Difference between revisions of "Team:Hong Kong-CUHK/Experiments"

 
(46 intermediate revisions by 5 users not shown)
Line 45: Line 45:
 
<div class="column full_size">
 
<div class="column full_size">
  
Experiment
+
 
<h1>Overview of experiment</h1>
+
<center> <h1>Overview of experiments</h1> </center>  
<font size="4">In our project, we first designed toehold switches the detect H7N9 and H5N1 virus in silico based on our modelling. We then constructed the plasmids that express switches and triggers by DNA synthesis and standard cloning method. Validation of the toehold switches was performed by co-expressing the switch and trigger plasmids in E. coli and in cell free system. Meanwhile, we also constructed our toehold switches and trigger cloning tool to allow convenient construction of switch and trigger expressing plasmid. Using the cloning tool, we tried to improve one existing toehold switch in the Registry. We also characterized two reporter protein (mRFP and amaJlime) in the registry to facilitate our project.
+
 
<br>
 
<br>
 +
<ol type="1">
 +
<p style="font-family: roboto;font-size:115%;">
 +
  <li><i>In silico</i> designed toehold switches to detect H7N9 and H5N1 viruses based on our modelling.</li>
 +
  <li>Constructed plasmids containing switches or triggers by DNA synthesis and standard cloning method.</li>
 +
  <li>Validated the toehold switches by co-expressing the switch and trigger plasmids in <i>E. coli</i> and cell free system.</li>
 +
  <li>Constructed cloning tools for toehold switch and trigger to allow convenient replacement of switch and trigger in the plasmids.</li>
 +
  <li>Improved one existing toehold switch in the Registry.</li>
 +
  <li>Characterized two reporter proteins (mRFP and amaJlime) in the Registry.
 +
</ol>
 
<br>
 
<br>
<h3>In silico design of Influenza Toehold switches</h3>
 
According to Green et al., the optimal length of RNA to be detected by a toehold switch is around 30 bp. In other words, a target RNA with 1000 bp in length will give 970 possible switches. However, the performances of each possible switch are different, since the performance is governed by serval parameters in the target region, such as the minimum free energy (For more information, please visit RNA thermodynamics modelling page). To minimize the manpower on screening of the switches, we constructed an online toehold switch design program. Apart from basic thermodynamic parameters, it also screens for rare codon, stop codon and RFC illegal sites along the sequence. In addition, the built- in BLAST function also automatically screen for nonspecific region to avoid false positive detection. Ultimately, the program can sort a list of “best” Toehold Switch sequence according to their free energy using the embedded function of “Vienna RNA” (8). The program facilitates the construction of toehold switch by providing a user-friendly interface with novel screening function.
 
 
<br>
 
<br>
 +
<p><h3><i>In silico</i> design of Influenza Toehold switches</h3></p>
 +
<p style="font-family: roboto;font-size:115%;">
 +
According to Green <i>et al.</i>(1), the optimal length of RNA to be detected by a toehold switch is around 30 bp. In other words, a target RNA with 1000 bp in length will give 970 possible switches. However, the performances of each possible switches are different, since the performance is governed by serval parameters in the target region, such as the minimum free energy of the RNA (For more information, please visit <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Model"> modelling page</a>). To minimize the manpower on screening of the switches, we constructed an <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Software"> online toehold switch design program </a>. Apart from the basic thermodynamic parameters, it also screens for rare codons, stop codons and RFC illegal sites along the sequence. In addition, the built-in BLAST function also automatically screen for nonspecific region to avoid false positive detection. Ultimately, the program can sort a list of “best” Toehold Switch sequence according to their free energy using the embedded function of <a href="https://www.tbi.univie.ac.at/RNA/">“Vienna RNA”</a> (2). The program facilitates the construction of toehold switch by providing a user-friendly interface with novel screening function.
 
<br>
 
<br>
We used the program to design our switches to detect H5, H7, N1, N9 and PB2 RNAs. Polymerase basic protein 2 (PB2) gene is influenza A specific gene that used as a positive control of flu A. We downloaded the latest influenza gene sequence from the Influenza Research Database and inputted to our program to generate switches. The sequence used are listed below:
+
<br>
 +
To detect influenza A, Polymerase Basic Protein 2 (PB2) gene is used as a positive control as it is influenza A-specific. Further subtyping requires a subtype-specific RNA that can also fulfil the criteria for being a good toehold switch. We downloaded the latest influenza gene sequences from the <a href="https://www.fludb.org/brc/home.spg?decorator=influenza "> Influenza Research Database</a>(3) and inputted to our program to generate switches to detect H5, H7, N1, N9 and PB2 RNAs. The sequences used are listed below (Type of flu/ region of origin/ number of lineage/ year of isolation):
  
 
<center><img src="https://static.igem.org/mediawiki/2017/e/e7/Experimap.jpg"  style="width:540px;height:360px;"></center>
 
<center><img src="https://static.igem.org/mediawiki/2017/e/e7/Experimap.jpg"  style="width:540px;height:360px;"></center>
 +
<p style="font-family: roboto;font-size:115%;">
 +
3 toehold switches with “good” predicted performance were chosen to target each RNA (For more information, please visit <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Model">RNA thermodynamics modelling page</a>). For example, the three switches are named as H5-1, H5-2 and H5-3 for H5 RNA detection. The figure above shows the detection region of each toehold switch. Before constructing the toehold switches, we ensured all the switches passed our modelling criteria.
 +
<br>
 +
 +
  
We chose 3 toehold switches with “good” predicted performance to target each RNA (For more information, please visit RNA thermodynamics modelling page). (e.g. H5-1, H5-2 and H5-3 to detect H5 RNA). The figure above shows the detection region of each toehold switch. Before constructing the toehold switches, we ensured all the switches passed the modelling test.
 
<br>
 
 
<br>
 
<br>
 +
<p><h3>Construction of toehold switch and trigger-expressing plasmid</h3></p>
 +
<p style="font-family: roboto;font-size:115%;">
 +
<center><img src="https://static.igem.org/mediawiki/2017/d/dc/CUHK_toeholdstructure.jpg" width="50%" height="auto"></center>
 +
<p style="font-family: roboto;font-size:115%;">
 +
The upper picture showed the general structure of our toehold switch (For detailed structure, please visit our <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Model"> modelling page</a>). mRFP(E1010) was chosen as the reporter of our toehold switches because it is very distinguishable by naked eyes while at the same time it can be quantified by measuring the fluorescence signal using a plate reader. The switch sequence generated by our program was linked with promoter(J23100) and reporter sequence. The trigger sequences was linked with promoter(J23100). Switches and triggers DNA were synthesized by IDT’s sponsored gBlock synthesis service. The gBlocks were used as template and amplified by PCR. The bands with correct size were gel-purified. We inserted the purified PCR products into pSB4C5 (for switch) or pSB1K3 (for trigger) using restriction cut and ligation. Sequencing results confirmed all 30 constructs were cloned.
 +
 +
Due to safety and budget concern, partial sequence of the viral gene was used. Below listed the partial sequence we used:
 +
<div class="some-padding"></div>
 +
<div class="some-padding"></div>
 +
<div class="some-padding"></div>
 +
<div class="some-padding"></div>
 +
<div class="panel-group" id="accordion" role="tablist" aria-multiselectable="true">
 +
            <div class="panel panel-default">
 +
                <div class="panel-heading" role="tab" id="P0">
 +
                    <h4 class="panel-title">
 +
                    <a role="button" data-toggle="collapse" data-parent="#accordion" href="#P0-collapse" aria-expanded="false" aria-controls="P0-collapse">
 +
<div>
 +
                    <div class="col-md-11">Click here to view trigger sequences </div><div class="col-md-1"><i class="fa fa-arrow-down fa-10" aria-hidden="true"></i></div>
 +
</div>
 +
                    </a>
 +
                    </h4>
 +
 +
                </div>
 +
                <div id="P0-collapse" class="panel-collapse collapse" role="tabpanel" aria-labelledby="P0">
 +
                    <div class="panel-body">               
 +
<ol>
 +
 +
<table width="80%">
 +
 +
<tr>
 +
<th>Respective switch</th>
 +
<th>Trigger sequence</th>
 +
</tr>
 +
 +
<tr>
 +
<td>PB2-1</td>
 +
<td>AAACAUUGAAAAUAAGAGUACAUGAAGGAUAUGAGGAAUUCACAAUGGUUGGGCG
 +
<br>AAGAGCAACAGCCAUUCUAAGGAAAGCAACCAGAAGACUGAUCCAACUGAUAGUGAGUG
 +
<br>GGAAAGUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>PB2-2</td>
 +
<td>CAAGGCAACCAAGAGGCUUACGGUGCUUGGGAAGGAUGCAGGUACAUUGAUGGAAG
 +
<br>ACCCGGACGAGGGAACAGCAGGAGUGGAAUCUGCAGUAUUGAGGGGAUUUCUGAUUCUG
 +
<br>GGCAAUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>PB2-3</td>
 +
<td>AGAGUUAGUAAAAUGGGAGUAGAUGAAUAUUCCAGCACUGAGAGAGUGGUCGUGAG
 +
<br>UAUUGAUCGUUUCUUGAGGGUCCGAGACCAGAGGGGAAACGUACUCCUGUCUCCCGAAG
 +
<br>AGGUUUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
 +
<tr>
 +
<td>H5-1</td>
 +
<td>UAGGGAUAAUGCAAAGGAGCUUGGUAACGGUUGUUUCGAGUUCUAUCACAGAUGUG
 +
<br>AUAAUGAAUGUAUGGAAAGUGUAAGAAACGGAACGUAUGACUACCCUCAAUAUUCAGAAG
 +
<br>AAGCUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>H5-2</td>
 +
<td>AGUGGAGAAAAUCAAUCCAGCCAAUGACCUCUGUUAUCCAGGGAAUUUCAACGACU
 +
<br>AUGAAGAACUGAAACACCUAUUGAGCAGAAUAAACCAUUUUGAGAAAAUUCAGAUCAUUC
 +
<br>CCAAUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>H5-3</td>
 +
<td>CAUCAUAGCAACGAGCAGGGGAGUGGGUACGCUGCAGACAAAGAAUCCACUCAAAGG
 +
<br>GCUAUAGAUGGAGUCACCAAUAAGGUCAAUUCGAUCAUUGACAAAAUGAACACUCAGUUU
 +
<br>GAGUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>N1-1</td>
 +
<td>CAUCAUAGCAACGAGCAGGGGAGUGGGUACGCUGCAGACAAAGAAUCCACUCAAAGG
 +
<br>GCUAUAGAUGGAGUCACCAAUAAGGUCAAUUCGAUCAUUGACAAAAUGAACACUCAGUUU
 +
<br>GAGUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>N1-2</td>
 +
<td>GUUUUCAUUUAAAUACGGCAAUGGUGUUUGGAUCGGGAGAACCAAAAGCACUAAUU
 +
<br>CCAGGAGCGGCUUUGAAAUGAUUUGGGACCCAAAUGGGUGGACUGGAACGGACAGUAGC
 +
<br>UUUUCUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>N1-3</td>
 +
<td>AGAAGAUAAUAACCAUCGGAUCAAUCUGUAUGGUAAUUGGGAUAGCUAGCUUAAUG
 +
<br>UUACAAAUUGGAAACAUAAUCUCAAUAUGGAUCAGUCAUUCAAUUCAGACAGGGAACCAA
 +
<br>UGCCUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>H7-1</td>
 +
<td>ACACCAGAAUGCACAGGGAGAGGGAACUGCUGCAGAUUACAAAAGCACUCAAUCGGC
 +
<br>AAUUGAUCAAAUAACAGGGAAAUUAAACCGGCUUAUAGCAAAAACCAACCAACAAUUUGAG
 +
<br>UUUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>H7-2</td>
 +
<td>ACACAUUAACUGAAAGAGGAGUGGAAGUCGUCAAUGCAACUGAAACGGUGGAACGAAC
 +
<br>AAACAUCCCCCGGAUCUGCUCAAAAGGGAAAAGGACAGUUGAUCUCGGUCAAUGUGGACUC
 +
<br>CUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>H7-3</td>
 +
<td>AGUGGCUACAAAGAUGUGAUACUUUGGUUUAGCUUCGGGGCAUCAUGUUUCAUACUUC
 +
<br>UAGCCAUUGUAAUGGGCCUUGUCUUCAUAUGUGUAAAGAAUGGAAACAUGCGGUGCACUAU
 +
<br>UUAGCGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>N9-1</td>
 +
<td>UUAGUCACAAGAGAACCCUAUGUUUCAUGCAACCCAGAUGAAUGCAGGUUCUAUGCUCU
 +
<br>CAGCCAAGGAACAACAAUCAGAGGGAAACACUCAAACGGUACAAUACACGAUAGGUCCCAGUAG
 +
<br>CGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>N9-2</td>
 +
<td>AAUAACUUAACUAAAGGGCUCUGUACUAUAAAUUCGUGGCACAUAUAUGGGAAAGACAAU
 +
<br>GCAGUAAGAAUUGGAGAAAGCUCGGAUGUUUUAGUCACAAGAGAACCCUAUGUUUCAUGCUAG
 +
<br>CGGCCGCUGCAGCUCGAG</td>
 +
 +
<tr>
 +
<td>N9-3</td>
 +
<td>ACUACUUUAAAGAGGGGAAAAUAUUGAAAUGGGAGUCUCUGACUGGAACUGCUAAGCACAU
 +
<br>UGAAGAAUGCUCAUGUUACGGGGAACGAACAGGGAUUACCUGCACAUGCAAGGACAAUUUAGCG
 +
<br>GCCGCUGCAGCUCGAG</td>
 +
 +
 +
</tr>
 +
 +
 +
 +
</table>
 +
 +
</ol>
 +
  </div>
 +
</div>
 +
</div>
 +
 +
 +
 +
  
<h3>Construction of toehold switch and trigger- expressing plasmid</h3>
 
We choose mRFP as the reporter of our toehold switches because it is very distinguishable by naked eyes while at the same time it can be quantified by measuring the fluorescence signal using a plate reader. The upper picture showed the general structure of our toehold switch. After having the toehold switch sequences generated by our program, we linked it with the reporter sequence and synthesized them using IDT’s sponsored gBlock synthesis service. The gBlocks were used as template and amplified by PCR. The bands with correct size is gel- purified. We inserted the purified PCR products into pSB4C5 (for switch) or pSB1k3 (for trigger) using restriction cut and ligation. Sequencing result confirm all 30 constructed were successfully constructed.
 
 
<br>
 
<br>
 
<br>
 
<br>
Below is a table illustrating the information of the backbone:
+
<p style="font-family: roboto;font-size:115%;">
 +
Below is a table with the information of the backbone:
 
<table width="79%">
 
<table width="79%">
  
Line 79: Line 231:
 
<td><b>Backbone</b></td>
 
<td><b>Backbone</b></td>
 
<td>pSB4C5</td>
 
<td>pSB4C5</td>
<td>pSB1k3</td>
+
<td>pSB1K3</td>
  
 
</tr>
 
</tr>
Line 100: Line 252:
 
<br>
 
<br>
 
<br>
 
<br>
We choose these two backbone with different Ori and antibiotic resistance gene because they will be used in latter co- transformation experiment. In co- transformation experiment, the two plasmids should not share the same type of origin of replication (ORI), since they will compete for the replication machinery and affect the copy number. In addition, having two different antibiotic resistance gene allow co-transformation.  
+
<p style="font-family: roboto;font-size:115%;">
 +
These two backbones with different Ori and antibiotic resistance genes were used because they will be used in the following experiments. Two co-transformed plasmids should not have the same type of origin of replication (Ori), or otherwise, they will compete for the replication machinery and affect the copy number(4). A higher copy number is chosen for the trigger plasmid to ensure trigger expression is in excess in cells. In addition, having two different antibiotic resistance genes avoid dropping out of either one of the plasmids during selection.
 +
 
 +
 
 +
 
 
<br>
 
<br>
 
<br>
 
<br>
<h3>In vivo assay: co- transformation in E. coli</h3>
+
<p><h3><i>In vivo</i> assay: co-transformation in <i>E. coli</i></h3></p>
  
 
<center><img src="https://static.igem.org/mediawiki/2017/1/1a/CUHK_cotrans.jpg"  style="width:50%;height:auto;"></center>
 
<center><img src="https://static.igem.org/mediawiki/2017/1/1a/CUHK_cotrans.jpg"  style="width:50%;height:auto;"></center>
 +
<p style="font-family: roboto;font-size:115%;">
 +
Expressing our switches in <i>E. coli</i> is a cheaper and more familiar method to validate our switches and the program. The assay is done by co-transforming switch-expressing plasmid and trigger-expressing plasmid into <i>E. coli</i> BL21 (DE3). Negative control is done by co-transforming switch-expressing plasmid and empty pSB1K3. Single colonies of the transformants were picked and grown overnight starter culture. Expression of reporter mRFP was done by shaking culture for 6 hours after 1% inoculation. Cells were harvested, washed with PBS buffer, then aliquoted in 96-well plates. Fluorescence intensity was measured by BMG ClarioStar microplate reader. We later checked for difference of florescent signal between the switch-trigger co-transformants and the negative control. In theory, if the toehold switch works as expected, the florescent signal of switch-trigger co-transformants must be higher than that of the negative control.
  
Since cell free system is relatively expensive to us, we would like to first validate our switches in E. coli, which can be much cheaper. The assay is done by co-transformation of switch-expressing plasmid and trigger expressing plasmid.
 
 
Ptotocol:
 
Co-trans
 
Validate of switch
 
 
<br>
 
<br>
 
<br>
 
<br>
<h3>In vitro assay: Cell free system</h3>
+
<p><h3><i>In vitro</i> assay: Cell free system</h3> </p>
We used the Promega S30 T7 High-Yield Protein Expression System.
+
<p style="font-family: roboto;font-size:115%;">
 +
We used the Promega S30 T7 High-Yield Protein Expression System as our cell free system. After the <i>in vivo</i> test, we chose the workable switches to test in cell free system. We expressed: (1) toehold switch, (2) toehold switch and trigger pair, (3) J61002(constitutive mRFP generator as a positive control of the highest possible RFP expression), (3) luciferase positive control provided by the manufacturer, and (4) negative control where DNA is replaced with water in separate cell free reactions. We followed exactly the protocol provided by the company in our experiment. The reaction was done by mixing 2 μg DNA, S30 Premix and S30 Extract together to a reaction volume of 50 μl, followed by incubating at 37˚C for an hour. The florescent signal from the reacted mixture was then determined by BMG ClarioStar plate reader. Over-expression of protein in the reaction mixture was checked by SDS-PAGE.
 
<br>
 
<br>
 
<br>
 
<br>
<h3>Toehold switch and trigger cloning tool: BBa_K2254000 & BBa_K2254001</h3>
+
<p><h3>Toehold switch and trigger cloning tools: BBa_K2254000 & BBa_K2254001</h3></p>
  
<center><img src="https://static.igem.org/mediawiki/2017/9/94/CUHK_SSD.jpg"  style="width:100%;height:auto;"></center>
+
<center><img src="https://static.igem.org/mediawiki/2017/8/86/CUHK_tool.jpg"  style="width:100%;height:auto;"></center>
<center><img src="https://static.igem.org/mediawiki/2017/7/7c/CUHK_TSD.png"  style="width:100%;height:auto;"></center>
+
  
During our construction of switches, we realized that it would be relatively expensive to synthesis toehold switch together with the linker and reporter gene. We also want to have a convenient tool to construct and validate switches. Therefore, we constructed our toehold switch and trigger cloning tool that utilize the type IIS restriction enzymes Eco31I. Using the biobricks, user can just construct their toehold switch or trigger by ordering 2 primer-like oligo. It also utilizes screening technique that is similar to blue white screening. User can use this biobrick to construct their toehold switch that use pT7 as promoter and mRFP as reporter.
+
<p style="font-family: roboto;font-size:115%;">
 +
During our construction of switches, we realized that it would be relatively expensive to synthesis toehold switch together with the linker and reporter gene. We also want to have a convenient tool to construct and validate switches. Therefore, we constructed our toehold switch and trigger cloning tools that utilize the type IIS restriction enzyme Eco31I. Using the biobricks, user can simply construct their toehold switch or trigger by ordering 2 primer-like oligos. It also utilizes screening technique that is similar to blue/white screening. User can use this biobrick to construct their toehold switches that use pT7 as the promoter and mRFP as the reporter.
 
<br>
 
<br>
 
<br>
 
<br>
To use the biobricks to clone switches and triggers, user can just order 2 oligos (similar to primer) and insert the short DNA into the biobricks by restriction cut and ligation. For the 2 oligos (about 60nt), one oligo should contain forward toehold switch sequence with AGGG at 5’ end, and another one should contain reverse complement toehold switch sequence with AGTA at 5’ end. To allow convenient screening of correct clone, there is a constitutive promoter (J23100) and RBS (B0034) situated between two Eco31I sites. Double digestion by Eco31I will remove them, and insertion of switch will block the translation of mRFP, resulting colonies that don’t express mRFP, whereas ligation of single digested plasmid will give red colonies.
+
To use the biobricks to clone switches and triggers, user can just order 2 oligos (similar to primer) and insert the short DNA into the biobricks by restriction cut and ligation. For the 2 oligos (about 60 nt), one oligo should contain forward toehold switch sequence with AGGG at the 5’ end, and another one should contain reverse complement toehold switch sequence with AGTA at the 5’ end. To allow convenient screening of clones, there is a constitutive promoter (J23100) and RBS (B0034) situated between the two Eco31I sites. Digestion by Eco31I will remove them, and the subsequent insertion of switch will block the translation of mRFP, resulting in white colonies, whereas undigested plasmid or ligation of single digested plasmid will give red colonies.
 
<br>
 
<br>
 
<br>
 
<br>
The toehold switch will be linked to a flexible linker (AACCTGGCGGCAGCGCAAAAG) followed by mRFP reporter (E1010) and a double terminator (B0015). The linker is used to separate the coding sequence in the toehold switch and the reporter to prevent interference of protein folding. When the toehold switch hairpin is linearized by its orthogonal trigger RNA, RBS will be exposed, allowing the translation of downstream mRFP reporter gene. Since an Xhoi site is present between the linker and the mRFP sequence, the reporter can be easily changed by restriction digestion followed by ligation.
+
The toehold switch will be linked to a flexible linker (AACCTGGCGGCAGCGCAAAAG) followed by mRFP reporter (E1010) and a double terminator (B0015). The linker is used to separate the coding sequence in the toehold switch and the reporter to prevent interference of protein folding. When the toehold switch hairpin is linearized by its orthogonal trigger RNA, RBS will be exposed, allowing the translation of downstream mRFP reporter gene. Since an XhoI site is present between the linker and the mRFP sequence, the reporter can be easily changed by restriction digestion followed by ligation.
 
<br>
 
<br>
 
<br>
 
<br>
<h3>Improving existing biobricks and project: Cancer switches</h3>
+
<p> <h3>Improving existing biobricks and project: Cancer switches</h3> </p>
Previously, the CGU Taiwan 2015 team was also working on toehold switch. They designed toehold switches to detect biomarker of oral cancer. We investigated their project and found that their toehold switches have room for improvement.
+
<p style="font-family: roboto;font-size:115%;">
 +
Previously, the <a href="https://2015.igem.org/Team:CGU_Taiwan/Results"> Chang Gung University (CGU) Taiwan 2015 team</a> also worked on toehold switch. They designed toehold switches to detect biomarker of oral cancer. We investigated their project and found that their toehold switches have room for improvement.
 
<br>
 
<br>
 
<br>
 
<br>
Firstly, they use luciferase as reporter gene. We think that luciferase is not feasible to be used for on- site diagnosis sense the luciferase activity need to be measured by machine. Secondly, we inputted the sequence of those oral cancer biomarker into our program and found that a better switch can be designed by choosing another region for detection (see modelling page). Therefore, we improved their biobricks by using In silico design of switch and RFP as reporter.
+
Firstly, they use luciferase as reporter gene. We think that luciferase is not feasible to be used for on-site diagnosis since the luciferase activity need to be measured by a reader. Secondly, their toehold switches did not worked as expected because the reporter expression was suppressed when trigger was added.Thirdly, we inputted the sequences of those oral cancer biomarkers into our program and found that a better switch can be designed by choosing another region for detection (see <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Model"> modelling page</a>). Therefore, we improved their biobricks by using <i>in silico</i> design of switch and RFP as a reporter.
 
<br>
 
<br>
 
<br>
 
<br>
<h3>Characterization of chromoprotein</h3>
+
<p> <h3>Characterization of chromoproteins</h3> </p>
Different types of body fluid have different pH (figure). Since we are going to use body fluid as sample in our influenza diagnostic test, we would like to investigate if the pH in body fluid can interfere the reporter protein we used in our test. Theoretically, fluorescent signal may be disturbed by pH because pH can interfere the folding and conformation of the fluorophore. Therefore, we characterized the fluorescence of 2 fluorescence protein: mRFP and amajLime in different pH condition. We hope to find out the optimum pH for the fluorescence protein and to check if they are suitable to be used in our diagnostic test.  
+
<p style="font-family: roboto;font-size:115%;">
 +
Different types of body fluid have different pH (5)(below figure). Inspired by a  <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/HP/Gold_Integrated"> medical expert</a> we interviewed, we would like to investigate if the pH in body fluid can interfere with the reporter protein we used in our test, since we are going to use body fluid as sample in our influenza diagnostic test. Fluorescent signal is known to be pH-dependent because pH can change the folding and conformation of the fluorophore, and ionization states can also cause shift in the Excitation/Emission spectra (6). Therefore, we characterized the fluorescence of 2 fluorescent proteins: <a href="http://parts.igem.org/Part:BBa_E1010"> mRFP(BBa_E1010) </a> and <a href="http://parts.igem.org/Part:BBa_K1033916"> amajLime(BBa_K1033916)</a>  at different pH. We want to find out their optimum pH and see if they are suitable to be the reporter protein in our diagnostic test.  
 
<br>
 
<br>
 
<br>
 
<br>
pH values of commonly extracted body fluid:
+
 
Body Fluid pH
+
<center>pH values of commonly extracted body fluids</center>
Blood 7.4
+
<center><table width="79%">
Duodenum 5.5
+
 
Ileum 8.0
+
 
Saliva 6.4
+
<tr>
Serum 7.2
+
<th width="20%">Body Fluids</th>
Stomach 1.5
+
<th width="20%">pH</th>
Urine 5.8
+
 
 +
</tr>
 +
 
 +
<tr>
 +
<td>Blood</td>
 +
<td>7.4</td>
 +
 
 +
</tr>
 +
 
 +
<tr>
 +
<td>Saliva</td>
 +
<td>6.4</td>
 +
 
 +
</tr>
 +
 
 +
<tr>
 +
<td>Ileum fluid</td>
 +
<td>8.0</td>
 +
 
 +
</tr>
 +
 
 +
<tr>
 +
<td>Serum</td>
 +
<td>7.2</td>
 +
 
 +
</tr>
 +
 
 +
<tr>
 +
<td>Stomach juice</td>
 +
<td>1.5</td>
 +
 
 +
</tr>
 +
 
 +
<tr>
 +
<td>Urine</td>
 +
<td>5.8</td>
 +
 
 +
</tr>
 +
 
 +
</table></center>
 +
 
 +
<p style="font-family: roboto;font-size:115%;">
 +
To examine the performance of mRFP and amajLime under different pH, we inserted the biobricks into pSB1A2 and expressed them in <i>E. coli</i>  C41(DE3) . mRFP and amajLime were then purified form lysed cells by anion exchange chromatography (AEC) and hydrophobic interaction chromatography (HIC).
 +
<br>
 +
<br>
 +
 
 +
Below picture shows the SDS–PAGE analysis of purification of amajLime (left) and mRFP (right).
 +
 
 +
<center><img src="https://static.igem.org/mediawiki/2017/4/42/CUHK_SDSPAGE1.jpg" style="width:70%;height:auto;"></center>
 +
 
 +
<p style="font-family: roboto;font-size:115%;">
 +
F.1 to F.3 represents chronological order of elutions in HIC. Samples (10µl) were mixed with 10 µl 2X SDS gel-loading buffer and 10 µl of the mixture were loaded on the SDS-gel. The purest fraction, F.2 in both cases, were selected to proceed to pH stability test, where purified proteins were diluted in buffers in the range of pH 2-12 to a final concentration of 100 µg/mL, and the fluorescence intensity was recorded by BMG ClarioStar plate reader.
 +
</p>
 +
 
 +
 
 +
<h3>Shipping</h3>
 +
Since iGEM requires standard backbone pSB1C3 for shipping, we later sub-cloned our biobricks into pSB1C3. Agarose electrophoresis and sequencing revealed that all biobricks were successfully inserted. Below showed our 1% agarose gel photo (our biobricks ~ 1000bp, pSB1C3 ~ 2000bp):
 +
<center><img src="https://static.igem.org/mediawiki/2017/1/1b/CUHK_Shipclone.jpg" style="width:70%;height:auto;"></center>
 +
 
 +
 
 +
<br>
 
<br>
 
<br>
 +
<h3>References:</h3>
 +
1. Green AA, Silver PA, Collins JJ, Yin P. Toehold switches: de-novo-designed regulators of gene expression. Cell. 2014 Nov 6;159(4):925-39.
 
<br>
 
<br>
To examine the pH sensitivity of mRFP and amajLime, we inserted the biobrick to pSB1A2 and expressed them in E. coli. mRFP and amajLime were then purified form lysed cells by anion exchange chromatography and hydrophobic interaction chromatography (HIC). Coomassie Gels was used to examine the purification after chromatography. To examine the pH stability of proteins, purified proteins were diluted into buffers ranging from pH2-pH12 while fluorescent intensity was recorded in plate reader.  
+
2. Lorenz, Ronny and Bernhart, Stephan H. and Höner zu Siederdissen, Christian and Tafer, Hakim and Flamm, Christoph and Stadler, Peter F. and Hofacker, Ivo L. ViennaRNA Package 2.0. Algorithms for Molecular Biology, 6:1 26, 2011,
 
<br>
 
<br>
 +
3. Zhang Y et. al. Influenza Research Database: An integrated bioinformatics resource for influenza virus research. Nucleic Acids Res. 2017 Jan 4;45(D1):D466-D474.
 
<br>
 
<br>
SDS–PAGE analysis of purification of amajLime (left) and mRFP (right) proteins by ion-exchange chromatography and followed by hydrophobic-interaction chromatography HIC. F.1 to F.3 represents chronological order of elution in HIC. Sample were mixed with 10 µl SDS 2X gel-loading buffer and 10 µl were loaded on the SDS-Gel. The purest fraction, F.2 in both cases, were selected to proceed for pH stability test.</font size>
+
4. Nordström K, Dasgupta S. Copy-number control of the Escherichia coli chromosome: a plasmidologist's view. EMBO Rep. 2006 May;7(5):484-9.
 
<br>
 
<br>
 +
5. Schwalfenberg GK. The alkaline diet: is there evidence that an alkaline pH diet benefits health? J Environ Public Health. 2012;2012:727630.
 
<br>
 
<br>
 +
6. Battad JM et al. A structural basis for the pH-dependent increase in fluorescence efficiency of chromoproteins. J Mol Biol. 2007 May 11;368(4):998-1010.
 +
 +
  
  
Line 171: Line 394:
  
 
</div>
 
</div>
 
+
</section>
 
</html>
 
</html>
 
{{Template:Hong_Kong-CUHK_footer}}
 
{{Template:Hong_Kong-CUHK_footer}}

Latest revision as of 20:57, 1 November 2017





Overview of experiments


  1. In silico designed toehold switches to detect H7N9 and H5N1 viruses based on our modelling.
  2. Constructed plasmids containing switches or triggers by DNA synthesis and standard cloning method.
  3. Validated the toehold switches by co-expressing the switch and trigger plasmids in E. coli and cell free system.
  4. Constructed cloning tools for toehold switch and trigger to allow convenient replacement of switch and trigger in the plasmids.
  5. Improved one existing toehold switch in the Registry.
  6. Characterized two reporter proteins (mRFP and amaJlime) in the Registry.


In silico design of Influenza Toehold switches

According to Green et al.(1), the optimal length of RNA to be detected by a toehold switch is around 30 bp. In other words, a target RNA with 1000 bp in length will give 970 possible switches. However, the performances of each possible switches are different, since the performance is governed by serval parameters in the target region, such as the minimum free energy of the RNA (For more information, please visit modelling page). To minimize the manpower on screening of the switches, we constructed an online toehold switch design program . Apart from the basic thermodynamic parameters, it also screens for rare codons, stop codons and RFC illegal sites along the sequence. In addition, the built-in BLAST function also automatically screen for nonspecific region to avoid false positive detection. Ultimately, the program can sort a list of “best” Toehold Switch sequence according to their free energy using the embedded function of “Vienna RNA” (2). The program facilitates the construction of toehold switch by providing a user-friendly interface with novel screening function.

To detect influenza A, Polymerase Basic Protein 2 (PB2) gene is used as a positive control as it is influenza A-specific. Further subtyping requires a subtype-specific RNA that can also fulfil the criteria for being a good toehold switch. We downloaded the latest influenza gene sequences from the Influenza Research Database(3) and inputted to our program to generate switches to detect H5, H7, N1, N9 and PB2 RNAs. The sequences used are listed below (Type of flu/ region of origin/ number of lineage/ year of isolation):

3 toehold switches with “good” predicted performance were chosen to target each RNA (For more information, please visit RNA thermodynamics modelling page). For example, the three switches are named as H5-1, H5-2 and H5-3 for H5 RNA detection. The figure above shows the detection region of each toehold switch. Before constructing the toehold switches, we ensured all the switches passed our modelling criteria.

Construction of toehold switch and trigger-expressing plasmid

The upper picture showed the general structure of our toehold switch (For detailed structure, please visit our modelling page). mRFP(E1010) was chosen as the reporter of our toehold switches because it is very distinguishable by naked eyes while at the same time it can be quantified by measuring the fluorescence signal using a plate reader. The switch sequence generated by our program was linked with promoter(J23100) and reporter sequence. The trigger sequences was linked with promoter(J23100). Switches and triggers DNA were synthesized by IDT’s sponsored gBlock synthesis service. The gBlocks were used as template and amplified by PCR. The bands with correct size were gel-purified. We inserted the purified PCR products into pSB4C5 (for switch) or pSB1K3 (for trigger) using restriction cut and ligation. Sequencing results confirmed all 30 constructs were cloned. Due to safety and budget concern, partial sequence of the viral gene was used. Below listed the partial sequence we used:

    Respective switch Trigger sequence
    PB2-1 AAACAUUGAAAAUAAGAGUACAUGAAGGAUAUGAGGAAUUCACAAUGGUUGGGCG
    AAGAGCAACAGCCAUUCUAAGGAAAGCAACCAGAAGACUGAUCCAACUGAUAGUGAGUG
    GGAAAGUAGCGGCCGCUGCAGCUCGAG
    PB2-2 CAAGGCAACCAAGAGGCUUACGGUGCUUGGGAAGGAUGCAGGUACAUUGAUGGAAG
    ACCCGGACGAGGGAACAGCAGGAGUGGAAUCUGCAGUAUUGAGGGGAUUUCUGAUUCUG
    GGCAAUAGCGGCCGCUGCAGCUCGAG
    PB2-3 AGAGUUAGUAAAAUGGGAGUAGAUGAAUAUUCCAGCACUGAGAGAGUGGUCGUGAG
    UAUUGAUCGUUUCUUGAGGGUCCGAGACCAGAGGGGAAACGUACUCCUGUCUCCCGAAG
    AGGUUUAGCGGCCGCUGCAGCUCGAG
    H5-1 UAGGGAUAAUGCAAAGGAGCUUGGUAACGGUUGUUUCGAGUUCUAUCACAGAUGUG
    AUAAUGAAUGUAUGGAAAGUGUAAGAAACGGAACGUAUGACUACCCUCAAUAUUCAGAAG
    AAGCUAGCGGCCGCUGCAGCUCGAG
    H5-2 AGUGGAGAAAAUCAAUCCAGCCAAUGACCUCUGUUAUCCAGGGAAUUUCAACGACU
    AUGAAGAACUGAAACACCUAUUGAGCAGAAUAAACCAUUUUGAGAAAAUUCAGAUCAUUC
    CCAAUAGCGGCCGCUGCAGCUCGAG
    H5-3 CAUCAUAGCAACGAGCAGGGGAGUGGGUACGCUGCAGACAAAGAAUCCACUCAAAGG
    GCUAUAGAUGGAGUCACCAAUAAGGUCAAUUCGAUCAUUGACAAAAUGAACACUCAGUUU
    GAGUAGCGGCCGCUGCAGCUCGAG
    N1-1 CAUCAUAGCAACGAGCAGGGGAGUGGGUACGCUGCAGACAAAGAAUCCACUCAAAGG
    GCUAUAGAUGGAGUCACCAAUAAGGUCAAUUCGAUCAUUGACAAAAUGAACACUCAGUUU
    GAGUAGCGGCCGCUGCAGCUCGAG
    N1-2 GUUUUCAUUUAAAUACGGCAAUGGUGUUUGGAUCGGGAGAACCAAAAGCACUAAUU
    CCAGGAGCGGCUUUGAAAUGAUUUGGGACCCAAAUGGGUGGACUGGAACGGACAGUAGC
    UUUUCUAGCGGCCGCUGCAGCUCGAG
    N1-3 AGAAGAUAAUAACCAUCGGAUCAAUCUGUAUGGUAAUUGGGAUAGCUAGCUUAAUG
    UUACAAAUUGGAAACAUAAUCUCAAUAUGGAUCAGUCAUUCAAUUCAGACAGGGAACCAA
    UGCCUAGCGGCCGCUGCAGCUCGAG
    H7-1 ACACCAGAAUGCACAGGGAGAGGGAACUGCUGCAGAUUACAAAAGCACUCAAUCGGC
    AAUUGAUCAAAUAACAGGGAAAUUAAACCGGCUUAUAGCAAAAACCAACCAACAAUUUGAG
    UUUAGCGGCCGCUGCAGCUCGAG
    H7-2 ACACAUUAACUGAAAGAGGAGUGGAAGUCGUCAAUGCAACUGAAACGGUGGAACGAAC
    AAACAUCCCCCGGAUCUGCUCAAAAGGGAAAAGGACAGUUGAUCUCGGUCAAUGUGGACUC
    CUAGCGGCCGCUGCAGCUCGAG
    H7-3 AGUGGCUACAAAGAUGUGAUACUUUGGUUUAGCUUCGGGGCAUCAUGUUUCAUACUUC
    UAGCCAUUGUAAUGGGCCUUGUCUUCAUAUGUGUAAAGAAUGGAAACAUGCGGUGCACUAU
    UUAGCGGCCGCUGCAGCUCGAG
    N9-1 UUAGUCACAAGAGAACCCUAUGUUUCAUGCAACCCAGAUGAAUGCAGGUUCUAUGCUCU
    CAGCCAAGGAACAACAAUCAGAGGGAAACACUCAAACGGUACAAUACACGAUAGGUCCCAGUAG
    CGGCCGCUGCAGCUCGAG
    N9-2 AAUAACUUAACUAAAGGGCUCUGUACUAUAAAUUCGUGGCACAUAUAUGGGAAAGACAAU
    GCAGUAAGAAUUGGAGAAAGCUCGGAUGUUUUAGUCACAAGAGAACCCUAUGUUUCAUGCUAG
    CGGCCGCUGCAGCUCGAG
    N9-3 ACUACUUUAAAGAGGGGAAAAUAUUGAAAUGGGAGUCUCUGACUGGAACUGCUAAGCACAU
    UGAAGAAUGCUCAUGUUACGGGGAACGAACAGGGAUUACCUGCACAUGCAAGGACAAUUUAGCG
    GCCGCUGCAGCUCGAG


Below is a table with the information of the backbone:

Switch Trigger
Backbone pSB4C5 pSB1K3
Ori pSC101 (~5 copies) pMB1 (~100-300 copies)
Resistance chloramphenicol kanamycin


These two backbones with different Ori and antibiotic resistance genes were used because they will be used in the following experiments. Two co-transformed plasmids should not have the same type of origin of replication (Ori), or otherwise, they will compete for the replication machinery and affect the copy number(4). A higher copy number is chosen for the trigger plasmid to ensure trigger expression is in excess in cells. In addition, having two different antibiotic resistance genes avoid dropping out of either one of the plasmids during selection.

In vivo assay: co-transformation in E. coli

Expressing our switches in E. coli is a cheaper and more familiar method to validate our switches and the program. The assay is done by co-transforming switch-expressing plasmid and trigger-expressing plasmid into E. coli BL21 (DE3). Negative control is done by co-transforming switch-expressing plasmid and empty pSB1K3. Single colonies of the transformants were picked and grown overnight starter culture. Expression of reporter mRFP was done by shaking culture for 6 hours after 1% inoculation. Cells were harvested, washed with PBS buffer, then aliquoted in 96-well plates. Fluorescence intensity was measured by BMG ClarioStar microplate reader. We later checked for difference of florescent signal between the switch-trigger co-transformants and the negative control. In theory, if the toehold switch works as expected, the florescent signal of switch-trigger co-transformants must be higher than that of the negative control.

In vitro assay: Cell free system

We used the Promega S30 T7 High-Yield Protein Expression System as our cell free system. After the in vivo test, we chose the workable switches to test in cell free system. We expressed: (1) toehold switch, (2) toehold switch and trigger pair, (3) J61002(constitutive mRFP generator as a positive control of the highest possible RFP expression), (3) luciferase positive control provided by the manufacturer, and (4) negative control where DNA is replaced with water in separate cell free reactions. We followed exactly the protocol provided by the company in our experiment. The reaction was done by mixing 2 μg DNA, S30 Premix and S30 Extract together to a reaction volume of 50 μl, followed by incubating at 37˚C for an hour. The florescent signal from the reacted mixture was then determined by BMG ClarioStar plate reader. Over-expression of protein in the reaction mixture was checked by SDS-PAGE.

Toehold switch and trigger cloning tools: BBa_K2254000 & BBa_K2254001

During our construction of switches, we realized that it would be relatively expensive to synthesis toehold switch together with the linker and reporter gene. We also want to have a convenient tool to construct and validate switches. Therefore, we constructed our toehold switch and trigger cloning tools that utilize the type IIS restriction enzyme Eco31I. Using the biobricks, user can simply construct their toehold switch or trigger by ordering 2 primer-like oligos. It also utilizes screening technique that is similar to blue/white screening. User can use this biobrick to construct their toehold switches that use pT7 as the promoter and mRFP as the reporter.

To use the biobricks to clone switches and triggers, user can just order 2 oligos (similar to primer) and insert the short DNA into the biobricks by restriction cut and ligation. For the 2 oligos (about 60 nt), one oligo should contain forward toehold switch sequence with AGGG at the 5’ end, and another one should contain reverse complement toehold switch sequence with AGTA at the 5’ end. To allow convenient screening of clones, there is a constitutive promoter (J23100) and RBS (B0034) situated between the two Eco31I sites. Digestion by Eco31I will remove them, and the subsequent insertion of switch will block the translation of mRFP, resulting in white colonies, whereas undigested plasmid or ligation of single digested plasmid will give red colonies.

The toehold switch will be linked to a flexible linker (AACCTGGCGGCAGCGCAAAAG) followed by mRFP reporter (E1010) and a double terminator (B0015). The linker is used to separate the coding sequence in the toehold switch and the reporter to prevent interference of protein folding. When the toehold switch hairpin is linearized by its orthogonal trigger RNA, RBS will be exposed, allowing the translation of downstream mRFP reporter gene. Since an XhoI site is present between the linker and the mRFP sequence, the reporter can be easily changed by restriction digestion followed by ligation.

Improving existing biobricks and project: Cancer switches

Previously, the Chang Gung University (CGU) Taiwan 2015 team also worked on toehold switch. They designed toehold switches to detect biomarker of oral cancer. We investigated their project and found that their toehold switches have room for improvement.

Firstly, they use luciferase as reporter gene. We think that luciferase is not feasible to be used for on-site diagnosis since the luciferase activity need to be measured by a reader. Secondly, their toehold switches did not worked as expected because the reporter expression was suppressed when trigger was added.Thirdly, we inputted the sequences of those oral cancer biomarkers into our program and found that a better switch can be designed by choosing another region for detection (see modelling page). Therefore, we improved their biobricks by using in silico design of switch and RFP as a reporter.

Characterization of chromoproteins

Different types of body fluid have different pH (5)(below figure). Inspired by a medical expert we interviewed, we would like to investigate if the pH in body fluid can interfere with the reporter protein we used in our test, since we are going to use body fluid as sample in our influenza diagnostic test. Fluorescent signal is known to be pH-dependent because pH can change the folding and conformation of the fluorophore, and ionization states can also cause shift in the Excitation/Emission spectra (6). Therefore, we characterized the fluorescence of 2 fluorescent proteins: mRFP(BBa_E1010) and amajLime(BBa_K1033916) at different pH. We want to find out their optimum pH and see if they are suitable to be the reporter protein in our diagnostic test.

pH values of commonly extracted body fluids
Body Fluids pH
Blood 7.4
Saliva 6.4
Ileum fluid 8.0
Serum 7.2
Stomach juice 1.5
Urine 5.8

To examine the performance of mRFP and amajLime under different pH, we inserted the biobricks into pSB1A2 and expressed them in E. coli C41(DE3) . mRFP and amajLime were then purified form lysed cells by anion exchange chromatography (AEC) and hydrophobic interaction chromatography (HIC).

Below picture shows the SDS–PAGE analysis of purification of amajLime (left) and mRFP (right).

F.1 to F.3 represents chronological order of elutions in HIC. Samples (10µl) were mixed with 10 µl 2X SDS gel-loading buffer and 10 µl of the mixture were loaded on the SDS-gel. The purest fraction, F.2 in both cases, were selected to proceed to pH stability test, where purified proteins were diluted in buffers in the range of pH 2-12 to a final concentration of 100 µg/mL, and the fluorescence intensity was recorded by BMG ClarioStar plate reader.

Shipping

Since iGEM requires standard backbone pSB1C3 for shipping, we later sub-cloned our biobricks into pSB1C3. Agarose electrophoresis and sequencing revealed that all biobricks were successfully inserted. Below showed our 1% agarose gel photo (our biobricks ~ 1000bp, pSB1C3 ~ 2000bp):


References:

1. Green AA, Silver PA, Collins JJ, Yin P. Toehold switches: de-novo-designed regulators of gene expression. Cell. 2014 Nov 6;159(4):925-39.
2. Lorenz, Ronny and Bernhart, Stephan H. and Höner zu Siederdissen, Christian and Tafer, Hakim and Flamm, Christoph and Stadler, Peter F. and Hofacker, Ivo L. ViennaRNA Package 2.0. Algorithms for Molecular Biology, 6:1 26, 2011,
3. Zhang Y et. al. Influenza Research Database: An integrated bioinformatics resource for influenza virus research. Nucleic Acids Res. 2017 Jan 4;45(D1):D466-D474.
4. Nordström K, Dasgupta S. Copy-number control of the Escherichia coli chromosome: a plasmidologist's view. EMBO Rep. 2006 May;7(5):484-9.
5. Schwalfenberg GK. The alkaline diet: is there evidence that an alkaline pH diet benefits health? J Environ Public Health. 2012;2012:727630.
6. Battad JM et al. A structural basis for the pH-dependent increase in fluorescence efficiency of chromoproteins. J Mol Biol. 2007 May 11;368(4):998-1010.