Difference between revisions of "Team:ZJU-China/Part Collection"
Zhiling Zhou (Talk | contribs) |
Zhiling Zhou (Talk | contribs) |
||
| (3 intermediate revisions by the same user not shown) | |||
| Line 445: | Line 445: | ||
<li><a href="https://2017.igem.org/Team:ZJU-China/Project/conclusion">Conclusions</a></li> | <li><a href="https://2017.igem.org/Team:ZJU-China/Project/conclusion">Conclusions</a></li> | ||
<li><a href="https://2017.igem.org/Team:ZJU-China/Notebook">Notebook</a></li> | <li><a href="https://2017.igem.org/Team:ZJU-China/Notebook">Notebook</a></li> | ||
| + | <li><a href="https://2017.igem.org/Team:ZJU-China/Protocols">Protocols</a></li> | ||
</ul> | </ul> | ||
</li> | </li> | ||
| Line 472: | Line 473: | ||
</li> | </li> | ||
| − | <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware">Hardware</a></li> | + | <li class="m_nav_item dropdown" > |
| + | <a href="#" class="dropdown-toggle link" data-toggle="dropdown">Hardware<b class="caret"></b></a> | ||
| + | <ul class="dropdown-menu "> | ||
| + | <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware">Overview</a></li> | ||
| + | <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware/Device">Device</a></li> | ||
| + | <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware/Improvements">Improvements</a></li> | ||
| + | <li><a href="https://2017.igem.org/Team:ZJU-China/Hardware/MediumWave">Medium Wave</a></li> | ||
| + | </ul> | ||
| + | </li> | ||
<li class="m_nav_item dropdown" > | <li class="m_nav_item dropdown" > | ||
| Line 516: | Line 525: | ||
<div style="height: 50px;"></div> | <div style="height: 50px;"></div> | ||
| − | <h1 id="improve" class="ArticleHead GreenAH">Part Collection</h1> | + | <h1 id="improve" class="page-header ArticleHead GreenAH">Part Collection</h1> |
| − | <p class="PP">It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the | + | <p class="PP"><br/>It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the wild-type T7 promoter to get a collection of modified T7 promoters.</p> |
| − | <p class="PP">T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the | + | <p class="PP">T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the range from -20 to -12. The sequences of these modified promoters are shown in the Table below.</p> |
<h2 id="sms" class="H2Head">Sequences of Modified Promoters</h2> | <h2 id="sms" class="H2Head">Sequences of Modified Promoters</h2> | ||
<table class="table"> | <table class="table"> | ||
| Line 533: | Line 542: | ||
<h2 id="test" class="H2Head">Test</h2> | <h2 id="test" class="H2Head">Test</h2> | ||
| − | <p class="PP">To test the function of mutant promoters, we chose the <a class="cite" href="http://parts.igem.org/Part:BBa_E1010"> | + | <p class="PP">To test the function of mutant promoters, we chose the <a class="cite" href="http://parts.igem.org/Part:BBa_E1010">mRFP</a> as our reporter. By assessing the absolute fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure and Table below.</p> |
<div class="imgdiv"><img class="textimg" src="https://static.igem.org/mediawiki/2017/2/23/ZJU_China_imporve_1.png"></div> | <div class="imgdiv"><img class="textimg" src="https://static.igem.org/mediawiki/2017/2/23/ZJU_China_imporve_1.png"></div> | ||
| − | <p class="capture">Relative Strength of wildtype T7 promoter and mutant promoters</p> | + | <p class="capture">Fig.1 Relative Strength of wildtype T7 promoter and mutant promoters</p> |
| + | |||
| + | <table class="table"> | ||
| + | <tr><th class="yellowTable">Part number</th><th class="yellowTable">Relative Strength</th></tr> | ||
| + | <tr><th class="grayTable">BBa_K525998(wild type)</th><th>1</th></tr> | ||
| + | <tr><th class="grayTable">BBa_K2207024</th><th>0.26</th></tr> | ||
| + | <tr><th class="grayTable">BBa_K2207025</th><th>11.44</th></tr> | ||
| + | <tr><th class="grayTable">BBa_K2207026</th><th>9.15</th></tr> | ||
| + | <tr><th class="grayTable">BBa_K2207027</th><th>7.57</th></tr> | ||
| + | <tr><th class="grayTable">BBa_K2207028</th><th>8.41</th></tr> | ||
| + | <tr><th class="grayTable">BBa_K2207029</th><th>3.65</th></tr> | ||
| + | <tr><th class="grayTable">BBa_K2207030</th><th>6.79</th></tr> | ||
| + | </table> | ||
| + | |||
<p class="PP">As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.</p> | <p class="PP">As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.</p> | ||
| + | <h2 id="ref" class="H2Head">Reference</h2> | ||
| + | <p class="ref">[1] Ikeda R A, Ligman C M, Warshamana S, et al. T7 promoter contacts essential for promoter activity in vivo[J]. Nucleic Acids Research, 1992, 20(10): 2517-2524.</p> | ||
| + | <p class="ref">[2] Tang G, Bandwar R P, Patel S S, et al. Extended Upstream A-T Sequence Increases T7 Promoter Strength[J]. Journal of Biological Chemistry, 2005, 280(49): 40707-40713.</p> | ||
| − | </div> | + | |
| + | </div> | ||
| Line 547: | Line 573: | ||
<nav style="position: fixed; top: 100px ; left:50px;" class="bs-docs-sidebar hidden-print hidden-xs hidden-sm"> | <nav style="position: fixed; top: 100px ; left:50px;" class="bs-docs-sidebar hidden-print hidden-xs hidden-sm"> | ||
<ul class="nav bs-docs-sidenav shorterli"> | <ul class="nav bs-docs-sidenav shorterli"> | ||
| − | |||
<li><a href="#improve">Improve Part</a></li> | <li><a href="#improve">Improve Part</a></li> | ||
| − | <li><a href="#sms">Sequences | + | <li><a href="#sms">Sequences info</a></li> |
<li><a href="#test">Test</a></li> | <li><a href="#test">Test</a></li> | ||
| + | <li><a href="#ref">Reference</a></li> | ||
</ul> | </ul> | ||
Latest revision as of 15:18, 1 November 2017
Part Collection
It is well known that T7 promoter is a kind of common promoter used for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter is of high efficiency, in order to meet some specific demands, we need a series of modified T7 promoters with different strength of expression. Hence, we tried to transform the wild-type T7 promoter to get a collection of modified T7 promoters.
T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some mutation may make T7 promoter fail to work. Thus, with the help of some previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the range from -20 to -12. The sequences of these modified promoters are shown in the Table below.
Sequences of Modified Promoters
| Part number | Sequence(-20~+6) |
|---|---|
| BBa_K525998(wild type) | gagtaatacgactcactatagggaaa |
| BBa_K2207024 | tagtaatacgactcactatagggaaa |
| BBa_K2207025 | aagtaatacgactcactatagggaaa |
| BBa_K2207026 | gaataatacgactcactatagggaaa |
| BBa_K2207027 | gattaatacgactcactatagggaaa |
| BBa_K2207028 | gattaataagactcactatagggaaa |
| BBa_K2207029 | gattaatatgactcactatagggaaa |
| BBa_K2207030 | tattaatacgactcactatagggaaa |
Test
To test the function of mutant promoters, we chose the mRFP as our reporter. By assessing the absolute fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of mRFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure and Table below.
Fig.1 Relative Strength of wildtype T7 promoter and mutant promoters
| Part number | Relative Strength |
|---|---|
| BBa_K525998(wild type) | 1 |
| BBa_K2207024 | 0.26 |
| BBa_K2207025 | 11.44 |
| BBa_K2207026 | 9.15 |
| BBa_K2207027 | 7.57 |
| BBa_K2207028 | 8.41 |
| BBa_K2207029 | 3.65 |
| BBa_K2207030 | 6.79 |
As we can see from the figure, except the part K2207024, all mutant promoters showed increased strength compared with wild type T7 promoter. Therefore, our part collection enables users to control the expression of protein using T7 promoter, especially offering more opportunity for increasing the efficiency of protein expression.
Reference
[1] Ikeda R A, Ligman C M, Warshamana S, et al. T7 promoter contacts essential for promoter activity in vivo[J]. Nucleic Acids Research, 1992, 20(10): 2517-2524.
[2] Tang G, Bandwar R P, Patel S S, et al. Extended Upstream A-T Sequence Increases T7 Promoter Strength[J]. Journal of Biological Chemistry, 2005, 280(49): 40707-40713.
