACTGATCAGCAAAGGCCGTATGCCGCTGGCGATCATTAAGGTGGCGCTGAACATGGCGCGTGCGAGCCAGGTGGTTTACAAACACGACGAAGATAGCTATTTCAGCTGCGTGGACAACTACGTTGAGGCGCTGTTCTTTACCCCGCTGCTGTAA

Codon Adaptation Index (CAI)

PdGES

CAI: 0.97

Fig. 1-1 The distribution of codon usage frequency along the length of the gene sequence. A CAI of 1.0 is considered to be perfect in the desired expression organism, and a CAI of > 0.8 is regarded as good, in terms of high gene expression level.

Amplification of PdGES
carrier
pUC57 vector

Introduction of pUC57:

pUC57 is a carrier of E.Coli and s cloning vector of 2710 bp. The promoter of pUC57 is lac and the replicon is ColE1 origin and the resistance of pUC57 is the ampicillin in prokaryotic. In addition, the aerobic environment with 37 degree Celsius in LB medium is the most suitable for pUC57 cultivation. In our experiment, we get gene PdGES and PcGES from pUC57 as our initial materials.

The sequences of common primer for pUC57:

5' sequencing primer M13R: CAGGAAACAGCTATGACC

3' sequencing primer M13F: TGTAAAACGACGGCCAGT

Fig. 1-2 The plasmid portfolio of pUC57

Amplification of PdGES

To obtain the target gene PdGES , using the specific primers to clone the targeted gene, our team amplify the template----vector pUC57 with PdGES ---- through PCR.

The sequence of forward primer is: AAAAACAACTAATTATTCGAAGATGGCGAGCGCGCGTAG

The sequence of reverse primer is: AGGCGAATTAATTCGCGGCGCTTTACAGCAGCGGGGTAA

As shown is figure 1-3, the size of PdGES shown on the picture matchs with the theoretical size of PdGES which is 1755 bp, we successfully clone the gene PdGES .

Fig. 1-3 Electrophoresis of PdGES PCR product.

The left column is the marker, and the two strips on the right are PCR products of PdGES .

The sizes of the two strips are about 2000 bp.

Construction of vectors
Construction of yeast expression vector pPIC9K

pPIC9K is a carrier for the expression of protein in yeast of 9276bp. The promoter of pPIC9K is AOX1 and the resistance of pPIC9K is the Ampicillin.

The sequences of common primer for pPIC9K:

5' sequencing primer is 5´-GACTGGTTCCAATTGACAAGC-3´

3' sequencing primer is 5´-GCAAATGGCATTCTGACATCC-3´

Fig. 1-4 The plasmid portfolio of pPIC9K

The vector pPIC9K used in our experiment doesn’t have the S part, because the S part is the secretion signal which can remove the protein we produce in the experiment. Since our purpose is to obtain the protein, we have to cut this part to make our experiment successful.

As shown in the diagram below, PdGES has been ligated to the yeast vector pPIC9K successfully. The process is achieved by digestion and ligation to BamHI and NotI. Finally, we transform the ligation product into competent cell yeast GS115.

Fig. 1-5 Electrophoresis of PdGES -contained pPIC9K vector.

The left column is the marker and the strips on the right are the PCR products of ligation of PdGES.

Construction of E. Coli expression vector pET32a

pET32a is a carrier for the expression of protein in E.Coli of 5900bp. The promoter of pET32a is T7, which is a strong primer that can express at any time, any cell under any circumstance. The resistance of pET32a is the Ampicillin.

The sequences of primer for pET32a:

5' sequencing primer is 5´-TAATACGACTCACTATAGGG-3´

3' sequencing primer is 5´-GCTAGTTATTGCTCAGCGG-3´

Fig. 1-6 The plasmid portfolio of pET32a

We try to ligate SpTPS1 gene into pET32a vector, but after three trails, we failed to ligate the intracellular device in pET32a. The possible explanation is the condition of ligation is not suitable or the sequence of this gene.

PcGES

PcGES, Pogostemon cablin geraniol synthase (GS1), is an also enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate(GPP)can be produced. The fuction of PcGES is to convert GPP to geraniol. PcGES functions the same as PdGES, the only difference is that they are from different species. By applying both GESs in our experiments, we can find out which one is more efficient by analyzing the efficiency of production.

Optimization of PcGES
The nucleotide sequence before optimization

(GenBank: KF926075.1)

ATGTCTTGTGCTAGAAGCTACACCATTCCTTTGTCCTTCCCCAAAACCTCTAATTCACCATTGCAACTAAAGAATCTCCTCCCTTTCCCCGCCGCCCGGTCGCGTTTTTCCGTGCGCATGTCCACCTCGTCCCTTCCCGTTGGCAACGAAGCCCTACTAAAATACATTCGACAACCCGTGGTGTTGCCTACGGAAGAAGATGAGAGCATCAAGAGGAGAGATTATTTGCTCGAAAAAACTGCGAGGAGGTTAAGGACGAGTACGGGTAGTGTGGAGAAGCTTAAGCTTATCGATACGATCCAACGACTAGGAATCGATTATTATTTGGAGGACGATATAAACGTAGTACTTAGAAATGAGTACTATAATGGTAGGTCTAGTGAAGAAGACCTCTTCACTACAGCTCTAAGATTTCGTTTGCTTCGTCACAACGGCTTCCAAATTAGTTCTGATGTATTCATGAAATTCAAGGACAAAAATGGAAAATTCAAAAAATGGATAGCTGAGGATACAATAGGGTTACTGAGCTTATATGAGGCGTCGTATATGGGAGCTCATGGTGAAAAAATATTGGAAGAAGCGATGGAATTCTCGAGGTCACTCCTCAAGAGATCGCTTCCTCAGTTGCCTCCGAAGCTCCACGGGCAGGTGGCTCAAGCCTTGGAGCTTCCGAGACACCTGAGGATGGCTAGATTAGAAGCTCGACGGTTTGTCCAGCAATACGCTAAACAAAGTGACTGCGATCGTGACCTTTTGAACCTAGCAACATTGGATTATAACAAGGTTCAATTGCAGCACCAATTTGAACTTGCCGAAATTACAAGGTGGTGGCAACAGCTTGGTCTAGTAGAAAAGTTAACATTTGCACGAGATAGACCGTTGGAGTGTTTTTTGTGGACCGTTGGATTACTCCCAGAACCCAGATATTCCACGTGTCGAATTGAGATGGCCAAGACCATTGCTATTTTATTAGTCATTGACGATATTTTCGACACGTATGGCAAAATGGATGAACTCCTCCTCTTCACCCAAGCTATTAGAAGATGGGATCTTGAAGCAATGGATATCCTTCCGGAATACATGAAAATATGTTACATGGCATTATACAACACAACTAATGAAATATGCTACAAAGTGCTCAAACTCAATGGATGGAGTGTCCTTTCTTACCTTAAATCTACGTGGATAGATATGATAGAAGGTTTTATGGTGGAGGCAAAATGGTTGAATGGTGGTGGTGCACCAAACTTGGAAGAGTACCTTGAGAATGGAGTGTCTACGGCGGGTGCATACATGGCTCTGGTGCACCTCTTTTTCCTAATTGGAGAAGGCGTTAATGACCAAAATGCCCCACTCTTGACCAAAAAACCATACCCCAAGCTCTTCTCCGCCGCTGGCCGGATTCTTCGCCTCTGGGACGACCTCGGAACTGCCAAGGAGGAGCAAGAGCGAGGAGACGTAGCATCGAGCATCGAGTTTGTGATGAGAGAGAAAGAGGTGGAAAGTGAAGAAGAGGGAAGAAGATACATATTGGGAGAGATATATGAGTTATGGAAGGATTTGAATGGGGAGTTGATGTCCAAGAATGGAATGCCATTAGCGATTATTAAAGTCGCACTTAACATGGCACGAGCTTCCCAAGTGGTGTACAAGCATGAAGAGGACACTTATTTCTCCAGCGTGGATAATTACGTGGAAGCCCTCTTCTTCACTCCTCTTCCTTCATCCATCTAA

Optimization

In order to assure that PcGES ligate to the multiple clone sites of the vector successfully, we avoid all the common restriction enzyme cutting sites (EcoR I, Xba I, Spe I, Pst I, BamH I, Bgl II, Hind III, Kpn I, Nco I, Nde I,Not I,Sal I, Xho I, Polymerase slippage site, Polymerase slippage site, Frameshift element, ribosome binding site)when the synthesis is being performed.

To make the parts established by genes satisfy the need of constructing the vector pSBIC3, we avoid the restriction enzyme cutting sites, which are EcoR Ⅰ, Xba I, Spe I, Pst I.

To lig ate genes directly to the standard vector, we add the restriction enzyme cutting sites of Xba Ⅰ and Spe Ⅰ to the upstream and downstream of target gene.

The optimized sequence

ATGTCTTGTGCTAGATCATACACTATCCCATTATCTTTTCCAAAGACATCTAATTCACCATTACAATTGAAAAATTTGTTACCATTTCCAGCTGCAAGATCAAGATTTTCTGTTAGAATGTCTACATCTTCATTACCAGTTGGTAACGAAGCATTGTTGAAGTACATCAGACAACCAGTTGTTTTGCCAACAGAAGAAGATGAATCAATTAAAAGAAGAGATTATTTGTTGGAAAAGACTGCAAGAAGATTAAGAACTTCTACAGGTTCAGTTGAAAAATTGAAATTGATCGATACTATCCAAAGATTAGGTATCGATTACTACTTGGAAGATGATATCAACGTTGTTTTGAGAAACGAATACTACAACGGTAGATCATCTGAAGAAGATTTGTTTACTACAGCTTTGAGATTCAGATTGTTGAGACATAACGGTTTCCAAATTTCTTCAGATGTTTTTATGAAGTTTAAAGATAAGAATGGTAAATTCAAGAAATGGATTGCTGAAGATACAATCGGTTTGTTATCTTTATACGAAGCATCTTACATGGGTGCACATGGTGAAAAGATTTTGGAAGAAGCTATGGAATTTTCAAGATCATTGTTGAAGAGATCATTGCCACAATTGCCACCAAAATTACATGGTCAAGTTGCTCAAGCATTAGAATTGCCAAGACATTTGAGAATGGCTAGATTGGAAGCAAGAAGATTTGTTCAACAATACGCTAAACAATCTGATTGTGATAGAGATTTGTTGAATTTGGCAACTTTGGATTACAATAAGGTTCAATTACAACATCAATTCGAATTGGCTGAAATCACTAGATGGTGGCAACAATTGGGTTTGGTTGAAAAATTGACATTTGCAAGAGATAGACCATTGGAATGTTTCTTGTGGACTGTTGGTTTGTTACCAGAACCAAGATACTCTACTTGTAGAATCGAAATGGCTAAGACAATTGCAATCTTGTTAGTTATTGATGATATCTTCGATACTTATGGTAAAATGGATGAATTGTTGTTGTTTACACAAGCTATCAGAAGATGGGATTTGGAAGCAATGGATATCTTGCCAGAATACATGAAAATTTGTTATATGGCTTTATACAATACTACAAACGAAATTTGTTACAAGGTTTTGAAATTGAACGGTTGGTCTGTTTTGTCATATTTGAAATCTACATGGATCGATATGATCGAAGGTTTTATGGTTGAAGCTAAATGGTTGAATGGTGGTGGTGCTCCAAATTTGGAAGAATACTTAGAAAACGGTGTTTCAACTGCTGGTGCATACATGGCTTTAGTTCATTTGTTTTTCTTGATCGGTGAAGGTGTTAACGATCAAAACGCACCATTATTGACTAAGAAACCATACCCAAAATTGTTTTCTGCTGCTGGTAGAATTTTAAGATTGTGGGATGATTTGGGTACTGCTAAAGAAGAACAAGAAAGAGGTGACGTTGCATCTTCAATCGAATTTGTTATGAGAGAAAAAGAAGTTGAATCAGAAGAAGAAGGTAGAAGATACATCTTGGGTGAAATATATGAATTGTGGAAAGATTTGAACGGTGAATTGATGTCTAAAAATGGTATGCCATTGGCTATTATTAAGGTTGCATTGAACATGGCTAGAGCATCACAAGTTGTTTACAAGCATGAAGAAGATACATACTTTTCTTCAGTTGATAACTACGTTGAAGCATTGTTTTTCACTCCATTGCCATCTTCTATTTGA

Codon Adaptation Index (CAI)

PcGES

CAI: 0.93

Fig. 2-1 The distribution of codon usage frequency along the length of the gene sequence. A CAI of 1.0 is considered to be perfect in the desired expression organism, and a CAI of > 0.8 is regarded as good, in terms of high gene expression level.

Amplification of PcGES
carrier-pUC57 vector

The information of this vector is the same as PdGES (above 1.2.1.1)

verification of PcGES product

To obtain the target gene PcGES , using the specific primers to clone the target gene, we amplify the template is the vector pUC57 with PcGES through PCR.

The sequence of forward primer is: AAAAACAACTAATTATTCGAAGATGTCTTGTGCTAGATCAT

The sequence of reverse primer is: AGGCGAATTAATTCGCGGCGCTTTCAAATAGAAGATGGCAAT

As shown is figure 1-3, we successfully cloned gene PcGES , because the size of PcGES shown on the picture matches with the theoretical size of PcGES which is 1734 bp.

Fig. 2-2 Electrophoresis of PcGES PCR product.

The left column is the marker, and the two strips on the right are PCR products of PcGES.

The sizes of the two strips are about 2000 bp.

The We try to ligate SpTPS1 gene into pPIC9K and pET32a vector, but after three trails, we failed to ligate the vector. The possible explanation is the condition of ligation is not suitable or the sequence of this gene. But we successfully ligated SpTPS1 gene with OYE and 2A in pPIC9K and pET32a vector, the specific information will be show the following text.(3.)

HbOYE
Sequence of HbOYE

ATCTCTCTAATAATCATCTTCGTCAGCAGCAGCACAGCAGCAGCAGAAGAAAGTCATATATATATATATATCTTAGATTCATTTCAGTTCTAGATAAGAAGCAACAATGGCTGAAACTGGAACAGAAGGGACCGGGATCACCACCCTATTTTCTCCTTACAAAATGGGCAAGTTCAGCCTCTCCCACAGGGTGGTGCTGGCTCCCATGACTAGATGCAGAGCGTTGAACGGGATACCAAACGCAGCGCTGGTGGATTACTACACGCAGAGATCAACTCCCGGCGGATTTCTCATCACGGAAGGCACTCTGGTTTCCCCTACTGCCCCTGGGTTTCCTCATGTCCCTGGAATTTATACAGAAGAACAAGCGGAGGCATGGAAGAGGGTGGTGGATGCAGTTCATGCCAAAGGGAGCATCATATTCTGTCAATTATGGCATGTTGGCCGCGCATCTCATCAGGTTTATCAACCTAATGGAGCGCACCAATATCATCGACGGGCAAGGCCATCTCAAACAGATGGAGAATTCTCATGCCAGATGGATCATATGGGAAATACCCAACACCTAGGCCCTTGGAAACACCTGAAATACTAGAGGTAGTGAAGAATTATCGCCAGTCAGCCTTGAATGCCATTCGAGCAGGCTTTGATGGAATTGAGGTCCACGGGGCTCATGGTTACCTTATTGATCAATTCTTAAAAGACGGGATCAATGACCGAACAGATGAGTATGGTGGATCAATCAACAATCGATGCAGATTCCTAATGCAGGTGATTCAGGCAGTAGTTGCAGCTATTGGTGCTGATCGAGTTGGTTTCAGAATGTCACCGGCAATTGATCACCTAGATGCCATAGATTCTGATCCGCTCAACTTGGGTCTTGCTGTAATCGAGAGACTTAACAAACTTCAGTTGAACCTTGGATCAAAACTCACTTATCTCCATGTCACTCAGCCTCGCTACACAGCTTATGGCCAAACAGAATCAGGCAGACATGGTACTGAAGAAGAGGAAGCTAGATTAATGAGAACTTGGAGAAGGGCTTATAAGGGAACTTTCATCTGTAGCGGTGGGTTCACGAGGGAGCTAGGAATGGAAGCTATAGCTCAAGATGATGCAGATTTGGTATCTTATGGCCGACTTTTTATTTCAAACCCAGACTTAGTCTTGAGATTTAAGCTCAATGCGCCCTTGAATAAGTATGTCAGGAAAACATTCTACACCCAAGATCCTGTTGTTGGGTACACAGACTACCCATTTTTCAGAAAAGTAGACGGGAGCCAGGAGCCACGATCACGCCTTTGAATCTGTAGTCTTTGGAATAATTATACATGTATTTAAACATATGATATTTTGTTTGAACTTTATTATATCAGTGAACATCTTGATTAAAAGACAACATCCTCTAAGAAGAGGATTTTTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Amplification of HbOYE
carrier-pUC57 vector

The information of this vector is the same as PdGES (above 1.2.1.1)

verification of HbOYE product

To obtain the target gene HbOYE, using the specific primers to clone the targeted gene,our team amplify the template is the vector pUC57 with HbOYE through PCR.

The sequence of forward primer is: TTTTATTTCAAACCCAGAC

The sequence of reverse primer is: GGTGGTGGTGCTCGAGTCTTTTAATTGATTCATCT

As shown is figure 1-3, we successfully cloned gene HbOYE, because the size of HbOYE shown on the picture matches with the theoretical size of HbOYE which is 1455 bp.

Fig. 3-1 Electrophoresis of HbOYE PCR products.

The left column is the marker, and the two strips on the right are PCR products of HbOYE.

The sizes of the two strips are about 1200 bp.

Ligation of HbOYE fragment to pET32a vector
pET32a vector

pET32a is a carrier of E.Coli of 5900bp. The promoter of pET32a is T7 and the resistance of pET32a is the Ampicillin. The information of this vector is the same as PdGES (above 1.3.2)

3.3.2 Ligation of HbOYE fragment to pET32a vector

we use the restriction endonuclease BamH I and Xho I to cut the E. Coli expression vector pET32a and make it ligated with HbOYE (1.2 kb), and the result has been shown positive through PCR.

Then we ligate the product with T4 vector for sequencing. Eventually, the product has been transformed into the competent cell E. Coli complement cell DH5α, and the result of sequencing is 100% matched.

Fig. 3-2 Electrophoresis of HbOYE -contained pET32a vector.

The left column is the marker and the strips on the right are all the samples of combination of HbOYE and pFT32a. According to the graph, the size is between 1000 bp and 750 bp, so the result is positive.

Ligation of HbOYE fragment to pPIC9K vector
pPIC9K vector

pPIC9K is a carrier for the expression of protein in yeast of 9276bp. The promoter of pPIC9K is AOX1 and the resistance of pPIC9K is the Ampicillin. The information of this vector is the same as PdGES (above 1.3.1)

3.4.2 Ligation of HbOYE fragment to pPIC9K vector

We utilize restriction endonuclease Bam H I and NotI to cut the yeast expression vector PIC9K and make it ligated with HbOYE (about 1.2 kb), and the result has been shown positive through PCR.

Fig. 3-3 Electrophoresis of HbOYE -contained pPIC9K vector.

The left column is the marker and the strips on the right are all the samples of combination of HbOYE and pPIC9K. According to the graph, the size is between 1000 bp and 2000 bp, so the result is positive.

Ligation of HbOYE with 2A and GES to pPIC9K vector and pET32a vector

To improve the efficiency of production while keeping the two proteins independent at the same time, we decide to combine OYE and GES together. It turns out that we choose 2A as a ‘bridge’ to link the two genes because the protein translated by 2A can be cut by certain enzymes automatically. 2A, known as CHYSEL polypeptides, contains the peptide bond to grow the peptide chain which helps to link two genes. The presence of the conserved CHYSEL residues in the peptides contributes to form a torsion which causes the peptide chain to be released later, and then the two genes can express in a cell separately. Furthermore, we employ two kinds of 2A, which are F2A and P2A. By doing so, we can compare the efficiencies of them and choose one which is more efficient.

F2A sequence:

CAGCTGTTGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTCGAGTCCAACCCTGGGCCC

P2A sequence:

GGAAGCGGAGCGACGAATTTTAGTCTACTGAAACAAGCGGGAGACGTGGAGGAAAACCCTGGACCT

HbOYE+2A

By using Net-PCR, we combine the HbOYE with 2A. 2A is a piece of peptide which can combine two genes together and be cut at 3’ prime end when the DNA is translated into mRNA. After being cut, the two genes can still perform their functions correctly in the latter steps. The picture of electrophoresis following shows the positive result of the combination. This product will be used in the final step of our experiment. Because of the function domain of GES is on the 3’ end,the 2A which can express 20 amino acids which may influence the function of GES protein, so we ligated OYE with 2A first, the ligate GES after 2A.

Fig. 3-4 Eelectrophoresis of HbOYE +2A -contained pPIC9K vector. The left column is the marker and the strips on the right are all the samples of combination of HbOYE and 2A. According to the graph, the size of HbOYE +2A is between 1000 bp and 2000 bp, so the result is positive.

Fig. 3-5 Eelectrophoresis of HbOYE+2A-contained pET32a vector. The M stands for the marker and the 1,2,3 stand for samples of combination of HbOYE and 2A. lane 1 and 2 is the HbOYE + F2A,3 stands for HbOYE + P2A. According to the graph, we use a part of sequence to measure, so the result is positive.

HbOYE+2A+PcGES

By using Net-PCR, we combine the previous product (HbOYE with 2A) and PcGES. The picture of electrophoresis following shows the positive result of the combination. This product is our final product of the whole experiments.

Fig. 3-6 Electrophoresis of HbOYE+2A+PcGES-contained pET32a vector.

The M stands for the marker and the 1,2,3 stand for samples of combination of HbOYE +2A and PcGES. 1 and 2 is the HbOYE+2A+PcGES, 3 and 4 stands for HbOYE + P2A+ PcGES. According to the graph, we use a part of sequence to measure, so the result is positive.

Fig. 3-7 Electrophoresis of HbOYE+F2A+PcGES-contained pPIC9K vector.

The M stands for the marker and the 1,2,3 stand for samples of combination of HbOYE +2A and PcGES. 1 and 2 is the HbOYE + F2A+PcGES, According to the graph, we use a part of sequence to measure, so the result is positive.

ScOYE
nucleotide sequence of ScOYE

ATGCCATTTGTTAAGGACTTTAAGCCACAAGCTTTGGGTGACACCAACTTATTCAAACCAATCAAAATTGGTAACAATGAACTTCTACACCGTGCTGTCATTCCTCCATTGACTAGAATGAGAGCCCAACATCCAGGTAATATTCCAAACAGAGACTGGGCCGTTGAATACTACGCTCAACGTGCTCAAAGACCAGGAACCTTGATTATCACTGAAGGTACCTTTCCCTCTCCACAATCTGGGGGTTACGACAATGCTCCAGGTATCTGGTCCGAAGAACAAATTAAAGAATGGACCAAGATTTTCAAGGCTATTCATGAGAATAAATCGTTCGCATGGGTCCAATTATGGGTTCTAGGTTGGGCTGCTTTCCCAGACACCCTTGCTAGGGATGGTTTGCGTTACGACTCCGCTTCTGACAACGTGTATATGAATGCAGAACAAGAAGAAAAGGCTAAGAAGGCTAACAACCCACAACACAGTATAACAAAGGATGAAATTAAGCAATACGTCAAAGAATACGTCCAAGCTGCCAAAAACTCCATTGCTGCTGGTGCCGATGGTGTTGAAATCCACAGCGCTAACGGTTACTTGTTGAACCAGTTCTTGGACCCACACTCCAATAACAGAACCGATGAGTATGGTGGATCCATCGAAAACAGAGCCCGTTTCACCTTGGAAGTGGTTGATGCAGTTGTCGATGCTATTGGCCCTGAAAAAGTCGGTTTGAGATTGTCTCCATATGGTGTCTTCAACAGTATGTCTGGTGGTGCTGAAACCGGTATTGTTGCTCAATATGCTTATGTCTTAGGTGAACTAGAAAGAAGAGCTAAAGCTGGCAAGCGTTTGGCTTTCGTCCATCTAGTTGAACCTCGTGTCACCAACCCATTTTTAACTGAAGGTGAAGGTGAATACAATGGAGGTAGCAACAAATTTGCTTATTCTATCTGGAAGGGCCCAATTATTAGAGCTGGTAACTTTGCTCTGCACCCAGAAGTTGTCAGAGAAGAGGTGAAGGATCCTAGAACATTGATCGGTTACGGTAGATTTTTTATCTCTAATCCAGATTTGGTTGATCGTTTGGAAAAAGGGTTACCATTAAACAAATATGACAGAGACACTTTCTACAAAATGTCAGCTGAGGGATACATTGACTACCCTACGTACGAAGAAGCTCTAAAACTCGGTTGGGACAAAAATTAA

Amplification of ScOYE
carrier-pUC57

The information of this vector is the same as PdGES (above 1.2.1.1)

verification of ScOYE product

To obtain the target gene ScOYE , using the specific primers to clone the targeted gene,we amplify the template is the vector pUC57 with HbOYE through PCR.

The sequence of forward primer is:AAAAACAACTAATTATTCGAAGATGCCATTTGTTAAGGACT

The sequence of reverse primer is: AGGCGAATTAATTCGCGGCGCTTTTTTGTCCCAACCG

As shown is figure 1-3, we successfully cloned gene ScOYE , because the size of ScOYE shown on the picture matches with the theoretical size of ScOYE which is 1203 bp.

Fig. 4-1 The picture of electrophoresis of ScOYE.

The left column is the marker, and the two strips on the right are PCR products of ScOYE.

The sizes of the two strips are more than 1000 bp.

Ligation of ScOYE in E.Coli
Ligation of ScOYE fragment to pET32a vector

We uses the restriction endonuclease BamH I and Xho I to cut the E. Coli expression vector pET32a and make it ligated with ScOYE, and the result has been shown positive through PCR.

Then we ligate the product with T4 vector for sequencing. Eventually, the product has been transformed into the E. Coli competent cell DH5α, and the result of sequencing is 100% matched.

Fig. 4-2 Electrophoresis of ScOYE -contained pET32a vector. The left column is the marker and the strips on the right are all the samples of combination of ScOYE and pET32a. According to the graph, the size is between 1000 bp and 2000 bp, so the result is positive.

Ligation of ScOYE in Yeast

We plan to striction endonuclease BamH I and NotI to cut the yeast expression vector PIC9K and make it ligated with ScOYE. Then combine the previous product (ScOYE with 2A) and PcGES. but the time is limitated.