Tochingyuet (Talk | contribs) |
|||
(5 intermediate revisions by 4 users not shown) | |||
Line 77: | Line 77: | ||
<p style="font-family: roboto;font-size:115%;"> | <p style="font-family: roboto;font-size:115%;"> | ||
<center><img src="https://static.igem.org/mediawiki/2017/d/dc/CUHK_toeholdstructure.jpg" width="50%" height="auto"></center> | <center><img src="https://static.igem.org/mediawiki/2017/d/dc/CUHK_toeholdstructure.jpg" width="50%" height="auto"></center> | ||
+ | <p style="font-family: roboto;font-size:115%;"> | ||
The upper picture showed the general structure of our toehold switch (For detailed structure, please visit our <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Model"> modelling page</a>). mRFP(E1010) was chosen as the reporter of our toehold switches because it is very distinguishable by naked eyes while at the same time it can be quantified by measuring the fluorescence signal using a plate reader. The switch sequence generated by our program was linked with promoter(J23100) and reporter sequence. The trigger sequences was linked with promoter(J23100). Switches and triggers DNA were synthesized by IDT’s sponsored gBlock synthesis service. The gBlocks were used as template and amplified by PCR. The bands with correct size were gel-purified. We inserted the purified PCR products into pSB4C5 (for switch) or pSB1K3 (for trigger) using restriction cut and ligation. Sequencing results confirmed all 30 constructs were cloned. | The upper picture showed the general structure of our toehold switch (For detailed structure, please visit our <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Model"> modelling page</a>). mRFP(E1010) was chosen as the reporter of our toehold switches because it is very distinguishable by naked eyes while at the same time it can be quantified by measuring the fluorescence signal using a plate reader. The switch sequence generated by our program was linked with promoter(J23100) and reporter sequence. The trigger sequences was linked with promoter(J23100). Switches and triggers DNA were synthesized by IDT’s sponsored gBlock synthesis service. The gBlocks were used as template and amplified by PCR. The bands with correct size were gel-purified. We inserted the purified PCR products into pSB4C5 (for switch) or pSB1K3 (for trigger) using restriction cut and ligation. Sequencing results confirmed all 30 constructs were cloned. | ||
Line 100: | Line 101: | ||
<ol> | <ol> | ||
− | <table width=" | + | <table width="80%"> |
<tr> | <tr> | ||
Line 109: | Line 110: | ||
<tr> | <tr> | ||
<td>PB2-1</td> | <td>PB2-1</td> | ||
− | <td> | + | <td>AAACAUUGAAAAUAAGAGUACAUGAAGGAUAUGAGGAAUUCACAAUGGUUGGGCG |
− | <br> | + | <br>AAGAGCAACAGCCAUUCUAAGGAAAGCAACCAGAAGACUGAUCCAACUGAUAGUGAGUG |
+ | <br>GGAAAGUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>PB2-2</td> | <td>PB2-2</td> | ||
− | <td> | + | <td>CAAGGCAACCAAGAGGCUUACGGUGCUUGGGAAGGAUGCAGGUACAUUGAUGGAAG |
− | <br> | + | <br>ACCCGGACGAGGGAACAGCAGGAGUGGAAUCUGCAGUAUUGAGGGGAUUUCUGAUUCUG |
+ | <br>GGCAAUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>PB2-3</td> | <td>PB2-3</td> | ||
− | <td> | + | <td>AGAGUUAGUAAAAUGGGAGUAGAUGAAUAUUCCAGCACUGAGAGAGUGGUCGUGAG |
− | <br> | + | <br>UAUUGAUCGUUUCUUGAGGGUCCGAGACCAGAGGGGAAACGUACUCCUGUCUCCCGAAG |
+ | <br>AGGUUUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>H5-1</td> | <td>H5-1</td> | ||
− | <td> | + | <td>UAGGGAUAAUGCAAAGGAGCUUGGUAACGGUUGUUUCGAGUUCUAUCACAGAUGUG |
− | <br> | + | <br>AUAAUGAAUGUAUGGAAAGUGUAAGAAACGGAACGUAUGACUACCCUCAAUAUUCAGAAG |
+ | <br>AAGCUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>H5-2</td> | <td>H5-2</td> | ||
− | <td> | + | <td>AGUGGAGAAAAUCAAUCCAGCCAAUGACCUCUGUUAUCCAGGGAAUUUCAACGACU |
− | <br> | + | <br>AUGAAGAACUGAAACACCUAUUGAGCAGAAUAAACCAUUUUGAGAAAAUUCAGAUCAUUC |
+ | <br>CCAAUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>H5-3</td> | <td>H5-3</td> | ||
− | <td> | + | <td>CAUCAUAGCAACGAGCAGGGGAGUGGGUACGCUGCAGACAAAGAAUCCACUCAAAGG |
− | <br> | + | <br>GCUAUAGAUGGAGUCACCAAUAAGGUCAAUUCGAUCAUUGACAAAAUGAACACUCAGUUU |
+ | <br>GAGUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>N1-1</td> | <td>N1-1</td> | ||
− | <td> | + | <td>CAUCAUAGCAACGAGCAGGGGAGUGGGUACGCUGCAGACAAAGAAUCCACUCAAAGG |
− | <br> | + | <br>GCUAUAGAUGGAGUCACCAAUAAGGUCAAUUCGAUCAUUGACAAAAUGAACACUCAGUUU |
+ | <br>GAGUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>N1-2</td> | <td>N1-2</td> | ||
− | <td> | + | <td>GUUUUCAUUUAAAUACGGCAAUGGUGUUUGGAUCGGGAGAACCAAAAGCACUAAUU |
− | <br> | + | <br>CCAGGAGCGGCUUUGAAAUGAUUUGGGACCCAAAUGGGUGGACUGGAACGGACAGUAGC |
+ | <br>UUUUCUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>N1-3</td> | <td>N1-3</td> | ||
− | <td> | + | <td>AGAAGAUAAUAACCAUCGGAUCAAUCUGUAUGGUAAUUGGGAUAGCUAGCUUAAUG |
− | <br> | + | <br>UUACAAAUUGGAAACAUAAUCUCAAUAUGGAUCAGUCAUUCAAUUCAGACAGGGAACCAA |
+ | <br>UGCCUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>H7-1</td> | <td>H7-1</td> | ||
− | <td> | + | <td>ACACCAGAAUGCACAGGGAGAGGGAACUGCUGCAGAUUACAAAAGCACUCAAUCGGC |
− | <br> | + | <br>AAUUGAUCAAAUAACAGGGAAAUUAAACCGGCUUAUAGCAAAAACCAACCAACAAUUUGAG |
+ | <br>UUUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>H7-2</td> | <td>H7-2</td> | ||
− | <td> | + | <td>ACACAUUAACUGAAAGAGGAGUGGAAGUCGUCAAUGCAACUGAAACGGUGGAACGAAC |
− | <br> | + | <br>AAACAUCCCCCGGAUCUGCUCAAAAGGGAAAAGGACAGUUGAUCUCGGUCAAUGUGGACUC |
+ | <br>CUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>H7-3</td> | <td>H7-3</td> | ||
− | <td> | + | <td>AGUGGCUACAAAGAUGUGAUACUUUGGUUUAGCUUCGGGGCAUCAUGUUUCAUACUUC |
− | <br> | + | <br>UAGCCAUUGUAAUGGGCCUUGUCUUCAUAUGUGUAAAGAAUGGAAACAUGCGGUGCACUAU |
+ | <br>UUAGCGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>N9-1</td> | <td>N9-1</td> | ||
− | <td> | + | <td>UUAGUCACAAGAGAACCCUAUGUUUCAUGCAACCCAGAUGAAUGCAGGUUCUAUGCUCU |
− | <br> | + | <br>CAGCCAAGGAACAACAAUCAGAGGGAAACACUCAAACGGUACAAUACACGAUAGGUCCCAGUAG |
+ | <br>CGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>N9-2</td> | <td>N9-2</td> | ||
− | <td> | + | <td>AAUAACUUAACUAAAGGGCUCUGUACUAUAAAUUCGUGGCACAUAUAUGGGAAAGACAAU |
− | <br> | + | <br>GCAGUAAGAAUUGGAGAAAGCUCGGAUGUUUUAGUCACAAGAGAACCCUAUGUUUCAUGCUAG |
+ | <br>CGGCCGCUGCAGCUCGAG</td> | ||
<tr> | <tr> | ||
<td>N9-3</td> | <td>N9-3</td> | ||
− | <td> | + | <td>ACUACUUUAAAGAGGGGAAAAUAUUGAAAUGGGAGUCUCUGACUGGAACUGCUAAGCACAU |
− | <br> | + | <br>UGAAGAAUGCUCAUGUUACGGGGAACGAACAGGGAUUACCUGCACAUGCAAGGACAAUUUAGCG |
+ | <br>GCCGCUGCAGCUCGAG</td> | ||
Line 201: | Line 217: | ||
<br> | <br> | ||
<br> | <br> | ||
+ | <p style="font-family: roboto;font-size:115%;"> | ||
Below is a table with the information of the backbone: | Below is a table with the information of the backbone: | ||
<table width="79%"> | <table width="79%"> | ||
Line 274: | Line 291: | ||
<br> | <br> | ||
<br> | <br> | ||
− | Firstly, they use luciferase as reporter gene. We think that luciferase is not feasible to be used for on-site diagnosis since the luciferase activity need to be measured by a reader. Secondly, we inputted the sequences of those oral cancer biomarkers into our program and found that a better switch can be designed by choosing another region for detection (see <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Model"> modelling page</a>). Therefore, we improved their biobricks by using <i>in silico</i> design of switch and RFP as a reporter. | + | Firstly, they use luciferase as reporter gene. We think that luciferase is not feasible to be used for on-site diagnosis since the luciferase activity need to be measured by a reader. Secondly, their toehold switches did not worked as expected because the reporter expression was suppressed when trigger was added.Thirdly, we inputted the sequences of those oral cancer biomarkers into our program and found that a better switch can be designed by choosing another region for detection (see <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Model"> modelling page</a>). Therefore, we improved their biobricks by using <i>in silico</i> design of switch and RFP as a reporter. |
<br> | <br> | ||
<br> | <br> | ||
<p> <h3>Characterization of chromoproteins</h3> </p> | <p> <h3>Characterization of chromoproteins</h3> </p> | ||
<p style="font-family: roboto;font-size:115%;"> | <p style="font-family: roboto;font-size:115%;"> | ||
− | Different types of body fluid have different pH (5)(below figure). | + | Different types of body fluid have different pH (5)(below figure). Inspired by a <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/HP/Gold_Integrated"> medical expert</a> we interviewed, we would like to investigate if the pH in body fluid can interfere with the reporter protein we used in our test, since we are going to use body fluid as sample in our influenza diagnostic test. Fluorescent signal is known to be pH-dependent because pH can change the folding and conformation of the fluorophore, and ionization states can also cause shift in the Excitation/Emission spectra (6). Therefore, we characterized the fluorescence of 2 fluorescent proteins: <a href="http://parts.igem.org/Part:BBa_E1010"> mRFP(BBa_E1010) </a> and <a href="http://parts.igem.org/Part:BBa_K1033916"> amajLime(BBa_K1033916)</a> at different pH. We want to find out their optimum pH and see if they are suitable to be the reporter protein in our diagnostic test. |
<br> | <br> | ||
<br> | <br> | ||
Line 336: | Line 353: | ||
<br> | <br> | ||
− | Below picture shows the SDS–PAGE analysis of purification | + | Below picture shows the SDS–PAGE analysis of purification of amajLime (left) and mRFP (right). |
<center><img src="https://static.igem.org/mediawiki/2017/4/42/CUHK_SDSPAGE1.jpg" style="width:70%;height:auto;"></center> | <center><img src="https://static.igem.org/mediawiki/2017/4/42/CUHK_SDSPAGE1.jpg" style="width:70%;height:auto;"></center> |
Latest revision as of 20:57, 1 November 2017