Difference between revisions of "Team:ZJU-China/Part Collection"

 
(5 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
 
<html lang="zh-CN">
 
<html lang="zh-CN">
 
   <head>
 
   <head>
 
  
 
<link href="https://2017.igem.org/Zju/css/bootstrap?action=raw&ctype=text/css" rel="stylesheet" media="screen" />
 
<link href="https://2017.igem.org/Zju/css/bootstrap?action=raw&ctype=text/css" rel="stylesheet" media="screen" />
 
<link href="https://2017.igem.org/Zju/css/bootstraptheme?action=raw&ctype=text/css" rel="stylesheet" id="bs-theme-stylesheet">
 
<link href="https://2017.igem.org/Zju/css/bootstraptheme?action=raw&ctype=text/css" rel="stylesheet" id="bs-theme-stylesheet">
<link href='https://2017.igem.org/Team:ZJU-China/cs/font?action=raw&ctype=text/css' rel='stylesheet' type='text/css'>
 
 
<link href="https://2017.igem.org/Zju/css/docs/min?action=raw&ctype=text/css" rel="stylesheet" type="text/css"/>
 
<link href="https://2017.igem.org/Zju/css/docs/min?action=raw&ctype=text/css" rel="stylesheet" type="text/css"/>
 +
<!-- <link href="css/doc-style.css" rel="stylesheet" type="text/css"/> -->
 
<link href="https://2017.igem.org/Zju/css/doc-style?action=raw&ctype=text/css" rel="stylesheet">
 
<link href="https://2017.igem.org/Zju/css/doc-style?action=raw&ctype=text/css" rel="stylesheet">
 
<link href="https://2017.igem.org/Zju/css/responsive/min?action=raw&ctype=text/css" rel="stylesheet">
 
<link href="https://2017.igem.org/Zju/css/responsive/min?action=raw&ctype=text/css" rel="stylesheet">
 
+
<!-- 按钮的字体 -->
 +
<link href='http://fonts.googleapis.com/css?family=Yanone+Kaffeesatz:700' rel='stylesheet' type='text/css'>
 +
<!-- 按钮的字体end -->
 
<script>
 
<script>
 
   var _hmt = _hmt || [];
 
   var _hmt = _hmt || [];
 
</script>
 
</script>
      <link rel="stylesheet" href="../css/doc-style.css">
 
 
   </head>
 
   </head>
  
Line 68: Line 67:
  
 
#content_wrapper p {
 
#content_wrapper p {
     font-family: 'Tempus Sans ITC',Tahoma, Geneva, sans-serif;
+
     font-family: 'Yanone Kaffeesatz',Tahoma, Geneva, sans-serif;
 
}
 
}
  
Line 99: Line 98:
 
   vertical-align: baseline;
 
   vertical-align: baseline;
 
   font-size: 0.875em;
 
   font-size: 0.875em;
   font-family:'Tempus Sans ITC', verdana, sans-serif;
+
   font-family:'Yanone Kaffeesatz', verdana, sans-serif;
 
}
 
}
  
Line 108: Line 107:
 
   margin-top: 0.2em;
 
   margin-top: 0.2em;
 
   color: #3399ff;
 
   color: #3399ff;
   font-family:'Tempus Sans ITC', verdana, sans-serif;
+
   font-family:'Yanone Kaffeesatz', verdana, sans-serif;
 
}
 
}
  
Line 116: Line 115:
 
   margin-top: 1em;
 
   margin-top: 1em;
 
   text-align: left;
 
   text-align: left;
   font-family:'Tempus Sans ITC', verdana, sans-serif;
+
   font-family:'Yanone Kaffeesatz', verdana, sans-serif;
 
}
 
}
  
 
.TextContent p{
 
.TextContent p{
 
   margin-bottom: 1.2em;
 
   margin-bottom: 1.2em;
   font-family:'Tempus Sans ITC', verdana, sans-serif;
+
   font-family:'Yanone Kaffeesatz', verdana, sans-serif;
 
}
 
}
  
Line 217: Line 216:
 
     font-weight: 100;
 
     font-weight: 100;
 
     text-align: left;
 
     text-align: left;
 +
    line-height: 35px;
 
}
 
}
  
Line 248: Line 248:
 
     width: 100px;
 
     width: 100px;
 
}
 
}
 +
  
  
 
.ArticleHead{
 
.ArticleHead{
  font-family: 'Tempus Sans ITC',georgia !important;
+
    font-family: 'Tempus Sans ITC',georgia !important;
  font-size: 40px !important;
+
    font-size: 40px !important;
  font-weight: 800 !important;
+
    font-weight: 800 !important;
  color: #56A36C !important;
+
    color: #56A36C !important;
  text-align: center !important;
+
    text-align: center !important;
 
     margin-bottom: 0 !important;
 
     margin-bottom: 0 !important;
     /*margin-top: .6em !important;*/
+
     margin-top: .6em !important;
 
}
 
}
  
 
.H3Head{
 
.H3Head{
  font-family: 'Tempus Sans ITC',georgia !important;
+
    font-family: 'Tempus Sans ITC',georgia !important;
  color: #FEC43E !important;
+
    color: #FEC43E !important;
  font-size: 25px !important;
+
    font-size: 25px !important;
  font-weight: 400 !important;
+
    font-weight: 400 !important;
  text-align: left !important;
+
    text-align: left !important;
 
     margin-bottom: 0 !important;
 
     margin-bottom: 0 !important;
 
     margin-top:.6em !important;
 
     margin-top:.6em !important;
Line 271: Line 272:
  
 
.PP{
 
.PP{
  font-family:Tahoma, Geneva, sans-serif !important;
+
    font-family:Tahoma, Geneva, sans-serif !important;
  font-size: 20px !important;
+
    font-size: 20px !important;
  font-weight: 100 !important;
+
    font-weight: 100 !important;
  text-align: left !important;
+
    text-align: left !important;
 
}
 
}
  
  
 
.Retract{
 
.Retract{
  padding-left: 50px;
+
    padding-left: 50px;
 
}
 
}
  
 
.GreenAH{
 
.GreenAH{
  color: #56A36C;
+
    color: #56A36C;
 
}
 
}
  
 
.YellowAH{
 
.YellowAH{
  color: #FEC43E;
+
    color: #FEC43E;
 
}
 
}
  
Line 298: Line 299:
 
}
 
}
  
.grayTable
 
{
 
    background-color: #979797;
 
}
 
  
.yellowTable
 
{
 
    background-color: #CD9B1D;
 
    color: #000;
 
}
 
  
 
h2{
 
h2{
  font-family: 'Tempus Sans ITC';
+
    font-family: 'Tempus Sans ITC';
  font-weight: 500;
+
    font-weight: 500;
  font-size: 35px;
+
    font-size: 35px;
  text-align: left;
+
    text-align: left;
 
}
 
}
  
 
h3{
 
h3{
  font-family: 'Tempus Sans ITC';
+
    font-family: 'Tempus Sans ITC';
  font-weight: 500;
+
    font-weight: 500;
  font-size: 32px;
+
    font-size: 32px;
  text-align: left;
+
    text-align: left;
 
}
 
}
  
 
h4{
 
h4{
  font-family: 'Tempus Sans ITC';
+
    font-family: 'Tempus Sans ITC';
  font-weight: 500;
+
    font-weight: 500;
  font-size: 28px;
+
    font-size: 28px;
  text-align: left;
+
    text-align: left;
 
}
 
}
  
 
h5{
 
h5{
  font-family: 'Tempus Sans ITC';
+
    font-family: 'Tempus Sans ITC';
  font-weight: 500;
+
    font-weight: 500;
  font-size: 25px;
+
    font-size: 25px;
  text-align: left;
+
    text-align: left;
 
}
 
}
  
 
p{
 
p{
  margin:0;
+
    margin:0;
  font-size:17px;
+
    font-size:17px;
  line-height: 30px;
+
    line-height: 30px;
  /*padding-bottom: 20px;*/
+
    /*padding-bottom: 20px;*/
  color: #111111;
+
    color: #111111;
 
}
 
}
  
Line 360: Line 352:
 
     text-align: left !important;
 
     text-align: left !important;
 
}
 
}
 +
/*文中自定义*/
  
.nonStyleTable
+
/*老姜要好看一点的表格*/
{
+
.tableNice thead, .tableNice tr {
     background: transparent !important;
+
    text-align: center;
     border:none !important;
+
    border-top-width: 1px;
 +
    border-top-style: solid;
 +
    border-top-color: #b1c6d9;
 +
}
 +
.tableNice {
 +
     width: auto;
 +
    align: center;
 +
    border-bottom-width: 1px;
 +
    border-bottom-style: solid;
 +
     border-bottom-color: #D0E9FF;
 
}
 
}
  
.textimg{
+
/* Padding and font style */
    /*width:50%;*/
+
.tableNice td, .tableNice th {
     /*margin-top: 20px;*/
+
     padding: 5px 10px;
     /*padding-bottom: 20px;*/
+
     font-size: 12px;
     text-align: center;
+
 
 +
     color: #00343F;
 
}
 
}
  
.redgene
+
/* Alternating background colors */
{
+
.tableNice tr:nth-child(even) {
     color: #53b172 !important;
+
    background: transparent;
 +
 
 +
}
 +
.tableNice tr:nth-child(odd) {
 +
     background: #EBFFFF;
 
}
 
}
  
/*文中自定义*/
+
.tableOuter
 +
{
 +
    align: center;
 +
    text-align: left;
 +
}
 +
/*老姜要好看一点的表格止*/
 
</style>
 
</style>
  
Line 387: Line 399:
 
                   <!-- <h1><a class="navbar-brand" href="index.html">MuMei Lab</a></h1> -->
 
                   <!-- <h1><a class="navbar-brand" href="index.html">MuMei Lab</a></h1> -->
  
    <div class="container">
+
 
 +
  <div class="container">
 
       <!-- header -->
 
       <!-- header -->
 
       <div class="header-w3layouts">
 
       <div class="header-w3layouts">
Line 412: Line 425:
 
                           <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Overview<b class="caret"></b></a>
 
                           <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Overview<b class="caret"></b></a>
 
                           <ul class="dropdown-menu ">
 
                           <ul class="dropdown-menu ">
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Overview">Project Description</a></li>
+
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Overview">Description</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Demonstrate">Demonstrate</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Demonstrate">Demonstrate</a></li>
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Achievements">Achievements</a></li>
 
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Applied_Design">Applied Design</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Applied_Design">Applied Design</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Achievements">Achievements</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Improve">Improve Parts</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Improve">Improve Parts</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/InterLab">InterLab</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/InterLab">InterLab</a></li>
Line 425: Line 438:
 
                           <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Project<b class="caret"></b></a>
 
                           <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Project<b class="caret"></b></a>
 
                           <ul class="dropdown-menu ">
 
                           <ul class="dropdown-menu ">
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Project/st">Chemical Transduction</a></li>
 
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Project/mt">Medium Wave Transduction</a></li>
 
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Project/tp">Trichoderma Proof</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Project/tp">Trichoderma Proof</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Project/voc">VOC sensors</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Project/voc">VOC sensors</a></li>
 +
                              <li><a style="font-size: 0.7em!important;" href="https://2017.igem.org/Team:ZJU-China/Project/st">Chemical Signal Transduction</a></li>
 +
                              <li><a style="font-size: 0.7em!important;" href="https://2017.igem.org/Team:ZJU-China/Project/mt">Medium Wave Transduction</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Project/Downstream">Downstream</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Project/Downstream">Downstream</a></li>
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Project/conclusion">Conclusion</a></li>
+
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Project/conclusion">Conclusions</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Notebook">Notebook</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Notebook">Notebook</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Protocols">Protocols</a></li>
 
                           </ul>
 
                           </ul>
 
                       </li>
 
                       </li>
Line 448: Line 462:
 
                           <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Parts<b class="caret"></b></a>
 
                           <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Parts<b class="caret"></b></a>
 
                           <ul class="dropdown-menu ">
 
                           <ul class="dropdown-menu ">
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Parts">All Parts</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Basic_Part">Basic Parts</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Composite_Part">Composite Parts</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Composite_Part">Composite Parts</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Part_Collection">Part Collection</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Part_Collection">Part Collection</a></li>
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Basic_Part">Basic Parts</a></li>
+
 
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Parts">All Parts</a></li>
+
 
  
  
Line 457: Line 473:
 
                       </li>
 
                       </li>
  
                       <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware">Hardware</a></li>
+
                       <li class="m_nav_item dropdown" >
 +
                          <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Hardware<b class="caret"></b></a>
 +
                          <ul class="dropdown-menu ">
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware">Overview</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware/Device">Device</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware/Improvements">Improvements</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware/MediumWave">Medium Wave</a></li>
 +
                          </ul>
 +
                      </li>
  
 
                       <li class="m_nav_item dropdown" >
 
                       <li class="m_nav_item dropdown" >
Line 481: Line 505:
 
                           <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Team<b class="caret"></b></a>
 
                           <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Team<b class="caret"></b></a>
 
                           <ul class="dropdown-menu ">
 
                           <ul class="dropdown-menu ">
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Collaborations">Collaboration</a></li>
 
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Team">Teammates</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Team">Teammates</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Attributions">Attribution</a></li>
 
                               <li><a href="https://2017.igem.org/Team:ZJU-China/Attributions">Attribution</a></li>
 +
                              <li><a href="https://2017.igem.org/Team:ZJU-China/Collaborations">Collaboration</a></li>
 
                           </ul>
 
                           </ul>
 
                       </li>
 
                       </li>
 
 
                   </ul>
 
                   </ul>
 
               </div>
 
               </div>
Line 493: Line 516:
 
   </div>
 
   </div>
  
<p></p>
+
  <p></p>
<div style="margin-top:0;padding-top:0">
+
  <img src="https://static.igem.org/mediawiki/2017/6/61/ZJU_China_interlab_header.jpg" width="100%">
+
  <!-- <img src="images/HP_temp/banner.jpg" width="100%"> -->
+
</div>
+
 
+
  
 
<div style="width: 100%" class="container zjuContent">
 
<div style="width: 100%" class="container zjuContent">
Line 505: Line 523:
 
       <div class="bs-docs-section">
 
       <div class="bs-docs-section">
  
 +
          <div style="height: 50px;"></div>
  
  <h1 id="improve" class="ArticleHead GreenAH">Part Collection</h1>
+
          <h1 id="improve" class="page-header ArticleHead GreenAH">Part Collection</h1>
      <p class="PP">It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the Wild-type T7 promoter to get a collection of modified T7 promoters.</p>
+
          <p class="PP"><br/>It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the wild-type T7 promoter to get a collection of modified T7 promoters.</p>
      <p class="PP">T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the site from -20 to -12. The sequences of these modified promoters are shown in the Table below.</p>
+
          <p class="PP">T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the range from -20 to -12. The sequences of these modified promoters are shown in the Table below.</p>
    <h2 id="sms" class="H2Head">Sequences of Modified Promoters</h2>
+
          <h2 id="sms" class="H2Head">Sequences of Modified Promoters</h2>
 
           <table class="table">
 
           <table class="table">
 
               <tr><th class="yellowTable">Part number</th><th class="yellowTable">Sequence(-20~+6)</th></tr>
 
               <tr><th class="yellowTable">Part number</th><th class="yellowTable">Sequence(-20~+6)</th></tr>
Line 522: Line 541:
 
           </table>
 
           </table>
  
      <h2 id="test" class="H2Head">Test</h2>
+
          <h2 id="test" class="H2Head">Test</h2>
           <p class="PP">To test the function of mutant promoters, we chose the <a class="cite" href="http://parts.igem.org/Part:BBa_E1010">mRFPas</a> our reporter. By assessing the relative fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure below.</p>
+
           <p class="PP">To test the function of mutant promoters, we chose the <a class="cite" href="http://parts.igem.org/Part:BBa_E1010">mRFP</a> as our reporter. By assessing the absolute fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure and Table below.</p>
 
           <div class="imgdiv"><img class="textimg" src="https://static.igem.org/mediawiki/2017/2/23/ZJU_China_imporve_1.png"></div>
 
           <div class="imgdiv"><img class="textimg" src="https://static.igem.org/mediawiki/2017/2/23/ZJU_China_imporve_1.png"></div>
            <p class="capture">Relative Strength of wildtype T7 promoter and mutant promoters</p>
+
          <p class="capture">Fig.1 Relative Strength of wildtype T7 promoter and mutant promoters</p>
 +
 
 +
          <table class="table">
 +
              <tr><th class="yellowTable">Part number</th><th class="yellowTable">Relative Strength</th></tr>
 +
              <tr><th class="grayTable">BBa_K525998(wild type)</th><th>1</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207024</th><th>0.26</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207025</th><th>11.44</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207026</th><th>9.15</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207027</th><th>7.57</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207028</th><th>8.41</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207029</th><th>3.65</th></tr>
 +
              <tr><th class="grayTable">BBa_K2207030</th><th>6.79</th></tr>
 +
          </table>
 +
 
 
           <p class="PP">As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.</p>
 
           <p class="PP">As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.</p>
  
 +
          <h2 id="ref" class="H2Head">Reference</h2>
 +
          <p class="ref">[1] Ikeda R A, Ligman C M, Warshamana S, et al. T7 promoter contacts essential for promoter activity in vivo[J]. Nucleic Acids Research, 1992, 20(10): 2517-2524.</p>
 +
          <p class="ref">[2] Tang G, Bandwar R P, Patel S S, et al. Extended Upstream A-T Sequence Increases T7 Promoter Strength[J]. Journal of Biological Chemistry, 2005, 280(49): 40707-40713.</p>
  
</div>
 
  
 +
      </div>
 +
       
  
  
 
<!-- 右侧监听开始 -->
 
<!-- 右侧监听开始 -->
 
<div class="col-md-3 disappear-on-top" role="complementary">
 
<div class="col-md-3 disappear-on-top" role="complementary">
   <nav  style="position: fixed; top: 100px ; left:50px; " class="bs-docs-sidebar hidden-print hidden-xs hidden-sm">
+
   <nav  style="position: fixed; top: 100px ; left:50px;" class="bs-docs-sidebar hidden-print hidden-xs hidden-sm">
 
     <ul class="nav bs-docs-sidenav shorterli">
 
     <ul class="nav bs-docs-sidenav shorterli">
 
         <li><a href="#improve">Improve Part</a></li>
 
         <li><a href="#improve">Improve Part</a></li>
         <li><a href="#sms">Sequences of Modified Promoters</a></li>
+
         <li><a href="#sms">Sequences info</a></li>
 
         <li><a href="#test">Test</a></li>
 
         <li><a href="#test">Test</a></li>
 
+
        <li><a href="#ref">Reference</a></li>
 
     </ul>
 
     </ul>
  
 
   <a class="back-to-top" href="#top">
 
   <a class="back-to-top" href="#top">
 
   <!--  <i class="fa fa-arrow-up nav_icon"></i> -->
 
   <!--  <i class="fa fa-arrow-up nav_icon"></i> -->
    <img style="width: 50px;" src="https://static.igem.org/mediawiki/2017/d/da/ZJU_China_UP.png">
+
      <img style="width: 50px;" src="https://static.igem.org/mediawiki/2017/d/da/ZJU_China_UP.png">
 
   </a>
 
   </a>
  
Line 560: Line 596:
 
       <p><br></p>
 
       <p><br></p>
 
     <p class="copyright">Copyright &copy; 2017 ZJU-IGEM | <a href="http://www.zju.edu.cn/">Zhejiang University</a> |</p>
 
     <p class="copyright">Copyright &copy; 2017 ZJU-IGEM | <a href="http://www.zju.edu.cn/">Zhejiang University</a> |</p>
    <p><br></p>
+
      <p><br></p>
 +
    <!--<p class="copyright">Contact us:<a class="copyright" href="">WeChat</a></p>-->
 
   </div>
 
   </div>
 
</div>
 
</div>
Line 574: Line 611:
 
   <script src="https://static.igem.org/mediawiki/2017/e/e0/ZJUChina_button.txt"></script>
 
   <script src="https://static.igem.org/mediawiki/2017/e/e0/ZJUChina_button.txt"></script>
  
  <!--<script src="js/scrolling-nav.js"></script>-->
+
 
   <script src="https://2017.igem.org/Zju/js/scrollingnav?action=raw&ctype=text/javascript"></script>
+
   <script src="https://2017.igem.org/Team:ZJU-China/js/scrollingnavnonPic?action=raw&ctype=text/javascript"></script>
 
   <script src="https://static.igem.org/mediawiki/2017/c/c0/ZJUChina_txtSmoothScroll.min.txt"></script>
 
   <script src="https://static.igem.org/mediawiki/2017/c/c0/ZJUChina_txtSmoothScroll.min.txt"></script>
  
 
   </body>
 
   </body>
 
</html>
 
</html>

Latest revision as of 15:18, 1 November 2017

Part Collection


It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the wild-type T7 promoter to get a collection of modified T7 promoters.

T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the range from -20 to -12. The sequences of these modified promoters are shown in the Table below.

Sequences of Modified Promoters

Part numberSequence(-20~+6)
BBa_K525998(wild type)gagtaatacgactcactatagggaaa
BBa_K2207024tagtaatacgactcactatagggaaa
BBa_K2207025aagtaatacgactcactatagggaaa
BBa_K2207026gaataatacgactcactatagggaaa
BBa_K2207027gattaatacgactcactatagggaaa
BBa_K2207028gattaataagactcactatagggaaa
BBa_K2207029gattaatatgactcactatagggaaa
BBa_K2207030tattaatacgactcactatagggaaa

Test

To test the function of mutant promoters, we chose the mRFP as our reporter. By assessing the absolute fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure and Table below.

Fig.1 Relative Strength of wildtype T7 promoter and mutant promoters

Part numberRelative Strength
BBa_K525998(wild type)1
BBa_K22070240.26
BBa_K220702511.44
BBa_K22070269.15
BBa_K22070277.57
BBa_K22070288.41
BBa_K22070293.65
BBa_K22070306.79

As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.

Reference

[1] Ikeda R A, Ligman C M, Warshamana S, et al. T7 promoter contacts essential for promoter activity in vivo[J]. Nucleic Acids Research, 1992, 20(10): 2517-2524.

[2] Tang G, Bandwar R P, Patel S S, et al. Extended Upstream A-T Sequence Increases T7 Promoter Strength[J]. Journal of Biological Chemistry, 2005, 280(49): 40707-40713.