Difference between revisions of "Team:Munich/Improve"

 
(59 intermediate revisions by 5 users not shown)
Line 49: Line 49:
 
</td>
 
</td>
 
<td id="myContent" width="20%" valign=top align=center>
 
<td id="myContent" width="20%" valign=top align=center>
 +
<a href="#-">
 +
<div class="popup" id="OH_PCR_Experiment_Popup">
 +
<img  src="https://static.igem.org/mediawiki/2017/1/1b/T--Munich--Improve_TEV_OH_PCR.png">
 +
</div></a>
 +
<a href="#-">
 +
<div class="popup" id="TEV_SEC_Popup">
 +
<img  src="https://static.igem.org/mediawiki/2017/f/f1/T--Munich--Improve_TEV_SEC_SDS.png">
 +
</div></a>
 +
<a href="#-">
 +
<div class="popup" id="TEV_Activity_Popup">
 +
<img  src="https://static.igem.org/mediawiki/2017/6/6b/T--Munich--Improve_TEV_Cleavage_final.png">
 +
</div></a>
 
<br>
 
<br>
 
<!-- Head End -->
 
<!-- Head End -->
 
<!-- Content Begin -->
 
<!-- Content Begin -->
−
<img id="TopPicture" width="960" src="https://static.igem.org/mediawiki/2017/b/be/T--Munich--FrontPagePictures_Attributions.jpg">
+
<img id="TopPicture" width="960" src="https://static.igem.org/mediawiki/2017/c/cd/T--Munich--FrontPagePictures_ImprovedPart.jpg">
 
<table width="960" border=0 cellspacing=0 cellpadding=10>
 
<table width="960" border=0 cellspacing=0 cellpadding=10>
 
<tr>
 
<tr>
Line 63: Line 75:
 
</tr>
 
</tr>
 
<tr><td colspan=6 align=left valign=center>
 
<tr><td colspan=6 align=left valign=center>
−
<font size=7><b style="color: #51a7f9">Improved part:</b></font>
+
<font size=7><b style="color: #51a7f9">Improved part</b></font>
 
</td>
 
</td>
 
</tr>
 
</tr>
Line 70: Line 82:
 
         <h3 class="introduction">The Tobacco Etch Virus (TEV) protease with 6x His-tag</h3>
 
         <h3 class="introduction">The Tobacco Etch Virus (TEV) protease with 6x His-tag</h3>
 
<p>
 
<p>
−
The (+)-strand RNA genomes are often translated by the host to polyprotein precursors, which are then co-translationally cleaved by therefore provided proteases into the mature proteins. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV)<sup><a class="myLink" href="#ref_1">1</a></sup>.  
+
The (+)-strand viral RNA genomes are often translated by the host to polyprotein. Then the virus provides protease to cleave these precursors into mature proteins co-translationally. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV)<sup><a class="myLink" href="#ref_1">1</a></sup>.  
 
                 </p>
 
                 </p>
 
<p>
 
<p>
−
or scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. We improved the BioBrick <a class="myLink" href="http://parts.igem.org/Part:BBa_K1319008">BBa_K1319008</a> by adding a 6x His-tag, which made it possible to purify this protease.  
+
For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. <b>We improved the BioBrick <a class="myLink" href="http://parts.igem.org/Part:BBa_K1319008">BBa_K1319008</a> by adding a His<sub>6</sub>-tag, which made it possible to purify this protease. </b> We show here the characterization of our improved BioBrick, but the completed details are available in the Registry page: <a class="myLink" href="http://parts.igem.org/Part:BBa_K2323002">BBa_K2323002</a>.
 
                 </p>
 
                 </p>
  
Line 83: Line 95:
 
<h3>TEV protease cloning</h3>
 
<h3>TEV protease cloning</h3>
 
<p>   
 
<p>   
−
The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.</p>
+
The His<sub>6</sub>-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev. </p>
 
<div class="captionPicture">
 
<div class="captionPicture">
 
<table class="anActualTable">
 
<table class="anActualTable">
−
     <tr><td>p-TEV-His-fwd:</td><td>catcatcaccatcaccacgccggcggcgaaagc</td></tr>
+
     <tr><td>5'-3' p-TEV-His-fwd:</td><td>catcatcaccatcaccacgccggcggcgaaagc</td></tr>
−
     <tr><td>p-TEV-His-rev:</td><td>catctagtatttctcctctttctctagtatctccc</td></tr>
+
     <tr><td>5'-3' p-TEV-His-rev:</td><td>catctagtatttctcctctttctctagtatctccc</td></tr>
 
</table>
 
</table>
−
<p>
+
 
−
5'-3' primers sequences
+
−
</p>
+
 
</div>
 
</div>
 
<div class="captionPicture">
 
<div class="captionPicture">
 
<img height=400 src="https://static.igem.org/mediawiki/2017/3/36/T--Munich--Improve_Plasmid_Map.svg">
 
<img height=400 src="https://static.igem.org/mediawiki/2017/3/36/T--Munich--Improve_Plasmid_Map.svg">
−
<p>
+
<p><b>Figure 1:</b>The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p>
−
The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS.
+
−
</p>
+
 
</div>
 
</div>
 
</td>
 
</td>
Line 103: Line 111:
  
  
−
<tr><td align=center valign=center colspan=6>
+
<tr><td class="verticalColumn" align=center valign=center colspan=3>
 
<p>   
 
<p>   
−
After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in <i>E. coli</i> DH5&alpha for plasmid storage and <i>E. coli</i> BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via <a class="myLink" href="/Team:Munich/Protocols">affinity and size exclusion chromatography</a>.
+
After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in <i>E. coli</i> DH5α for plasmid storage and <i>E. coli</i> BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via <a class="myLink" href="/Team:Munich/Protocols">affinity and size exclusion chromatography</a>.
 
</p>
 
</p>
−
<img width=400  src="https://static.igem.org/mediawiki/2017/1/1b/T--Munich--Improve_TEV_OH_PCR.png">
+
<div class="captionPicture">
 +
<a href="#TEV_SEC_Popup"><img height=300 src="https://static.igem.org/mediawiki/2017/f/f1/T--Munich--Improve_TEV_SEC_SDS.png"></a>
 +
<p><b>Figure 2:</b> The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p>
 +
</div>
 
</td>
 
</td>
−
</tr>
+
<td colspan=3 align=center valign=center>
  
−
<tr><td align=center valign=center colspan=6>
 
 
<div class="captionPicture">
 
<div class="captionPicture">
−
<img height=400 src="https://static.igem.org/mediawiki/2017/b/b1/T--Munich--Improve_His_TEV.svg">
+
<a href="#OH_PCR_Experiment_Popup"><img width=300  src="https://static.igem.org/mediawiki/2017/1/1b/T--Munich--Improve_TEV_OH_PCR.png"></a>
−
<p>
+
<p><b>Figure 3:</b> PCR overhang for TEV His-tag</p>
−
Affinity purification of His-TEV using the Äkta protein purification system.
+
−
</p>
+
 
</div>
 
</div>
 +
 
</td>
 
</td>
−
</tr>  
+
</tr>
  
 
<tr><td align=center valign=center colspan=6>
 
<tr><td align=center valign=center colspan=6>
 
<div class="captionPicture">
 
<div class="captionPicture">
−
<img height=300 src="https://static.igem.org/mediawiki/2017/a/a1/T--Munich--Improve_His_TEV_gel_1.png">
+
<img height=600 src="https://static.igem.org/mediawiki/2017/c/c1/T--Munich--Improve_TEV_SEC.svg">
−
<img height=300 src="https://static.igem.org/mediawiki/2017/d/d4/T--Munich--Improve_His_TEV_gel_2.png">
+
<p><b>Figure 4:</b> The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p>
−
<p>
+
−
10 % SDS-PAGE of affinity purification of the His-TEV protease.
+
−
</p>
+
 
</div>
 
</div>
 
</td>
 
</td>
−
</tr>  
+
</tr>
−
 
+
<tr><td align=center valign=center colspan=6>
−
 
+
<p>  
−
<tr><td colspan=3 align=center valign=center>
+
The gel images show the purity of the TEV protease. We stored the sample in TEV storage buffer at -80 °C.
−
<p> 
+
−
<b>AeBlue</b>: The RNA strand in a specially designed RNA/DNA dimer is cut by Cas13a's collateral
+
−
activity. After digestion, the interaction between the two strands is too weak to hold the dimer and it
+
−
decays. We can then use the DNA-strand as template to translate the chromoprotein <a href="http://parts.igem.org/Part:BBa_K864401">aeBlue</a>.
+
−
</p>
+
−
</td>
+
−
<td colspan=3 align=center valign=center>
+
−
<img src="https://static.igem.org/mediawiki/2017/9/90/T--Munich--Description_aeBlue.svg" width=360>
+
−
</td>
+
−
</tr>
+
−
 
+
−
<tr>
+
−
<td colspan=3 align=center valign=center>
+
−
<img src="https://static.igem.org/mediawiki/2017/6/64/T--Munich--Description_Intein_Extein.svg" width=360>
+
−
</td>
+
−
<td colspan=3 align=center valign=center>
+
−
<p>
+
−
<b>Intein-Extein</b>: By binding TEV-protease with a RNA-linker we can use Cas13a's collateral activity
+
−
to regulate the protease's diffusion and use it to cleave a TEV tag separating the intein regions of a
+
−
modified chromophore. After the first cleavage, the intein segment excises itself<sup><a class="myLink" href="#ref_13">13</a></sup>, bringing together the
+
−
halves of the chromophore. Only then is the chromophore functional and produces the colorimetric
+
−
read-out.
+
−
</p>
+
−
</td>
+
−
</tr>
+
−
 
+
−
<tr class="lastRow"><td colspan=3 align=center valign=center>
+
−
<p> 
+
−
<b>Gold nanoparticles</b>: Other than in the other two colorimetric readouts, aeB lue and Intein-Extein, the only protein involved in the gold nanoparticle (AuNP)-readout is Cas13a, like in our RNase Alert readout. This reduces the necessary fine tuning of the biochemical circuit to a minimum, favoring high robustness of the readout. Due to the phenomenon of Localized Surface Plasmon Resonance, AuNPs appear in a distinct color, ranging from intense red to blue, black and colorless. This property depends on particle size, shape, the immediate environment, and -most critical for our purpose- aggregation state<sup><a class="myLink" href="#ref_14">14</a></sup>.
+
−
</p>
+
−
<p> . In our project we use AuNPs with a diameter of roughly 10 nm, giving them a bright red color in solution. Their small size and therefore high surface-to-volume ratio makes them ideal for functionalization with thiolated compounds, forming covalent Au-S bonds. The first step of our concept is to use these properties to functionalize AuNPs with either 5’- or 3’- thiolated DNA and, through addition of linker- RNA which hybridizes with both thiolated DNA strands, form aggregates, changing the color from red to blue. The design of the linker-RNA includes an uracil-rich, single-stranded segment between the DNA-complementary termini, making it prone to Cas13a-mediated promiscuous cleavage. .
+
−
</p>
+
−
<p>
+
−
It has been shown that, for purely DNA-based hybridization, AuNP aggregates can be spotted on filter paper, dried and severed by addition of a nuclease-containing solution, visible through diffusion of red AuNPs on the paper. Thus, the second part of our concept is to spot RNA-linked AuNPs on paper, dry them alongside the Cas13a mixture and detect specific target RNAs and resulting Cas13a activity with a simple change from blue to red.
+
−
</p>
+
−
</td>
+
−
<td colspan=3 align=center valign=center>
+
−
<img src="https://static.igem.org/mediawiki/2017/b/b3/T--Munich--Description_Goldnanoparticles.svg" width=360>
+
−
 
+
−
</td>
+
−
</tr>
+
−
 
+
−
<tr><td colspan=6 align=center valign=center>
+
−
<h3>Software</h3>
+
−
<p> 
+
−
To help facilitate the design of crRNA, the sequences that give CascAID its specificity, we developed a
+
−
software tool that checks crRNA for unwanted secondary structures. This gives valuable insight on
+
−
whether the sequence is suited to use with Cas13a or whether some modifications are needed.
+
−
Together with Team Delft's software tool which designs the corresponding crRNA based on the target,
+
−
we collaborated to develop a powerful tool that suggests crRNA sequences and checks their usability
+
 
</p>
 
</p>
 
</td>
 
</td>
 
</tr>
 
</tr>
  
−
<tr><td colspan=6 align=center valign=center>
+
<tr><td align=center valign=center colspan=6>
−
<h3>References</h3>
+
 
<p>  
 
<p>  
−
    <ol style="text-align: left">
+
For an activity test, we incubated 30 µg His-MBP-Cas13a-Lsh as substrate with 1 µg of our TEV protease. We inactivated the cleavage reaction by adding 1x SDS-loading buffer. We analyzed the reaction with a SDS-PAGE and loaded samples, which were incubated 0, 1, 2, 3, 4 ,5 and overnight. The gel shows that nearly all our substrate is already cleaved after 1 h into His-MBP and Cas13a-Lsh.
−
      <li id="ref_1">Cohen, Limor, and David R. Walt. "Single-Molecule Arrays for Protein and Nucleic Acid Analysis." Annual Review of Analytical Chemistry 0 (2017).</li>
+
−
      <li id="ref_2">Nakano, Michihiko, et al. "Single-molecule PCR using water-in-oil emulsion." Journal of biotechnology 102.2 (2003): 117-124.</li>
+
−
      <li id="ref_3">Taniguchi, Yuichi, et al. "Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells." science 329.5991 (2010): 533-538.</li>
+
−
      <li id="ref_4">Rissin, David M., et al. "Single-molecule enzyme-linked immunosorbent assay detects serum proteins at subfemtomolar concentrations." Nature biotechnology 28.6 (2010): 595-599.</li>
+
−
      <li id="ref_5">Pardee, Keith, et al. "Rapid, low-cost detection of Zika virus using programmable biomolecular components." Cell 165.5 (2016): 1255-1266.</li>
+
−
      <li id="ref_6">Slomovic, Shimyn, Keith Pardee, and James J. Collins. "Synthetic biology devices for in vitro and in vivo diagnostics." Proceedings of the National Academy of Sciences 112.47 (2015): 14429-14435.</li>
+
−
      <li id="ref_7">Tang, Ruihua, et al. "A fully disposable and integrated paper-based device for nucleic acid extraction, amplification and detection." Lab on a Chip 17.7 (2017): 1270-1279.</li>
+
−
      <li id="ref_8">Vashist, Sandeep Kumar, et al. "Emerging technologies for next-generation point-of-care testing." Trends in biotechnology 33.11 (2015): 692-705.</li>
+
−
      <li id="ref_9">Gubala, Vladimir, et al. "Point of care diagnostics: status and future." Analytical chemistry 84.2 (2011): 487-515.</li>
+
−
      <li id="ref_10">Abudayyeh, Omar O., et al. "C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector." Science 353.6299 (2016): aaf5573.</li>
+
−
      <li id="ref_11">Gootenberg, Jonathan S., et al. "Nucleic acid detection with CRISPR-Cas13a/C2c2." Science (2017): eaam9321.</li>
+
−
      <li id="ref_12">https://www.idtdna.com/pages/docs/technical-reports/in_vitro_nuclease_detectionD325FDB69855.pdf (retrieved: 13.10.17)</li>
+
−
      <li id="ref_13"> Anraku, Yasuhiro, Ryuta Mizutani, and Yoshinori Satow. "Protein splicing: its discovery and structural insight into novel chemical mechanisms." IUBMB life 57.8 (2005): 563-574.</li>
+
−
      <li id="ref_14">Link, Stephan, and Mostafa A. El-Sayed. "Size and temperature dependence of the plasmon absorption of colloidal gold nanoparticles." The Journal of Physical Chemistry B 103.21 (1999): 4212-4217.</li>
+
−
      <li id="ref_15">Zhao, W., Ali, M.M., Aguirre, S.D., Brook, M.A., and Li, Y. (2008). "Paper-based bioassays using gold nanoparticle colorimetric probes." Analytical Chemistry 80, 8431–8437.</li>
+
−
    </ol>
+
 
</p>
 
</p>
−
</td>
+
<div class="captionPicture">
 +
<a href="#TEV_Activity_Popup"><img width=600  src="https://static.igem.org/mediawiki/2017/6/6b/T--Munich--Improve_TEV_Cleavage_final.png"></a>
 +
<p><b> Figure 5:</b> The SDS-PAGE showing the cleavage of our substrate after respective incubation time</p>
 +
</div>
 +
<p>Next, the activity should be analyzed between 0 and 1 h to correctly evaluate the results.  However, we highly purified our His-TEV protease and also used it successfully to process our Cas13a proteins. Here, we provide a BioBrick, which could be useful for all future iGEM teams.</p>
 
</tr>
 
</tr>
−
 
−
 
  
  

Latest revision as of 03:26, 2 November 2017

Description

Design

Demonstrate

Measurement

Applied Design

Final Results

Achievements

Protocols

Notebook

Safety

Parts

Improved Part

Part Collection

InterLab

Model

Software

Collaboration

Detector

Quake Valve

Paperstrips

Sample Processing

Silver

Gold

Engagement

Collaborations

Team members

Sponsors

Attributions

Gallery

Improved part

The Tobacco Etch Virus (TEV) protease with 6x His-tag

The (+)-strand viral RNA genomes are often translated by the host to polyprotein. Then the virus provides protease to cleave these precursors into mature proteins co-translationally. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV)1.

For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. We improved the BioBrick BBa_K1319008 by adding a His6-tag, which made it possible to purify this protease. We show here the characterization of our improved BioBrick, but the completed details are available in the Registry page: BBa_K2323002.

TEV protease cloning

The His6-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.

5'-3' p-TEV-His-fwd:catcatcaccatcaccacgccggcggcgaaagc
5'-3' p-TEV-His-rev:catctagtatttctcctctttctctagtatctccc

Figure 1:The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS

After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in E. coli DH5α for plasmid storage and E. coli BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via affinity and size exclusion chromatography.

Figure 2: The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS

Figure 3: PCR overhang for TEV His-tag

Figure 4: The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS

The gel images show the purity of the TEV protease. We stored the sample in TEV storage buffer at -80 °C.

For an activity test, we incubated 30 µg His-MBP-Cas13a-Lsh as substrate with 1 µg of our TEV protease. We inactivated the cleavage reaction by adding 1x SDS-loading buffer. We analyzed the reaction with a SDS-PAGE and loaded samples, which were incubated 0, 1, 2, 3, 4 ,5 and overnight. The gel shows that nearly all our substrate is already cleaved after 1 h into His-MBP and Cas13a-Lsh.

Figure 5: The SDS-PAGE showing the cleavage of our substrate after respective incubation time

Next, the activity should be analyzed between 0 and 1 h to correctly evaluate the results. However, we highly purified our His-TEV protease and also used it successfully to process our Cas13a proteins. Here, we provide a BioBrick, which could be useful for all future iGEM teams.