Sven klumpe (Talk | contribs) |
|||
(9 intermediate revisions by 2 users not shown) | |||
Line 24: | Line 24: | ||
#myContent *{ | #myContent *{ | ||
− | color: # | + | color: #444444; |
} | } | ||
Line 88: | Line 88: | ||
Since we were both employing Cas13a as the molecular heart of our project, it made sense to | Since we were both employing Cas13a as the molecular heart of our project, it made sense to | ||
exchange data and experiences from wet lab experiments. At some point during a skype meeting, | exchange data and experiences from wet lab experiments. At some point during a skype meeting, | ||
− | we | + | we realised that we were doing similar things in the dry lab and thus, decided |
− | to | + | to collaborate and exchange ideas in that field as well. <br><br> |
</p> | </p> | ||
</td> | </td> | ||
Line 103: | Line 103: | ||
of crRNAs they used in their project with our developed software. Since the secondary | of crRNAs they used in their project with our developed software. Since the secondary | ||
structure of the crRNA is essential for its affinity to Cas13a, one can make assumptions | structure of the crRNA is essential for its affinity to Cas13a, one can make assumptions | ||
− | on RNase activity of the protein | + | on the post-binding RNase activity of the protein based on secondary structure predictions. |
− | We then | + | We then compared these predicted structures to secondary structures of crRNAs that have |
been shown to work experimentally. For the five crRNA sequences Team Delft provided, | been shown to work experimentally. For the five crRNA sequences Team Delft provided, | ||
the predicted secondary structure matched one of the secondary structures in our databank. | the predicted secondary structure matched one of the secondary structures in our databank. | ||
− | The only one that was not recognized by neither | + | The only one that was not recognized by neither the NUPACK nor the mFOLD databank was |
− | crRNA 2. | + | crRNA 2. It's predicted secondary structure in Vienna notation is depicted below: |
+ | </p> | ||
<pre> | <pre> | ||
GGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAAGACAGUCAUAAGUGCGGCGACGAU | GGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAAGACAGUCAUAAGUGCGGCGACGAU | ||
..(((((((((.((((.........)))).((......))..)))).))))).((....)).. | ..(((((((((.((((.........)))).((......))..)))).))))).((....)).. | ||
</pre> | </pre> | ||
+ | <p> | ||
It looks like the backbone structure needed in the first 35 bases is not constructed completely. | It looks like the backbone structure needed in the first 35 bases is not constructed completely. | ||
When looking at the graphical output of NUPACK depicted in Figure 1, however, it is visible that the binding probability | When looking at the graphical output of NUPACK depicted in Figure 1, however, it is visible that the binding probability | ||
Line 121: | Line 123: | ||
<img alt="LightbringerReal" src="https://static.igem.org/mediawiki/2017/b/bf/T--Munich--SoftwareCollaborationsPagePicture-mfe.png" width="500"> | <img alt="LightbringerReal" src="https://static.igem.org/mediawiki/2017/b/bf/T--Munich--SoftwareCollaborationsPagePicture-mfe.png" width="500"> | ||
<p> | <p> | ||
− | < | + | <b>Figure 1</b>: Graphical output of the secondary structure prediction of crRNA 2 in NUPACK. |
</p> | </p> | ||
</div> | </div> | ||
Line 127: | Line 129: | ||
<img alt="LightbringerReal" src="https://static.igem.org/mediawiki/2017/c/c9/T--Munich--SoftwareCollaborationsPagePicture-activity.png" width="500"> | <img alt="LightbringerReal" src="https://static.igem.org/mediawiki/2017/c/c9/T--Munich--SoftwareCollaborationsPagePicture-activity.png" width="500"> | ||
<p> | <p> | ||
− | < | + | <b>Figure 2</b>: Cleavage experiments of crRNA 2, crRNA 3 and crRNA 4 as provided by TU Delft. |
</p> | </p> | ||
</div> | </div> | ||
Line 133: | Line 135: | ||
Indeed, decreased activity using crRNA 2 in comparison to other crRNA is observed when performing experiments using | Indeed, decreased activity using crRNA 2 in comparison to other crRNA is observed when performing experiments using | ||
these crRNA designs. Though this has to be treated with caution since crRNA 4's secondary structure was predicted | these crRNA designs. Though this has to be treated with caution since crRNA 4's secondary structure was predicted | ||
− | to be correct but the Cas13a-crRNA | + | to be correct but the Cas13a-crRNA complex of that crRNA does not show higher activity. We conclude that further testing |
of the software has to be done to show whether it can predict activity of Cas13a. <br><br> | of the software has to be done to show whether it can predict activity of Cas13a. <br><br> | ||
− | |||
</p> | </p> | ||
</td> | </td> | ||
Line 144: | Line 145: | ||
<p> | <p> | ||
Furthermore, in order to determine off-target effects, we constructed a database from Transcriptome data obtained | Furthermore, in order to determine off-target effects, we constructed a database from Transcriptome data obtained | ||
− | from the Ensembl and | + | from the Ensembl and Ensembl Bacteria databank. We tried to make the search as tailor-made to the Delft project as |
possible and thus considered species that were relevant to their project of detecting bacterial resistances related | possible and thus considered species that were relevant to their project of detecting bacterial resistances related | ||
to cattle and milk production. The included species were: | to cattle and milk production. The included species were: | ||
Line 159: | Line 160: | ||
<li>Streptococcus pneumoniae</li> | <li>Streptococcus pneumoniae</li> | ||
</ol> | </ol> | ||
− | |||
<br> | <br> | ||
+ | <p> | ||
Three of the five crRNAs showed no off-targets in the constructed database. For crRNA 3 and crRNA 4, | Three of the five crRNAs showed no off-targets in the constructed database. For crRNA 3 and crRNA 4, | ||
possible off-targets were detected but just as a result of the identity parameter being rather low | possible off-targets were detected but just as a result of the identity parameter being rather low | ||
Line 166: | Line 167: | ||
identical enough to show any RNase activity of Cas13a since the 28 bases target is specific to up to 2 mutations, | identical enough to show any RNase activity of Cas13a since the 28 bases target is specific to up to 2 mutations, | ||
but all the hits that have been found are with a match of 17 bases far from the 28 bases long. | but all the hits that have been found are with a match of 17 bases far from the 28 bases long. | ||
− | < | + | </p> |
+ | <p> | ||
Finally, we can conclude that our software did not find any problems in the crRNA design of Team Delft. | Finally, we can conclude that our software did not find any problems in the crRNA design of Team Delft. | ||
It seems that their constructs will most probably show activity and, at least for the mentioned species, | It seems that their constructs will most probably show activity and, at least for the mentioned species, | ||
it will not show any off-target effects. | it will not show any off-target effects. | ||
− | + | </p> | |
</p> | </p> | ||
Line 179: | Line 181: | ||
<h3>From TU Delft</h3> | <h3>From TU Delft</h3> | ||
<p> | <p> | ||
− | The TU Delft team developed | + | The TU Delft team developed a simulation code for modeling the on and off-target |
activities for sequences on all possible frames on the genome. In this, they employ a kinetic model | activities for sequences on all possible frames on the genome. In this, they employ a kinetic model | ||
by Depken et al. in 2017 to determine whether off-target activities are high enough to give a false positive | by Depken et al. in 2017 to determine whether off-target activities are high enough to give a false positive | ||
collateral RNase activity of the Cas13a protein. They deducted from these model cleavage probabilities | collateral RNase activity of the Cas13a protein. They deducted from these model cleavage probabilities | ||
for different crRNA sequences and could thus make statements of the possibility to distinguish | for different crRNA sequences and could thus make statements of the possibility to distinguish | ||
− | between our two bacterial targets, the | + | between our two bacterial targets, the 16S rRNA of <i>E. Coli</i> and <i>B. subtillis</i>. By running the crRNA |
against both genomes of these species, they determined the off-target probability to be very low for all our crRNA | against both genomes of these species, they determined the off-target probability to be very low for all our crRNA | ||
− | design as shown in Figure 3. Thus, | + | design as shown in <b>Figure 3</b>. Thus, they deduced from these that our crRNA design would be able to differentiate between <i>E. Coli</i> and <i>B. subtilis</i>. |
− | they deduced from these that our crRNA design would be able to differentiate between <i>E. Coli</i> and <i>B. subtilis</i>. | + | |
</p> | </p> | ||
Line 193: | Line 194: | ||
<img alt="LightbringerReal" src="https://static.igem.org/mediawiki/2017/4/40/T--Munich--SoftwareCollaborationsPagePicture-cleavage.png" width="700"> | <img alt="LightbringerReal" src="https://static.igem.org/mediawiki/2017/4/40/T--Munich--SoftwareCollaborationsPagePicture-cleavage.png" width="700"> | ||
<p> | <p> | ||
− | < | + | <b>Figure 3:</b> Off-target probability of activation of the Cas13a protein for our crRNAs sensing <i>E.Coli (1.3)</i> and <i>B. subtillis</i> |
crRNA 1-3 are taken into one since the spacer sequence of the crRNA was identical for these constructs. | crRNA 1-3 are taken into one since the spacer sequence of the crRNA was identical for these constructs. | ||
</p> | </p> | ||
Line 201: | Line 202: | ||
<p> | <p> | ||
<br><br> | <br><br> | ||
− | We would like to thank Team Delft for the fun collaboration and | + | We would like to thank Team Delft for the fun collaboration and wish you all the best for your project. |
− | We are looking forward to seeing | + | We are looking forward to seeing you in Boston. |
</p> | </p> | ||
</td> | </td> |
Latest revision as of 23:17, 1 November 2017